Skip to main content
NCBI home page
Frontiers in Plant Science logoLink to Frontiers in Plant Science
. 2012 Jul 26;3:165. doi: 10.3389/fpls.2012.00165

A Survey of MicroRNA Length Variants Contributing to miRNome Complexity in Peach (Prunus Persica L.)

Moreno Colaiacovo 1,†, Letizia Bernardo 1,†, Isabella Centomani 1, Cristina Crosatti 1, Lorenzo Giusti 1, Luigi Orrù 1, Gianni Tacconi 1, Antonella Lamontanara 1, Luigi Cattivelli 1, Primetta Faccioli 1,*
PMCID: PMC3405489  PMID: 22855688

Abstract

MicroRNAs (miRNAs) are short non-coding RNA molecules produced from hairpin structures and involved in gene expression regulation with major roles in plant development and stress response. Although each annotated miRNA in miRBase (www.mirbase.org) is a single defined sequence with no further details on possible variable sequence length, isomiRs – namely the population of variants of miRNAs coming from the same precursors – have been identified in several species and could represent a way of broadening the regulatory network of the cell. Next-gen-based sequencing makes it possible to comprehensively and accurately assess the entire miRNA repertoire including isomiRs. The aim of this work was to survey the complexity of the peach miRNome by carrying out Illumina high-throughput sequencing of miRNAs in three replicates of five biological samples arising from a set of different peach organs and/or phenological stages. Three hundred-ninety-two isomiRs (miRNA and miRNA*-related) corresponding to 26 putative miRNA coding loci, have been highlighted by mirDeep-P and analyzed. The presence of the same isomiRs in different biological replicates of a sample and in different tissues demonstrates that the generation of most of the detected isomiRs is not random. The degree of mature sequence heterogeneity is very different for each individual locus. Results obtained in the present work can thus contribute to a deeper view of the miRNome complexity and to better explore the mechanism of action of these tiny regulators.

Keywords: microRNA, isomiRs, next generation sequencing

Introduction

MicroRNAs (miRNAs) are short non-coding RNA molecules produced from hairpin structures and involved in gene expression regulation with major roles in plant development and stress response. MiRNAs are transcribed into a primary transcript which folds into a bulge with stem-loop conformation that is then cleaved by a Dicer-like (DCL) RNase III enzyme named DCL1. The cleavage results in a short duplex: one of the two strands forming the duplex and designated as miRNA* is then typically degraded while the other strand is incorporated into the RNA-induced silencing (RISC) complex where it mediates mRNA recognition and cleavage or translational repression (Jones-Rhoades et al., 2006; Voinnet, 2009; Xie et al., 2010).

Although each annotated miRNA in miRBase1 is a single defined sequence with no further details on possible variable sequence length, isomiRs – namely the population of variants of miRNAs coming from the same precursors – have been identified in several species and could represent a way of broadening the cell regulatory network (Ebhardt et al., 2009; Guo and Lu, 2010).

Vaucheret (2009) demonstrated the biological significance of mature miRNA length heterogeneity in Arabidopsis where the ath-miR168 can be processed as two different miRNA isoforms of 21 nt and 22 nt in length with different activities on AGO1 homeostasis (AGO1 is the Argonaute1 protein, a component of RISC complex that catalyzes broad miRNA- and siRNA-guided mRNA cleavage and translation repression Voinnet, 2009).

Alteration in miRNA end sequences can have strong effects on miRNA function due to the fact that the identity of the first 5′ nucleotide is the major determinant for AGO protein association (Takeda et al., 2008). As an example, Mi et al. (2008) found that AGO1 (which predominates in the miRNAs-mediated pathway) harbors miRNAs that favor a 5′ terminal uridine. A change at the 5′ terminal nucleotide of a miRNA predictably redirected it into a different AGO complex and altered its biological activity. Additionally, it was reported that the thermodynamic stability at the 5′ end of the strand is likely to affect the loading in the AGO complex (Eamens et al., 2009).

An accurate profile of the entire miRNA population of a biological sample provides useful information on miRNA activity and it can be used to compare the distribution of miRNA sequence variants in different samples. In fact, although the distribution of isomiRs across samples has been previously shown to be generally similar, examples in which the dominant isomiR is different from sample to sample have been found in animals (Lee et al., 2012) and could imply a functional role for specific isomiR sequences, besides affecting the accuracy and consistency of miRNA measurement.

This work aims to survey, by carrying out Illumina high-throughput sequencing, the complexity of peach miRNome through the analysis of the miRNA population of a set of samples representative of different tissues and developmental stages.

Materials and Methods

Plant material and RNA extraction

A 12-year-old tree grafted on wild seedling of the yellow-fleshed cv. Maycrest (Prunus persica (L.) Batsch), grown in Palazzolo di Sona, Verona, Italy (45.457°N, 10.822°E), was used as plant source material. Each sample was collected pooling together material from three different branches of the same plant. Four phenological stages (Chapman and Catlin, 1976) were considered: swollen bud, half-inch green, pink, bloom. Leaf and flower swollen buds were collected 41 days before flowering (DBF), half-inch leaves were collected 21 DBF, pink flower buds were collected six DBF. Codes were assigned to each samples: BF, pink; F, bloom; GF, swollen flower bud; O, half-inch green; GL, swollen leaf bud. Tissues were frozen in liquid nitrogen immediately after drawing. Total RNA was extracted from three independent samples with the Plant Total RNA Purification Kit (NORGEN Biotek Corp., Thorold, ON, Canada) following manufacturer instructions. RNA quality and concentration were evaluated with the Agilent 2100 Bioanalyzer RNA 6000 Nano assay (Agilent Technologies, Santa Clara, CA, USA).

Small RNA libraries construction and sequencing

Preparation of small RNA libraries was performed with the TruSeq Small RNA Sample Prep Kit (Illumina, San Diego, CA, USA) following manufacturer instructions. Briefly, 1 μg of total RNA was ligated with adapters at 3′ and 5′ ends, without any size fractionation. Adapter-ligated RNA was reverse-transcribed with SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA), then PCR-amplified (15 cycles). Samples were barcoded using 15 variants of the reverse primer provided with the kit. Libraries were pooled together and then purified on a 6% TBE PAGE gel after electrophoresis. Libraries quality and concentration were evaluated with the Agilent 2100 Bioanalyzer DNA 1000 assay. The obtained cDNAs were sequenced using the Illumina Genome Analyzer IIx.

Data analysis

Reads were filtered with UEA sRNA plant toolkit2 (Moxon et al., 2008) to remove adaptor sequences, reads shorter than 18 nt or longer than 24, low-complexity reads, reads matching rRNAs or tRNAs and reads that did not match the peach genomic sequence available at “The International Peach Genome Initiative – www.rosaceae.org/peach/genome” (only those sequences with a full-length perfect match to the selected genome were retained). Reads from one replicate (randomly chosen) of each biological sample were then analyzed with the software miRDeep-P (Yang and Li, 2011, default parameters) to identify miRNA loci expressed in all the five tested samples (GF, GL, B, F, O). Reads associated to these loci were then also screened in the remaining two replicates.

Read counts for each variant were divided by the total number of reads with a match in the peach genome in each sample and normalized to 1,000,000 reads. Reads that could be related to more than one locus were assigned by MiRDeep-P to all possible involved loci.

IsomiRs for each putative locus were blasted against miRBase (release 18) to search for the loci related to previously known miRNAs (Kozomara and Griffith-Jones, 2011). Blast vs. mature sequences was based on the following parameters: outfmt 6, task blastn, dust “no,” e-value 10, word_size 7, reward 2, num_alignments 10. Blast vs. precursor sequences was based on the following parameters: outfmt 6, task blastn, dust “no,” e-value 10e−3, num_alignments 10.

The correlation between biological replicates was evaluated by calculating the Pearson coefficient for all the possible pairs of replicates belonging to the same biological sample, as well as samples from different tissues for sake of comparison. We decided to remove from the set a sequence (HE860285) whose expression level was abnormally high, because its presence caused the Pearson correlation to be almost one in every comparison, irrespective of the tissue.

To identify miRNAs isomiRs that were differentially expressed among the biological samples, a t-test was performed for all the possible comparisons. An isomiR was considered as differentially expressed in a specific comparison if its p-value was less than 0.05. The whole set of reads associated with the miRNA loci was then used to perform a hierarchical clustering with R software, by applying the Canberra metric to calculate the distances between the expression vectors of the samples across the reads.

MiRNA target identification was carried out by psRNATarget3 (Dai and Zhao, 2011), with default parameters. To score the complementarity between small RNA and their target transcript, psRNATarget applies the scoring schema of miRU by Zhang (2005). The maximum expectation is the threshold of the score. A small RNA/target site pair will be discarded if its score is greater than the threshold. The default cut-off threshold is 3.0.

The accessibility of the mRNA target site to small RNA has been identified as one of the important factors involved in target recognition because the secondary structure (stem, etc.) around the target site will prevent the small RNA and mRNA target from contacting. The psRNATarget server employes RNAup to calculate target accessibility, which is represented by the energy required to open (unpair) secondary structure around the target site (usually the complementary region with small RNA and up/downstream) on target mRNA. The lower the energy the higher the possibility that small RNA is able to contact (and cleave) target mRNA. PsRNATarget uses a software, namely RNAup, described by Mückstein et al. (2006) to calculate this value, denoted as UPE.

All the miRNA-related sequences were submitted to the EMBL database, whereas the sequencing raw reads were submitted to the NCBI SRA (BioProject accession: PRJNA167962).

Results

Sequencing peach small RNA libraries

Illumina deep sequencing was used to profile the whole miRNA set of five different samples corresponding to different organs and/or phenological stages. Three replicates were analyzed for each sample. A total number of 40,764,330 sequence reads were obtained and filtered as reported in Section “Materials and Methods.” Details on the results of each filtering step are reported in Table 1. On average, 2,717,622 raw reads and 664,777 clean reads perfectly matching the genome were obtained in each of the 15 samples.

Table 1.

Reports the number of filtered reads perfectly matching the peach genome in each of the tested samples.

Sample Raw reads Matching adaptors Matching adaptors (18–24 nt) Low-complexity filtered (non-redundant) rRNA/tRNA removed (non-redundant) Matching peach genome (non-redundant)
BF1 2842653 2332661 1592671 1582689 (356161) 1335567 (333478) 797297 (207233)
BF2 2553116 2124140 1570583 1560824 (370103) 1401892 (351620) 817438 (220223)
BF3 2641037 2184480 1646360 1635958 (387915) 1466005 (368373) 853043 (235873)
F1 2523898 1819981 1180424 1173273 (215571) 858130 (194546) 368958 (78332)
F2 2898014 2361457 1389585 1381108 (233414) 1040918 (214222) 630870 (115644)
F3 3613383 2923242 1768783 1757830 (320484) 1362239 (297258) 700729 (143030)
GF1 2696289 2170904 1354915 1346476 (307349) 1200810 (289976) 774146 (190043)
GF2 3722325 2848155 1962881 1950819 (429497) 1570664 (405303) 928251 (248399)
GF3 2952035 2254276 1327544 1319295 (308967) 1145330 (291401) 609728 (168939)
GL1 2357377 1707677 1072569 1065997 (241873) 870779 (220909) 481523 (122824)
GL2 2304406 1729282 1080322 1073580 (253835) 929602 (234995) 460632 (125267)
GL3 1822754 1345521 745352 740785 (207198) 616318 (190449) 338168 (111111)
O1 3704334 2907197 1811057 1799817 (327514) 1384994 (302970) 890186 (182703)
O2 1896816 1509747 1068609 1061991 (226499) 911190 (208620) 624084 (129672)
O3 2235893 1753142 1286833 1278775 (282053) 1093002 (263673) 696601 (162637)
Open in a new tab

BF, pink; F, bloom; GF, swollen flower bud; O, half-inch green; GL, swollen leaf bud.

One technical replicate (randomly chosen and numbered as “1”) of each sample was subsequently analyzed with miRDeeP-P which highlighted the putative miRNA coding loci of the peach genome expressed in the five tested samples (reported in Files S1–S5 in Supplementary Material and summarized in File S6 in Supplementary Material). Twenty-six putative miRNA coding loci were expressed in all samples according to miRDeep-P results. The length of the putative precursors was between 41 nt and 227 nt (average length of 104 nt), while average mature miRNAs size was 22 nt.

These 26 miRNAs were selected and, for each of them, the corresponding associated reads were searched in all the replicates of each sample. The results (miRNAs and miRNAs* associated reads) are reported in Table 2 for each locus, the link between locus name and locus position can be found in File S7 in Supplementary Material and retrieved at www.rosaceae.org/peach/genome.

Table 2.

Reports the read count (divided by the total number of reads with a perfect match to the peach genome and normalized to 1,000,000 reads) of 26 putative miRNA coding loci that were expressed in all the 15 samples according to miRDeep-P results.

miRNA Reads EMBL accession number BF1 BF2 BF3 F1 F2 F3 GF1 GF2 GF3 GL1 GL2 GL3 O1 O2 O3
1_10 AGTTTGTGCGTGAATCGAACC HE862997 2.5 1.2 1.2 35.2 11.1 45.7 2.6 4.3 4.9 0 10.9 5.9 1.1 0 0
CAGTTTGTGCGTGAATCGAAC HE860429 6.3 9.8 19.9 24.4 7.9 20 3.9 10.8 14.8 8.3 17.4 5.9 3.4 0 8.6
TTAGATTCACGCACAAAC HE862999 0 0 0 0 0 0 1.3 2.2 1.6 0 0 0 0 0 0
TTAGATTCACGCACAAACT HE860429 3.8 6.1 4.7 5.4 0 4.3 3.9 4.3 3.3 2.1 6.5 0 1.1 1.6 0
TTAGATTCACGCACAAACTC HE863001 2.5 6.1 4.7 8.1 0 5.7 1.3 4.3 1.6 0 4.3 0 4.5 3.2 4.3
TTAGATTCACGCACAAACTCG HE860293 66.5 93 83.2 208.7 71.3 125.6 67.2 106.7 132.8 105.9 125.9 230.7 27 40.1 58.9
1_15 AACCACAAATCTCTTGGACTCCTG HE860430 1.3 0 1.2 0 0 0 1.3 1.1 0 0 0 0 0 1.6 0
AAGAGATTTGTGGTTACTCAC HE863003 0 0 1.2 0 0 0 1.3 2.2 1.6 0 4.3 3 0 1.6 1.4
AAGAGATTTGTGGTTACTCACC HE860430 2.5 2.4 0 0 0 1.4 0 1.1 0 0 0 0 0 0 0
AAGAGATTTGTGGTTACTCACCG HE863005 0 7.3 1.2 0 0 0 2.6 1.1 1.6 0 0 0 1.1 0 2.9
AAGAGATTTGTGGTTACTCACCGT HE860431 12.5 18.4 12.9 5.4 3.2 2.9 14.2 9.7 6.6 4.2 2.2 0 6.7 6.4 7.2
AGAGATTTGTGGTTACTCAC HE863007 6.3 2.4 3.5 2.7 0 0 0 1.1 0 2.1 0 0 1.1 1.6 1.4
AGAGATTTGTGGTTACTCACCG HE860431 1.3 4.9 4.7 0 1.6 0 2.6 0 0 2.1 0 3 1.1 4.8 4.3
AGAGATTTGTGGTTACTCACCGT HE863009 0 1.2 2.3 0 1.6 0 0 1.1 1.6 0 0 0 2.2 0 2.9
AGAGATTTGTGGTTACTCACCGTT HE860297 117.9 162.7 126.6 27.1 36.5 25.7 71 65.7 49.2 45.7 43.4 20.7 80.9 52.9 34.5
ATTTACATCCAACGGTGAGTAACC HE860432 0 0 0 0 0 0 0 0 0 2.1 2.2 0 0 0 0
CAAGAGATTTGTGGTTACTCA HE863011 0 0 0 0 1.6 0 0 0 0 0 0 3 1.1 0 0
CAAGAGATTTGTGGTTACTCACC HE860432 1.3 0 1.2 0 0 0 0 2.2 0 0 0 0 1.1 0 0
CAAGAGATTTGTGGTTACTCACCG HE863013 0 2.4 2.3 2.7 3.2 4.3 2.6 2.2 0 0 0 0 0 0 0
CCAAGAGATTTGTGGTTACTCA HE860433 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 0
TCCAAGAGATTTGTGGTTACTCAC HE863015 1.3 0 0 0 0 1.4 0 0 0 2.1 0 0 0 0 1.4
1_25 CGAAACCTCCCATTCCAA HE860433 1.3 0 0 0 0 0 1.3 2.2 0 2.1 2.2 3 0 0 0
GAGAGGTTGCCGGAAAGA HE863017 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
GGGTGAGAGGTTGCCGGAAA HE860434 0 0 2.3 0 0 0 0 0 0 2.1 0 0 0 1.6 4.3
GGGTGAGAGGTTGCCGGAAAG HE863019 2.5 9.8 16.4 0 0 0 10.3 14 8.2 12.5 15.2 11.8 15.7 30.4 38.8
GGGTGAGAGGTTGCCGGAAAGA HE860434 32.6 24.5 52.8 0 3.2 0 96.9 206.8 157.4 105.9 121.6 106.5 75.3 91.3 208.2
GGGTGAGAGGTTGCCGGAAAGAA HE863021 0 0 0 0 0 0 1.3 0 0 0 0 3 0 0 0
GGTGAGAGGTTGCCGGAAAGAAT HE860435 0 0 0 0 0 0 0 0 0 4.2 0 0 0 0 0
TCCGAAACCTCCCATTCCAA HE863023 1.3 0 1.2 0 0 1.4 3.9 0 0 0 0 0 2.2 0 1.4
TCCGAAACCTCCCATTCCAAT HE860435 3.8 1.2 1.2 0 0 0 1.3 1.1 0 0 0 0 0 0 1.4
TCCGAAACCTCCCATTCCAATG HE863025 0 0 0 0 0 0 3.9 0 0 0 0 0 0 0 0
TTCCGAAACCTCCCATTCCAA HE860436 17.6 30.6 17.6 5.4 6.3 15.7 29.7 49.6 27.9 33.2 39.1 26.6 13.5 11.2 8.6
TTCCGAAACCTCCCATTCCAAT HE863027 1.3 2.4 1.2 2.7 0 1.4 6.5 1.1 3.3 0 2.2 3 0 3.2 0
TTGGGTGAGAGGTTGCCGGAA HE860436 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 0
TTGGGTGAGAGGTTGCCGGAAA HE863029 2.5 0 0 0 0 2.9 1.3 0 0 0 0 0 0 0 0
TTTCCGAAACCTCCCATT HE860437 2.5 2.4 1.2 0 0 1.4 0 2.2 1.6 0 4.3 3 1.1 0 0
TTTCCGAAACCTCCCATTC HE863031 3.8 1.2 4.7 0 0 8.6 7.8 5.4 3.3 2.1 4.3 3 1.1 0 0
TTTCCGAAACCTCCCATTCC HE860437 8.8 8.6 23.4 5.4 9.5 17.1 34.9 23.7 23 10.4 21.7 3 2.2 4.8 4.3
TTTCCGAAACCTCCCATTCCA HE863033 15.1 11 12.9 0 4.8 5.7 29.7 22.6 13.1 16.6 21.7 3 1.1 0 5.7
TTTCCGAAACCTCCCATTCCAA HE860304 1135.1 1196.4 1134.8 401.1 391.5 687.9 1802 2047.9 1835.2 1277.2 1417.6 777.7 433.6 387.8 446.5
TTTCCGAAACCTCCCATTCCAAT HE860438 18.8 15.9 16.4 8.1 6.3 12.8 14.2 21.5 14.8 20.8 28.2 3 3.4 4.8 5.7
1_26 AAAAAGACTCAACAACCCATGTTT HE863035 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
AAAAGACTCAACAACCCATGT HE860438 0 1.2 1.2 2.7 0 1.4 0 0 0 0 2.2 0 0 1.6 0
AAAAGACTCAACAACCCATGTTT HE863037 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
AAAGACTCAACAACCCATGT HE860439 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAGGCATAGTAGGGTTTAGGA HE863039 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 1.4
AAAGGCATAGTAGGGTTTAGGAAG HE860439 3.8 0 1.2 0 0 0 6.5 8.6 3.3 2.1 4.3 0 0 0 1.4
AAGGCATAGTAGGGTTTAGGAAGT HE863041 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCCCGCCCATTCCAAATATT HE860440 0 0 0 2.7 0 1.4 1.3 0 0 0 0 0 0 1.6 0
ACCCCGCCCATTCCAAATATTT HE863043 0 0 0 0 0 1.4 1.3 0 0 0 0 0 0 0 0
ATATTTTCTAAGCCTACTGTC HE860440 7.5 3.7 5.9 8.1 3.2 8.6 22 20.5 26.2 16.6 13 11.8 13.5 4.8 7.2
CAAATATTTTCTAAGCCTACTGTC HE863045 0 0 0 2.7 0 0 0 0 0 0 0 0 0 0 0
CATAGTAGGGTTTAGGAA HE860441 0 0 0 0 0 0 1.3 0 0 2.1 0 0 0 0 0
CATAGTAGGGTTTAGGAAGTT HE863047 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
CATAGTAGGGTTTAGGAAGTTT HE860441 0 0 2.3 0 0 1.4 0 0 0 2.1 0 0 0 0 0
CATAGTAGGGTTTAGGAAGTTTT HE863049 1.3 1.2 2.3 0 1.6 2.9 5.2 3.2 1.6 2.1 0 0 1.1 0 2.9
CATAGTAGGGTTTAGGAAGTTTTT HE860442 7.5 7.3 4.7 5.4 3.2 4.3 10.3 11.9 3.3 10.4 0 3 2.2 1.6 4.3
CTTTGCCAACCCCGCCCATTCC HE863051 2.5 0 0 0 1.6 2.9 6.5 5.4 3.3 0 0 0 2.2 0 1.4
CTTTGCCAACCCCGCCCATTCCA HE860442 1.3 0 0 0 0 0 0 0 1.6 0 0 0 0 0 0
CTTTGCCAACCCCGCCCATTCCAA HE863053 0 1.2 1.2 0 0 0 5.2 1.1 4.9 16.6 2.2 8.9 1.1 0 1.4
GAAAGGCATAGTAGGGTTTAGGA HE860443 1.3 0 1.2 0 0 0 0 1.1 0 2.1 0 0 1.1 1.6 0
GAAAGGCATAGTAGGGTTTAGGAA HE863055 1.3 0 5.9 2.7 0 5.7 3.9 6.5 0 0 0 0 0 1.6 4.3
GCCAACCCCGCCCATTCCAA HE860443 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 0
GGAATGAGCGTGTTGGAAA HE863057 1.3 0 1.2 0 0 0 0 0 0 0 0 0 0 0 1.4
GGAATGAGCGTGTTGGAAAA HE860444 1.3 1.2 0 0 0 0 1.3 0 0 0 2.2 0 1.1 1.6 1.4
GGAATGAGCGTGTTGGAAAAG HE863059 7.5 4.9 3.5 2.7 3.2 4.3 5.2 8.6 4.9 10.4 6.5 3 5.6 3.2 12.9
GGAATGAGCGTGTTGGAAAAGA HE860444 2.5 4.9 5.9 0 0 0 9 2.2 8.2 29.1 15.2 11.8 0 1.6 0
GGAATGAGCGTGTTGGAAAAGAA HE863061 0 0 0 0 0 0 1.3 0 0 2.1 0 0 1.1 0 0
TATTTTCTAAGCCTACTGTC HE860445 0 0 1.2 0 0 0 0 3.2 0 4.2 0 0 0 0 0
TCTAAGCCTACTGTCTTTCCC HE863063 0 0 0 0 0 2.9 2.6 1.1 0 2.1 0 0 2.2 1.6 0
TCTAAGCCTACTGTCTTTCCCT HE860445 0 0 0 0 0 1.4 1.3 0 0 0 0 0 1.1 1.6 0
TGCCAACCCCGCCCATTCCA HE863065 1.3 0 0 0 0 1.4 0 0 0 0 0 0 0 0 0
TGCCAACCCCGCCCATTCCAA HE860446 6.3 1.2 2.3 0 0 4.3 2.6 2.2 1.6 6.2 2.2 5.9 2.2 3.2 1.4
TGCCAACCCCGCCCATTCCAAA HE863067 6.3 4.9 2.3 5.4 0 4.3 10.3 11.9 16.4 14.5 28.2 8.9 6.7 8 7.2
TGGAATGAGCGTGTTGGAAAA HE860446 1.3 0 0 0 0 0 0 1.1 0 0 0 0 0 0 0
TTCTTTGCCAACCCCGCCCATT HE863069 1.3 0 0 0 0 1.4 2.6 0 1.6 4.2 4.3 3 1.1 0 0
TTGCCAACCCCGCCCATT HE860447 1.3 1.2 0 0 0 1.4 0 2.2 4.9 2.1 0 0 0 0 0
TTGCCAACCCCGCCCATTC HE863071 3.8 2.4 2.3 2.7 0 0 7.8 10.8 6.6 4.2 2.2 0 1.1 0 0
TTGCCAACCCCGCCCATTCC HE860447 26.3 24.5 15.2 10.8 4.8 17.1 71 40.9 78.7 35.3 26.1 53.2 10.1 24 12.9
TTGCCAACCCCGCCCATTCCA HE863073 5 3.7 3.5 5.4 0 1.4 10.3 5.4 9.8 2.1 8.7 5.9 3.4 6.4 5.7
TTGCCAACCCCGCCCATTCCAA HE860305 180.6 163.9 138.3 140.9 85.6 119.9 260.9 266.1 477.3 344.7 382.1 275 126.9 203.5 189.5
TTGCCAACCCCGCCCATTCCAAA HE860448 0 0 2.3 0 1.6 1.4 2.6 3.2 3.3 0 2.2 0 1.1 1.6 2.9
TTGCCAACCCCGCCCATTCCAAAT HE863075 1.3 0 0 0 0 0 0 0 0 0 0 0 0 1.6 0
TTTGAAGCAGATGATGGAAC HE860448 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
TTTGCCAACCCCGCCCAT HE863077 0 2.4 0 0 0 0 1.3 0 3.3 0 2.2 0 1.1 0 1.4
TTTGCCAACCCCGCCCATT HE860449 2.5 0 0 2.7 0 0 6.5 0 8.2 2.1 2.2 0 0 6.4 0
TTTGCCAACCCCGCCCATTC HE863079 5 1.2 1.2 2.7 0 1.4 3.9 2.2 8.2 4.2 0 3 2.2 4.8 1.4
TTTGCCAACCCCGCCCATTCC HE860449 20.1 19.6 14.1 10.8 7.9 12.8 67.2 26.9 73.8 33.2 41.2 50.3 15.7 19.2 7.2
TTTGCCAACCCCGCCCATTCCA HE863081 5 8.6 3.5 2.7 1.6 1.4 22 9.7 13.1 10.4 13 5.9 5.6 3.2 5.7
TTTGCCAACCCCGCCCATTCCAA HE860450 115.4 71 70.3 59.6 36.5 75.6 148.6 136.8 239.5 240.9 223.6 171.5 57.3 134.6 83.3
TTTGCCAACCCCGCCCATTCCAAA HE863083 0 1.2 1.2 0 0 0 3.9 2.2 11.5 0 4.3 11.8 0 0 0
1_29 AGGTGGGCATACTGCCAACTG HE860450 3.8 2.4 2.3 13.6 4.8 10 1.3 0 0 0 0 0 3.4 1.6 1.4
ATTGGCATTCTGTCCACCTCC HE863085 0 1.2 0 0 1.6 0 0 0 0 0 0 0 1.1 0 0
TGGCATTCTGTCCACCTCC HE860451 1.3 0 0 0 0 1.4 0 0 0 0 2.2 0 0 0 0
TTGGCATTCTGTCCACCT HE863087 6.3 6.1 7 13.6 11.1 7.1 2.6 1.1 1.6 2.1 0 5.9 0 0 0
TTGGCATTCTGTCCACCTC HE860451 18.8 24.5 15.2 13.6 28.5 27.1 1.3 5.4 8.2 2.1 4.3 0 0 1.6 8.6
TTGGCATTCTGTCCACCTCC HE860307 89.1 121.1 89.1 127.4 141.1 225.5 80.1 53.9 59 27 26.1 20.7 20.2 35.3 25.8
TTGGCATTCTGTCCACCTCCT HE863089 36.4 29.4 36.3 10.8 26.9 62.8 23.3 15.1 13.1 2.1 4.3 3 4.5 4.8 1.4
TTGGCATTCTGTCCACCTCCTC HE860452 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
1_3 AACATGATCATCCGAATGAT HE863091 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 0
AATGCTGTCTGGTTCGAGA HE860452 1.3 2.4 1.2 0 1.6 2.9 0 1.1 3.3 2.1 2.2 0 0 1.6 1.4
ACCAGGCTTCATTCCCCC HE863093 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ATCCGAATGATCTCGGACCAGGCT HE860453 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 0
ATCTCGGACCAGGCTTCATTCCCC HE863095 6.3 14.7 17.6 0 9.5 11.4 2.6 1.1 0 6.2 6.5 0 1.1 4.8 5.7
ATGCTGTCTGGTTCGAGA HE860453 0 0 0 2.7 0 0 0 0 0 0 0 0 0 0 0
CGGACCAGGCTTCATTCC HE863097 0 0 0 0 0 0 0 1.1 0 0 2.2 0 2.2 0 0
CGGACCAGGCTTCATTCCC HE860454 1.3 2.4 0 2.7 1.6 0 1.3 5.4 1.6 0 0 3 1.1 0 0
CGGACCAGGCTTCATTCCCC HE863099 282.2 208 289.6 336.1 187 182.7 235.1 213.3 203.4 265.8 251.8 174.5 449.3 299.6 328.7
CGGACCAGGCTTCATTCCCCC HE860454 1.3 1.2 0 2.7 3.2 1.4 1.3 1.1 0 2.1 4.3 0 0 1.6 0
CTCGGACCAGGCTTCATTCC HE863101 0 2.4 1.2 2.7 1.6 1.4 1.3 0 1.6 0 0 0 1.1 0 0
CTCGGACCAGGCTTCATTCCC HE860455 66.5 83.2 65.6 132.8 42.8 129.9 9 9.7 9.8 10.4 17.4 17.7 16.9 46.5 43.1
CTCGGACCAGGCTTCATTCCCC HE863103 151.8 165.2 175.8 192.4 130 189.8 165.3 159.4 146 126.7 147.6 136 75.3 187.5 183.7
CTCGGACCAGGCTTCATTCCCCC HE860455 0 0 0 0 0 1.4 1.3 0 0 2.1 0 0 0 0 0
GAATGCTGTCTGGTTCGAGAC HE863105 3.8 1.2 0 5.4 0 1.4 0 0 0 0 0 0 1.1 1.6 0
GACCAGGCTTCATTCCCC HE860456 1.3 0 0 0 0 0 0 0 1.6 0 0 0 0 0 0
GGAATGCTGTCTGGTTCGA HE863107 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
GGAATGCTGTCTGGTTCGAGA HE860456 12.5 17.1 12.9 24.4 4.8 30 3.9 4.3 4.9 8.3 17.4 29.6 4.5 0 10
GGAATGCTGTCTGGTTCGAGAC HE863109 5 6.1 8.2 2.7 4.8 17.1 0 1.1 3.3 4.2 4.3 0 0 0 2.9
GGACCAGGCTTCATTCCC HE860457 1.3 0 1.2 0 0 0 0 0 0 0 0 0 0 0 0
GGACCAGGCTTCATTCCCC HE863111 146.7 154.1 143 184.3 136.3 148.4 155 161.6 134.5 189 191 147.9 171.9 174.7 193.8
TCGGACCAGGCTTCATTC HE860457 58.9 64.8 65.6 43.4 28.5 31.4 42.6 54.9 39.4 24.9 28.2 29.6 47.2 54.5 40.2
TCGGACCAGGCTTCATTCC HE863113 440.2 408.6 385.7 417.4 261.5 412.4 384.9 339.3 332.9 180.7 256.2 283.9 159.5 280.4 254.1
TCGGACCAGGCTTCATTCCC HE860458 706.1 675.3 720.9 441.8 321.8 449.5 586.5 627 546.1 388.4 525.4 387.4 410 512.8 541.2
TCGGACCAGGCTTCATTCCCC HE860285 282744.1 279717.9 296598.2 273500 243934.6 239360.7 306036.6 275122.8 248117.2 282794.4 317557.2 199637.5 217491.6 348033.3 350352.6
TCGGACCAGGCTTCATTCCCCC HE863115 209.5 212.9 233.3 384.9 160.1 276.9 170.5 137.9 165.6 272.1 191 168.6 174.1 282 236.9
TCTCGGACCAGGCTTCATTCC HE860458 110.4 179.8 155.9 273.7 190.2 332.5 11.6 8.6 14.8 24.9 99.9 11.8 28.1 57.7 45.9
TCTCGGACCAGGCTTCATTCCC HE863117 0 1.2 1.2 5.4 0 5.7 0 0 0 0 2.2 0 0 1.6 1.4
TCTCGGACCAGGCTTCATTCCCC HE860459 2.5 11 9.4 8.1 4.8 12.8 9 4.3 8.2 6.2 4.3 5.9 4.5 9.6 10
TCTCGGACCAGGCTTCATTCCCCC HE863119 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
1_32 ATTGACAGAAGAGAGTGAGCAC HE860459 1.3 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
GACAGAAGAGAGTGAGCAC HE863121 1.3 1.2 0 0 0 0 0 0 0 0 0 0 0 0 0
GCTCATGTCTCTTTCTGTCAGC HE860460 5 2.4 7 2.7 4.8 4.3 0 1.1 0 2.1 0 0 1.1 1.6 1.4
GCTCATGTCTCTTTCTGTCAGCT HE863123 2.5 0 0 0 0 1.4 0 0 0 0 0 0 0 0 0
TGACAGAAGAGAGTGAGCA HE860460 1.3 0 1.2 0 0 0 0 0 0 0 0 0 0 0 0
TGACAGAAGAGAGTGAGCAC HE860311 71.5 80.7 97.3 181.6 38 44.2 29.7 53.9 31.2 49.8 17.4 11.8 11.2 11.2 20.1
TGACAGAAGAGAGTGAGCACA HE863125 2.5 3.7 0 0 1.6 0 0 0 1.6 2.1 0 0 0 0 0
TGCTCATGTCTCTTTCTGTCAGC HE860461 0 2.4 2.3 8.1 1.6 0 1.3 0 0 2.1 0 0 0 1.6 0
TTGACAGAAGAGAGTGAGCAC HE863127 8.8 14.7 15.2 21.7 3.2 7.1 2.6 0 1.6 10.4 0 0 0 0 0
1_44 AGGTGGTCAGCATGTCAAACT HE860461 3.8 2.4 3.5 2.7 0 0 5.2 9.7 0 0 0 3 2.2 3.2 5.7
TGGCATTCTGTCCACCTCC HE860451 1.3 0 0 0 0 1.4 0 0 0 0 2.2 0 0 0 0
TTGGCATTCTGTCCACCT HE863087 6.3 6.1 7 13.6 11.1 7.1 2.6 1.1 1.6 2.1 0 5.9 0 0 0
TTGGCATTCTGTCCACCTC HE860451 18.8 24.5 15.2 13.6 28.5 27.1 1.3 5.4 8.2 2.1 4.3 0 0 1.6 8.6
TTGGCATTCTGTCCACCTCC HE860307 89.1 121.1 89.1 127.4 141.1 225.5 80.1 53.9 59 27 26.1 20.7 20.2 35.3 25.8
TTTGGCATTCTGTCCACCTCC HE863129 1.3 0 1.2 0 0 0 1.3 1.1 1.6 2.1 0 0 1.1 0 0
1_5 TACAATGAAATCACGGCC HE860462 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
TATAAAGAGATGTACTGGACC HE863131 3.8 2.4 2.3 2.7 0 0 2.6 2.2 0 2.1 4.3 0 2.2 1.6 1.4
TTATACAATGAAATCACGG HE860462 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 0
TTATACAATGAAATCACGGC HE860288 8.8 23.2 27 5.4 7.9 7.1 14.2 15.1 3.3 16.6 23.9 20.7 20.2 17.6 18.7
TTATACAATGAAATCACGGCC HE860287 125.4 174.9 219.2 70.5 130 81.3 107.2 131.4 147.6 280.4 230.1 378.5 179.7 126.6 277.1
TTATACAATGAAATCACGGCCG HE860286 129.2 116.2 148.9 29.8 71.3 37.1 63.3 75.4 62.3 170.3 141.1 195.2 85.4 83.3 208.2
10_1 ACAGGGAACAGGTAGAGCA HE863133 2.5 1.2 2.3 0 0 0 0 1.1 0 0 0 0 1.1 1.6 0
ACAGGGAACAGGTAGAGCATG HE860463 2.5 3.7 8.2 21.7 0 2.9 1.3 2.2 0 0 0 0 0 4.8 0
ATGCACTGCCTCTTCCCTGGC HE863135 2.5 3.7 4.7 2.7 1.6 5.7 1.3 0 0 0 0 0 2.2 8 1.4
TGCACTGCCTCTTCCCTG HE860463 11.3 3.7 7 5.4 0 8.6 3.9 3.2 0 0 0 3 9 4.8 5.7
TGCACTGCCTCTTCCCTGG HE863137 26.3 22 36.3 16.3 1.6 8.6 7.8 10.8 3.3 2.1 0 3 6.7 24 11.5
TGCACTGCCTCTTCCCTGGC HE860464 47.7 35.5 32.8 146.4 14.3 65.6 11.6 12.9 8.2 2.1 8.7 8.9 15.7 16 15.8
TGCACTGCCTCTTCCCTGGCT HE860428 154.3 137 137.2 168 53.9 119.9 95.6 72.2 90.2 16.6 19.5 14.8 83.1 81.7 64.6
TGCACTGCCTCTTCCCTGGCTG HE863139 2.5 6.1 3.5 10.8 1.6 5.7 1.3 2.2 1.6 0 2.2 0 2.2 1.6 4.3
2_31 CCAAAGGGATCGCATTGATCT HE860464 0 0 0 2.7 1.6 0 0 0 0 0 0 0 0 0 0
TCCAAAGGGATCGCATTGA HE863141 0 1.2 1.2 0 0 0 0 0 0 2.1 0 0 0 0 0
TCCAAAGGGATCGCATTGAT HE860465 0 1.2 0 0 0 1.4 1.3 1.1 0 0 0 0 0 0 0
TCCAAAGGGATCGCATTGATC HE860334 12.5 22 18.8 46.1 44.4 44.2 37.5 43.1 16.4 22.8 23.9 41.4 1.1 3.2 7.2
TCCAAAGGGATCGCATTGATCT HE863143 3.8 12.2 15.2 19 20.6 11.4 11.6 19.4 8.2 8.3 4.3 3 1.1 0 2.9
TCCAAAGGGATCGCATTGATCTA HE860465 0 0 0 5.4 1.6 4.3 0 0 0 0 0 0 0 0 0
TCGATGCGATCCCTTGGGA HE863145 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
TCGATGCGATCCCTTGGGAAG HE860337 1.3 4.9 3.5 67.8 30.1 55.7 1.3 4.3 1.6 12.5 6.5 3 2.2 1.6 5.7
TCGATGCGATCCCTTGGGAAGT HE860466 0 0 0 2.7 1.6 0 0 0 0 0 0 0 0 0 0
TGATATTGGATCGATGCGATC HE863147 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
3_16 ATTGTAGGAATGGGCTGTTTG HE860466 2.5 0 1.2 0 0 0 1.3 0 0 0 0 0 0 0 0
CCCAAGCCCGCCCATTCC HE863149 0 0 0 0 0 0 2.6 0 0 0 0 0 0 0 0
CCCAAGCCCGCCCATTCCA HE860467 0 0 0 0 0 0 1.3 1.1 0 0 0 0 0 0 0
CTTCCCAAGCCCGCCCATTCCA HE863151 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
GGAATGGGCTGTTTGGGA HE860467 13.8 7.3 17.6 16.3 28.5 12.8 3.9 7.5 11.5 10.4 17.4 20.7 11.2 14.4 10
GGAATGGGCTGTTTGGGAT HE863153 5 1.2 4.7 0 1.6 2.9 1.3 2.2 0 6.2 4.3 0 2.2 1.6 5.7
GGAATGGGCTGTTTGGGATG HE860468 70.2 56.3 92.6 168 68.2 92.8 10.3 24.8 23 22.8 17.4 20.7 69.6 56.1 61.7
GGAATGGGCTGTTTGGGATGA HE860347 100.3 84.4 150.1 311.7 111 177 22 49.6 50.8 47.8 34.7 53.2 197.7 86.5 104.8
GGAATGGGCTGTTTGGGATGAA HE863155 0 0 0 2.7 0 1.4 0 0 0 0 0 0 1.1 0 0
GGAATGGGCTGTTTGGGATGAAAG HE860468 0 0 0 2.7 0 0 0 0 0 0 0 0 2.2 0 1.4
TAGGAATGGGCTGTTTGGGA HE863157 2.5 1.2 3.5 0 1.6 0 0 0 0 0 0 0 0 0 1.4
TTCCCAAGCCCGCCCATT HE860469 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
TTCCCAAGCCCGCCCATTC HE863159 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
TTCCCAAGCCCGCCCATTCC HE860469 0 3.7 0 10.8 0 7.1 6.5 4.3 4.9 6.2 8.7 3 0 0 1.4
TTCCCAAGCCCGCCCATTCCA HE863161 0 0 2.3 0 1.6 1.4 0 0 1.6 2.1 0 0 0 0 0
TTCCCAAGCCCGCCCATTCCAA HE860348 112.9 130.9 99.6 216.8 123.6 182.7 217 225.2 288.7 278.3 212.8 115.3 47.2 38.5 63.2
TTGTAGGAATGGGCTGTTTGGGA HE860470 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
TTTCTTTCATCCCAAACAGCC HE863163 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
3_28 ATGGTGTCATCCCTCCTGTGACC HE860470 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
CCAAATTGAGAGAGAGAGAGAGAG HE863165 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCATCTTCCTGTGACATGAAC HE860471 0 0 0 2.7 0 1.4 0 0 0 2.1 0 0 0 0 0
CGCAGGAGAGATGGCACTG HE863167 0 0 0 0 0 0 0 0 0 2.1 2.2 3 0 0 0
GGTGTCATCCCTCCTGTGACC HE860471 0 0 0 0 1.6 0 0 0 0 2.1 2.2 0 0 0 0
TCCATCTTCCTGTGACATGA HE863169 0 0 0 2.7 0 0 0 0 1.6 0 2.2 3 0 0 0
TCGCAGGAGAGATGGCAC HE860472 2.5 0 0 0 0 0 0 1.1 0 0 4.3 3 0 0 0
TCGCAGGAGAGATGGCACTG HE863171 7.5 2.4 2.3 5.4 0 0 5.2 14 9.8 35.3 39.1 47.3 0 0 5.7
TCGCAGGAGAGATGGCACTGT HE860472 1.3 0 2.3 8.1 0 10 1.3 5.4 3.3 8.3 15.2 17.7 1.1 0 1.4
TCGCAGGAGAGATGGCACTGTC HE860356 15.1 9.8 15.2 51.5 19 38.5 40 74.3 44.3 110.1 165 139 3.4 4.8 7.2
TCGCAGGAGAGATGGCACTGTCT HE863173 0 0 0 2.7 0 0 0 0 1.6 0 0 0 0 0 0
TGGTGTCATCCCTCCTGTGACC HE860473 0 0 0 8.1 1.6 4.3 0 2.2 4.9 10.4 8.7 29.6 1.1 0 1.4
TTCCATCTTCCTGTGACATGA HE863175 0 0 0 2.7 3.2 1.4 2.6 1.1 1.6 2.1 4.3 23.7 0 0 0
TTCGCAGGAGAGATGGCAC HE860473 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
TTCGCAGGAGAGATGGCACTGTC HE863177 0 0 1.2 0 0 1.4 2.6 1.1 1.6 2.1 2.2 3 0 0 1.4
4_21 CCCTGCAGTACCTTCCTTTACCC HE860474 0 0 1.2 2.7 0 0 0 0 0 0 0 0 0 0 0
GGAGCGACCTGGGATCACATG HE863179 0 1.2 1.2 21.7 1.6 15.7 0 0 0 0 0 0 1.1 0 0
GTGTTCTCAGGTCGCCCCTG HE860474 0 0 2.3 0 0 1.4 0 1.1 3.3 0 0 0 2.2 0 0
TGTGTTCTCAGGTCGCCCC HE863181 3.8 2.4 3.5 8.1 4.8 4.3 0 0 0 2.1 0 3 0 14.4 7.2
TGTGTTCTCAGGTCGCCCCT HE860475 0 1.2 0 2.7 0 0 0 2.2 0 0 0 3 3.4 1.6 8.6
TGTGTTCTCAGGTCGCCCCTG HE860366 356.2 210.4 280.2 311.7 313.9 216.9 31 71.1 54.1 60.2 36.9 35.5 540.3 700.2 723.5
5_14 AATGTTGTCTGGCTCGAG HE863183 0 1.2 3.5 0 0 1.4 0 0 0 0 0 0 1.1 1.6 1.4
AATGTTGTCTGGCTCGAGG HE860475 6.3 13.5 7 8.1 0 1.4 6.5 8.6 0 6.2 10.9 0 6.7 28.8 11.5
AATGTTGTCTGGCTCGAGGCC HE863185 0 0 0 2.7 0 0 1.3 1.1 1.6 0 4.3 0 1.1 1.6 0
AATGTTGTCTGGCTCGAGGCCC HE860476 0 0 0 0 0 0 1.3 1.1 0 0 0 0 0 0 0
AATGTTGTCTGGCTCGAGGCCCCT HE863187 0 0 0 0 0 0 0 2.2 3.3 2.1 0 3 0 0 0
ACCAGGCTTCATTCCCCC HE863093 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACGTCGGACCAGGCTTCATTC HE860476 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
ACGTCGGACCAGGCTTCATTCCCC HE863189 1.3 0 1.2 0 0 0 1.3 0 1.6 0 0 0 0 1.6 1.4
ATGTTGTCTGGCTCGAGG HE860477 1.3 2.4 3.5 0 0 0 0 0 0 0 2.2 0 1.1 1.6 2.9
ATTTGGTTCTACATTTAGTGAC HE863191 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CGGACCAGGCTTCATTCC HE863097 0 0 0 0 0 0 0 1.1 0 0 2.2 0 2.2 0 0
CGGACCAGGCTTCATTCCC HE860454 1.3 2.4 0 2.7 1.6 0 1.3 5.4 1.6 0 0 3 1.1 0 0
CGGACCAGGCTTCATTCCCC HE863099 282.2 208 289.6 336.1 187 182.7 235.1 213.3 203.4 265.8 251.8 174.5 449.3 299.6 328.7
CGGACCAGGCTTCATTCCCCC HE860454 1.3 1.2 0 2.7 3.2 1.4 1.3 1.1 0 2.1 4.3 0 0 1.6 0
CGTCGGACCAGGCTTCATTCC HE860477 1.3 0 1.2 0 1.6 0 0 2.2 0 0 0 0 0 0 0
CGTCGGACCAGGCTTCATTCCC HE863193 0 0 0 0 0 1.4 0 0 0 0 0 0 3.4 0 0
CGTCGGACCAGGCTTCATTCCCC HE860478 3.8 2.4 1.2 0 0 0 1.3 0 3.3 0 2.2 0 2.2 1.6 4.3
GAATGTTGTCTGGCTCGA HE863195 1.3 1.2 0 0 0 0 1.3 0 1.6 0 0 0 1.1 0 0
GAATGTTGTCTGGCTCGAGG HE860478 5 13.5 7 10.8 1.6 2.9 1.3 2.2 0 0 2.2 3 3.4 14.4 5.7
GAATGTTGTCTGGCTCGAGGC HE863197 0 1.2 2.3 2.7 0 0 0 2.2 0 0 0 3 0 0 1.4
GAATGTTGTCTGGCTCGAGGCC HE860479 0 2.4 0 0 0 1.4 0 0 0 0 0 0 1.1 1.6 0
GAATGTTGTCTGGCTCGAGGCCCC HE863199 0 0 0 0 0 0 0 0 3.3 2.1 0 0 0 0 0
GACCAGGCTTCATTCCCC HE860456 1.3 0 0 0 0 0 0 0 1.6 0 0 0 0 0 0
GGAATGTTGTCTGGCTCG HE860479 38.9 24.5 44.5 16.3 1.6 5.7 9 26.9 18 14.5 21.7 20.7 22.5 49.7 63.2
GGAATGTTGTCTGGCTCGA HE863201 10 11 24.6 5.4 4.8 1.4 11.6 16.2 14.8 22.8 8.7 32.5 5.6 8 24.4
GGAATGTTGTCTGGCTCGAG HE860480 6.3 3.7 10.6 16.3 4.8 0 6.5 8.6 3.3 8.3 4.3 11.8 4.5 6.4 14.4
GGAATGTTGTCTGGCTCGAGG HE863203 165.6 156.6 174.7 73.2 26.9 49.9 74.9 106.7 80.4 58.1 117.2 263.2 175.2 211.5 353.1
GGAATGTTGTCTGGCTCGAGGC HE860480 1.3 1.2 1.2 0 0 0 2.6 1.1 1.6 2.1 0 3 0 4.8 0
GGACCAGGCTTCATTCCC HE860457 1.3 0 1.2 0 0 0 0 0 0 0 0 0 0 0 0
GGACCAGGCTTCATTCCCC HE863111 146.7 154.1 143 184.3 136.3 148.4 155 161.6 134.5 189 191 147.9 171.9 174.7 193.8
GTCGGACCAGGCTTCATTC HE863205 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
GTCGGACCAGGCTTCATTCC HE860481 0 0 0 0 0 0 0 1.1 0 0 0 0 1.1 0 0
GTCGGACCAGGCTTCATTCCC HE863207 64 117.4 86.7 86.7 49.1 109.9 49.1 56 42.6 29.1 28.2 3 97.7 94.5 68.9
GTCGGACCAGGCTTCATTCCCC HE860481 21.3 26.9 29.3 29.8 9.5 14.3 31 29.1 23 33.2 30.4 17.7 51.7 62.5 37.3
GTCGGACCAGGCTTCATTCCCCC HE863209 0 2.4 7 0 0 1.4 7.8 8.6 0 2.1 4.3 0 4.5 4.8 7.2
GTTGTCTGGCTCGAGGCC HE860482 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
TAAATGTAGAACCAAATGATCT HE863211 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
TCACTAAATGTAGAACCAAATG HE860482 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 0
TCGGACCAGGCTTCATTC HE860457 58.9 64.8 65.6 43.4 28.5 31.4 42.6 54.9 39.4 24.9 28.2 29.6 47.2 54.5 40.2
TCGGACCAGGCTTCATTCC HE863113 440.2 408.6 385.7 417.4 261.5 412.4 384.9 339.3 332.9 180.7 256.2 283.9 159.5 280.4 254.1
TCGGACCAGGCTTCATTCCC HE860458 706.1 675.3 720.9 441.8 321.8 449.5 586.5 627 546.1 388.4 525.4 387.4 410 512.8 541.2
TCGGACCAGGCTTCATTCCCC HE860285 282744.1 279717.9 296598.2 273500 243934.6 239360.7 306036.6 275122.8 248117.2 282794.4 317557.2 199637.5 217491.6 348033.3 350352.6
TCGGACCAGGCTTCATTCCCCC HE863115 209.5 212.9 233.3 384.9 160.1 276.9 170.5 137.9 165.6 272.1 191 168.6 174.1 282 236.9
TGTCTGGCTCGAGGCCCCTA HE863213 0 0 0 2.7 0 0 0 0 0 0 0 0 0 0 0
5_3 CCCGCCTTGCATCAACTG HE860483 0 0 2.3 0 0 0 0 1.1 0 6.2 0 3 0 0 0
CCCGCCTTGCATCAACTGAA HE863215 0 0 1.2 0 0 2.9 1.3 1.1 3.3 6.2 8.7 5.9 0 1.6 2.9
CCCGCCTTGCATCAACTGAAT HE860483 35.1 44 38.7 75.9 30.1 95.6 62 263.9 242.7 255.4 455.9 257.3 20.2 139.4 208.2
CCGCCTTGCATCAACTGAAT HE863217 2.5 0 1.2 0 0 0 2.6 0 0 2.1 4.3 0 0 0 0
CGCTTGGTGCAGGTCGGGA HE860484 0 0 0 0 0 0 0 1.1 1.6 2.1 0 3 0 0 0
CGCTTGGTGCAGGTCGGGAA HE863219 0 0 0 0 0 0 0 1.1 3.3 6.2 2.2 3 1.1 0 1.4
CGCTTGGTGCAGGTCGGGAAC HE860484 0 0 0 2.7 0 0 0 0 0 0 2.2 0 0 0 0
GCTTGGTGCAGGTCGGGAA HE863221 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
GGGTCCCGCCTTGCATCAAC HE860485 0 0 0 0 0 0 0 0 0 4.2 2.2 0 0 0 0
GGTCCCGCCTTGCATCAACTGAAT HE863223 0 0 2.3 0 0 0 0 0 0 2.1 2.2 0 0 0 0
TCGCTTGGTGCAGGTCGGGA HE860485 11.3 20.8 15.2 48.8 6.3 14.3 27.1 26.9 68.9 78.9 56.4 65.1 5.6 19.2 18.7
TCGCTTGGTGCAGGTCGGGAA HE860370 259.6 254.5 184 219.5 136.3 186.9 193.8 339.3 501.9 494.3 579.6 520.5 104.5 208.3 249.8
TCGCTTGGTGCAGGTCGGGAACT HE863225 0 0 0 0 1.6 0 3.9 1.1 8.2 10.4 4.3 3 0 1.6 4.3
TGGGTCCCGCCTTGCATCAAC HE860486 6.3 9.8 12.9 24.4 14.3 28.5 28.4 24.8 39.4 45.7 52.1 82.8 4.5 12.8 10
TGGGTCCCGCCTTGCATCAACT HE863227 0 0 0 2.7 0 0 0 0 1.6 0 0 0 0 0 0
TGGTGCAGGTCGGGAACTGCT HE860486 1.3 1.2 1.2 0 0 0 0 0 0 4.2 0 0 0 0 0
TTGGTCGGTGGGTGCGAAATGGGT HE863229 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
6_29 AAGCTCAGGAGGGATAGC HE860487 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAGCTCAGGAGGGATAGCGC HE863231 0 0 0 2.7 0 1.4 0 1.1 1.6 0 0 0 0 0 0
AAGCTCAGGAGGGATAGCGCC HE860388 70.2 64.8 86.7 178.9 218.7 118.4 153.7 149.7 173.8 211.8 254 224.7 141.5 158.6 113.4
AGCTCAGGAGGGATAGCGCC HE860487 0 1.2 0 5.4 1.6 0 0 0 0 2.1 0 0 1.1 0 0
CGCTATCCATCCTGAGTTTC HE863233 0 1.2 1.2 8.1 19 2.9 0 0 1.6 0 0 0 0 0 0
CGCTATCCATCCTGAGTTTCA HE860488 1.3 1.2 4.7 13.6 42.8 27.1 2.6 5.4 1.6 0 2.2 0 1.1 0 0
TATTGCGCTATCCATCCTGAGTT HE863235 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
TCCATCCTGAGTTTCATGGCT HE860488 1.3 0 1.2 0 0 0 0 0 0 0 0 0 0 0 0
TTGCGCTATCCATCCTGAG HE863237 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
6_30 AAGCTGCCAGCATGATCTGAGC HE860489 0 0 0 0 0 0 0 0 0 0 0 0 1.1 4.8 0
AGATCATGTGGTAGCTTCATC HE863239 5 0 0 0 0 0 0 2.2 1.6 0 0 0 1.1 6.4 7.2
CTAGATCATGTGGTAGCTTCATC HE860489 1.3 0 0 0 0 0 1.3 0 1.6 0 0 0 1.1 1.6 0
GAAGCTGCCAGCATGATCTG HE863241 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 2.9
GAAGCTGCCAGCATGATCTGA HE860490 1.3 0 1.2 0 0 0 0 0 0 0 0 0 1.1 0 2.9
GATCATGTGGTAGCTTCATC HE863243 15.1 11 14.1 0 0 0 10.3 8.6 8.2 0 0 0 37.1 51.3 41.6
GCTAGATCATGTGGTAGCTTCATC HE860490 0 0 0 0 1.6 0 0 0 0 0 0 0 1.1 0 4.3
TAGATCATGTGGTAGCTTCATC HE863245 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 0
TGAAGCTGCCAGCATGAT HE860491 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 0
TGAAGCTGCCAGCATGATC HE863247 76.5 48.9 62.1 2.7 4.8 2.9 25.8 45.2 41 2.1 8.7 0 21.3 25.6 31.6
TGAAGCTGCCAGCATGATCT HE860284 170.6 172.5 161.8 19 17.4 30 153.7 153 88.6 10.4 15.2 14.8 35.9 36.9 48.8
TGAAGCTGCCAGCATGATCTG HE860399 1434.8 1105.9 1518.1 43.4 174.4 99.9 496 627 321.5 10.4 13 11.8 775.1 796.4 785.2
TGAAGCTGCCAGCATGATCTGA HE860400 1056.1 677.7 907.3 59.6 57.1 34.3 511.5 667.9 408.4 16.6 6.5 3 302.2 427.8 447.9
TGAAGCTGCCAGCATGATCTGAGC HE860491 2.5 0 0 0 0 0 1.3 2.2 1.6 0 0 0 2.2 1.6 2.9
TGTTGAAGCTGCCAGCATGATC HE863249 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
6_4 AAGCTCAGGAGGGATAGC HE860487 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAGCTCAGGAGGGATAGCGC HE863231 0 0 0 2.7 0 1.4 0 1.1 1.6 0 0 0 0 0 0
AAGCTCAGGAGGGATAGCGCC HE860388 70.2 64.8 86.7 178.9 218.7 118.4 153.7 149.7 173.8 211.8 254 224.7 141.5 158.6 113.4
AGCTCAGGAGGGATAGCGCC HE860487 0 1.2 0 5.4 1.6 0 0 0 0 2.1 0 0 1.1 0 0
CGCTATCTATCCTGAGTTTCA HE860492 0 0 0 0 0 0 1.3 0 1.6 8.3 4.3 0 0 0 0
6_7 AATTACTACTTTTGAGTGGTTA HE863251 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ATCTTTCCCAATCCACCCA HE860492 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 0
ATCTTTCCCAATCCACCCATGCC HE863253 10 12.2 3.5 2.7 1.6 1.4 11.6 16.2 11.5 10.4 6.5 3 14.6 33.6 20.1
CATGGGTAAGTGGGGAAGA HE860493 0 0 2.3 0 0 1.4 0 0 0 2.1 0 0 0 0 0
CATGGGTAAGTGGGGAAGATG HE863255 18.8 15.9 19.9 37.9 23.8 35.7 1.3 4.3 6.6 4.2 0 3 5.6 8 12.9
CATGGGTAAGTGGGGAAGATGA HE860493 5 6.1 3.5 2.7 6.3 2.9 2.6 4.3 0 2.1 6.5 0 2.2 1.6 1.4
CTTTCCCAATCCACCCATGC HE863257 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
CTTTCCCAATCCACCCATGCC HE860494 0 1.2 1.2 2.7 0 0 1.3 1.1 1.6 4.2 0 5.9 1.1 0 0
TCCCAATCCACCCATGCC HE863259 0 0 0 0 0 0 0 0 1.6 2.1 0 0 0 0 0
TCTTTCCCAATCCACCCA HE860494 3.8 4.9 3.5 2.7 3.2 1.4 0 1.1 9.8 8.3 0 8.9 0 11.2 7.2
TCTTTCCCAATCCACCCAT HE863261 1.3 0 0 0 0 0 0 1.1 0 0 0 0 1.1 0 0
TCTTTCCCAATCCACCCATG HE860495 1.3 0 0 0 0 0 2.6 0 0 2.1 0 0 1.1 0 0
TCTTTCCCAATCCACCCATGC HE863263 2.5 1.2 3.5 0 1.6 0 1.3 2.2 1.6 6.2 2.2 0 1.1 4.8 1.4
TCTTTCCCAATCCACCCATGCC HE860389 652.2 652 726.8 379.4 271.1 298.3 746.6 554.8 657.7 830.7 640.4 505.7 497.6 645.7 551.2
TCTTTCCCAATCCACCCATGCCT HE860495 5 0 0 0 0 0 2.6 0 1.6 0 0 0 1.1 0 1.4
TGGCATGGGTAAGTGGGGAAGA HE863265 0 0 0 0 0 0 0 0 0 2.1 0 0 1.1 0 0
TTAGGTTTCCTCTTATTCATCC HE860496 16.3 39.1 23.4 2.7 4.8 2.9 0 1.1 1.6 8.3 4.3 17.7 10.1 16 10
TTCCCAATCCACCCATGCCT HE863267 2.5 0 0 0 0 1.4 1.3 1.1 0 0 0 0 0 0 0
TTCCCAATCCACCCATGCCTT HE860496 0 1.2 1.2 0 1.6 0 0 1.1 4.9 0 2.2 0 1.1 1.6 2.9
TTTCCCAATCCACCCATGCCT HE863269 0 0 0 2.7 0 0 1.3 1.1 1.6 2.1 4.3 0 0 1.6 0
TTTCCCAATCCACCCATGCCTT HE860497 3.8 3.7 3.5 2.7 4.8 1.4 0 3.2 3.3 10.4 4.3 0 4.5 3.2 4.3
TTTCCCAATCCACCCATGCCTTA HE863271 0 1.2 1.2 0 4.8 1.4 1.3 2.2 1.6 0 2.2 3 0 4.8 1.4
TTTCCTCTTATTCATCCCTCT HE860497 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
7_23 AAGAAAGCTGTGGGAGAACAT HE863273 0 0 0 2.7 0 0 0 0 0 0 0 0 0 0 0
AAGAAAGCTGTGGGAGAACATGGC HE860498 0 1.2 0 0 0 0 1.3 0 0 2.1 0 0 1.1 0 0
CACAGCTTTCTTGAACTT HE863275 1.3 3.7 1.2 2.7 3.2 1.4 0 0 0 0 0 0 0 0 1.4
CCACAGCTTTCTTGAACT HE860498 0 0 0 2.7 0 1.4 0 0 0 0 0 0 0 0 0
CTCAAGAAAGCTGTGGGAGA HE863277 2.5 1.2 4.7 2.7 0 4.3 0 0 0 2.1 2.2 0 1.1 4.8 4.3
GCTCAAGAAAGCTGTGGGAGA HE860499 6.3 18.4 10.6 8.1 6.3 14.3 1.3 1.1 1.6 6.2 2.2 8.9 5.6 8 5.7
TATAAACAAGTCCTGGTCATGCTT HE863279 0 0 0 2.7 0 0 0 0 0 0 0 0 0 0 0
TCCACAGCTTTCTTGAACT HE860499 1.3 0 0 2.7 0 0 0 1.1 0 0 2.2 0 0 0 1.4
TCCACAGCTTTCTTGAACTT HE863281 3.8 3.7 4.7 5.4 4.8 4.3 1.3 0 3.3 0 0 3 3.4 0 4.3
TTCCACAGCTTTCTTGAA HE860500 0 0 0 2.7 0 0 0 1.1 0 0 0 0 0 0 0
TTCCACAGCTTTCTTGAAC HE863283 10 15.9 12.9 27.1 46 37.1 2.6 4.3 4.9 2.1 0 5.9 4.5 4.8 5.7
TTCCACAGCTTTCTTGAACT HE860500 76.5 132.1 87.9 146.4 271.1 289.7 16.8 20.5 11.5 8.3 4.3 23.7 40.4 35.3 51.7
TTCCACAGCTTTCTTGAACTT HE860413 1138.8 1645.4 1659.9 1658.7 2919.8 2253.4 198.9 377.1 216.5 211.8 149.8 165.6 949.2 741.9 808.2
TTCCACAGCTTTCTTGAACTTC HE863285 2.5 0 2.3 5.4 0 4.3 0 1.1 0 0 0 0 3.4 0 1.4
7_24 ACACTGTGGCTCGTTGTGTTGTCA HE860501 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 0
ACGTTATGTTGTCAAATTGTC HE863287 0 0 0 0 0 0 1.3 1.1 0 0 0 0 0 0 0
ATGTTGTCAAATTGTCAATC HE860501 0 0 0 0 1.6 1.4 1.3 0 1.6 0 0 5.9 0 0 0
CAACGTGACAACACAACGAGC HE863289 1.3 0 1.2 0 0 2.9 0 0 1.6 0 0 0 0 0 0
CAACGTGACAACACAACGAGCC HE860502 10 15.9 12.9 8.1 7.9 12.8 2.6 5.4 6.6 8.3 0 0 0 1.6 2.9
CACGTTATGTTGTCAAATTGTC HE863291 0 0 0 2.7 0 1.4 0 0 0 0 0 0 0 0 0
TATGTTGTCAAATTGTCAAT HE860502 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
TATGTTGTCAAATTGTCAATC HE860414 16.3 9.8 24.6 24.4 12.7 20 24.5 21.5 29.5 10.4 17.4 14.8 12.4 4.8 5.7
TGAACACAAAGATACATGCCCG HE863293 0 0 0 0 0 0 1.3 0 0 0 0 0 0 0 0
TTGACAACGTGACAACACAAC HE860503 0 1.2 1.2 0 0 0 5.2 2.2 1.6 0 4.3 3 0 0 0
7_25 GACAGAAGAGAGTGAGCAC HE863121 1.3 1.2 0 0 0 0 0 0 0 0 0 0 0 0 0
GCTCACTTCTCTCTCTGTCAGC HE863295 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
TGACAGAAGAGAGTGAGCA HE860460 1.3 0 1.2 0 0 0 0 0 0 0 0 0 0 0 0
TGACAGAAGAGAGTGAGCAC HE860311 71.5 80.7 97.3 181.6 38 44.2 29.7 53.9 31.2 49.8 17.4 11.8 11.2 11.2 20.1
TGACAGAAGAGAGTGAGCACA HE863125 2.5 3.7 0 0 1.6 0 0 0 1.6 2.1 0 0 0 0 0
8_16 CCGACAAGCGTGCTCTCTCTCGTT HE860503 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
GTGCTCTCTCTTGTTGTCATG HE863297 1.3 3.7 4.7 13.6 4.8 0 1.3 0 3.3 2.1 6.5 0 2.2 6.4 5.7
TGACAACGAGAGAGAGCAC HE860504 2.5 0 0 0 0 0 0 0 0 0 0 0 0 0 0
TGACAACGAGAGAGAGCACG HE863299 0 0 0 2.7 0 1.4 0 0 3.3 0 0 0 0 0 0
TGACAACGAGAGAGAGCACGC HE860423 75.3 35.5 21.1 29.8 23.8 41.4 20.7 45.2 32.8 39.5 69.5 62.1 5.6 14.4 8.6
TTGACAACGAGAGAGAGCAC HE860504 2.5 1.2 1.2 0 0 1.4 0 0 1.6 0 2.2 0 0 0 1.4
TTGACAACGAGAGAGAGCACG HE863301 6.3 0 0 8.1 4.8 2.9 3.9 6.5 3.3 2.1 10.9 0 1.1 1.6 0
TTGACAACGAGAGAGAGCACGC HE860505 0 0 0 0 0 0 0 0 0 0 0 0 1.1 0 0
TTGTCGGCACCCATGAAAGGGCCA HE863303 0 0 0 2.7 0 0 0 0 0 0 0 0 0 0 0
TTTGACAACGAGAGAGAGCAC HE860505 2.5 0 1.2 2.7 0 4.3 1.3 3.2 1.6 4.2 6.5 3 1.1 1.6 0
8_19 AATGTCGTCTGGTTCGAGA HE863305 0 0 1.2 2.7 3.2 1.4 0 0 0 0 0 0 0 1.6 0
AATGTCGTCTGGTTCGAGATC HE860506 1.3 0 0 0 0 1.4 0 0 0 0 0 0 0 0 0
ATTTCGGACCAGGCTTCATTC HE863307 3.8 3.7 3.5 2.7 1.6 4.3 1.3 0 0 0 0 3 0 0 0
ATTTCGGACCAGGCTTCATTCCCC HE860506 0 1.2 0 2.7 0 0 0 0 0 0 2.2 0 0 0 0
CGGACCAGGCTTCATTCC HE863097 0 0 0 0 0 0 0 1.1 0 0 2.2 0 2.2 0 0
CGGACCAGGCTTCATTCCC HE860454 1.3 2.4 0 2.7 1.6 0 1.3 5.4 1.6 0 0 3 1.1 0 0
CGGACCAGGCTTCATTCCCC HE863099 282.2 208 289.6 336.1 187 182.7 235.1 213.3 203.4 265.8 251.8 174.5 449.3 299.6 328.7
CGGACCAGGCTTCATTCCCCT HE863309 2.5 6.1 1.2 8.1 15.9 4.3 0 1.1 4.9 2.1 2.2 0 1.1 3.2 0
GAATGTCGTCTGGTTCGAGA HE860507 1.3 7.3 2.3 2.7 0 8.6 0 0 0 0 0 0 0 0 2.9
GACCAGGCTTCATTCCCC HE860456 1.3 0 0 0 0 0 0 0 1.6 0 0 0 0 0 0
GACCAGGCTTCATTCCCCTCA HE863311 0 0 0 2.7 0 0 0 0 0 0 0 0 0 0 0
GATTTCGGACCAGGCTTCATTCCC HE860507 1.3 0 0 2.7 0 0 0 0 0 0 0 0 0 0 0
GGAATGTCGTCTGGTTCGA HE863313 1.3 1.2 0 0 1.6 2.9 1.3 1.1 1.6 2.1 0 3 1.1 0 1.4
GGAATGTCGTCTGGTTCGAGA HE860508 20.1 15.9 19.9 21.7 28.5 35.7 2.6 5.4 8.2 4.2 0 3 3.4 4.8 5.7
GGAATGTCGTCTGGTTCGAGAT HE863315 0 0 0 2.7 0 0 0 0 0 0 0 0 0 0 0
GGACCAGGCTTCATTCCC HE860457 1.3 0 1.2 0 0 0 0 0 0 0 0 0 0 0 0
GGACCAGGCTTCATTCCCC HE863111 146.7 154.1 143 184.3 136.3 148.4 155 161.6 134.5 189 191 147.9 171.9 174.7 193.8
GGGAATGTCGTCTGGTTCGAG HE860508 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
TCGGACCAGGCTTCATTC HE860457 58.9 64.8 65.6 43.4 28.5 31.4 42.6 54.9 39.4 24.9 28.2 29.6 47.2 54.5 40.2
TCGGACCAGGCTTCATTCC HE863113 440.2 408.6 385.7 417.4 261.5 412.4 384.9 339.3 332.9 180.7 256.2 283.9 159.5 280.4 254.1
TCGGACCAGGCTTCATTCCC HE860458 706.1 675.3 720.9 441.8 321.8 449.5 586.5 627 546.1 388.4 525.4 387.4 410 512.8 541.2
TCGGACCAGGCTTCATTCCCC HE860285 282744.1 279717.9 296598.2 273500 243934.6 239360.7 306036.6 275122.8 248117.2 282794.4 317557.2 199637.5 217491.6 348033.3 350352.6
TCGGACCAGGCTTCATTCCCCT HE863317 37.6 41.6 39.9 27.1 12.7 21.4 59.4 47.4 41 31.2 28.2 35.5 33.7 32 40.2
TCGGACCAGGCTTCATTCCCCTC HE860509 0 0 1.2 0 0 0 0 0 0 2.1 0 0 0 0 0
TTCGGACCAGGCTTCATTCC HE863319 1.3 0 2.3 0 4.8 1.4 0 1.1 0 0 0 0 0 0 0
TTCGGACCAGGCTTCATTCCC HE860509 184.4 223.9 195.8 273.7 416.9 299.7 49.1 62.5 47.6 24.9 17.4 23.7 35.9 49.7 43.1
TTCGGACCAGGCTTCATTCCCC HE863321 153 168.8 158.3 219.5 280.6 191.2 117.5 101.3 95.1 27 32.6 20.7 35.9 57.7 44.5
TTCGGACCAGGCTTCATTCCCCT HE860510 1.3 0 0 0 1.6 0 0 0 0 0 0 0 0 0 0
TTGAGGGGAATGTCGTCTGG HE863323 1.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
TTTCGGACCAGGCTTCATTCC HE860510 67.7 104 85.6 103 187 114.2 41.3 25.9 24.6 4.2 6.5 20.7 14.6 11.2 15.8
8_21 CACGTGCTCCCCTTCTCC HE863325 0 0 0 0 0 0 0 0 0 2.1 0 0 0 0 0
CACGTGCTCCCCTTCTCCAAC HE860511 2.5 1.2 2.3 0 4.8 10 10.3 4.3 11.5 12.5 17.4 20.7 3.4 1.6 4.3
TGGAGAAGCAGGGCACGTGCA HE860424 55.2 30.6 24.6 62.3 7.9 45.7 14.2 28 21.3 20.8 17.4 29.6 6.7 8 4.3
Open in a new tab

BF, pink; F, bloom; GF, swollen flower bud; O, half-inch green; GL, swollen leaf bud.

IsomiRs identification and analysis

IsomiRs at each locus were blasted against miRBase. In some cases no mismatches were reported with the conserved sequences present in miRBase (e.g., miR403, miR394, miR166, miR156) while in some others mismatches were present and related to differences in the sequence and/or in its length. Detailed blast results are reported in File S8 in Supplementary Material which reports blast results based both on mature sequences (sheet “mature”) and precursor sequences (sheet “precursors”) deposited in miRBase. The file reports the matching sequence with the lowest e-value. When more than one matching sequence, belonging to different miRNA families, were found to have the same e-value all of them were reported.

Some miRNA families have more than one putative locus, therefore miRDeeP assigned common reads to all the possible loci. Both miRNA and miRNA*-related reads were identified at each locus. In some cases putative miRNAs* were identified on the basis of the alignment orientation (± with miRNA mature sequence deposited in miRBase) in some others the miRNA* sequences were already deposited in miRBase. The results of Table 2 highlight that some loci are characterized by a larger set of variants than others.

In the majority of the loci the most frequent read for a specific locus was the same in all the tested samples and across all the replicates of a sample (Table 2). Only in a few cases were some differences detected among samples or among replicates belonging to the same sample. Locus named 3_16 is particularly interesting because all the replicates of sample O have as the most frequent read the one corresponding to miRNA* (Table 2).

In some loci also the second most frequent read referred to the mature miRNA was the same in all the replicates of a sample and in all the samples. The second most frequent read was often obtained by a different cutting site at 5′ or 3′ ends. As reported above, miRNA*-related reads have also been identified by miRDeep-P for most of the 26 loci and length variability was detected for both 5′ and 3′ends.

Target analysis was carried out by psRNATarget. The whole set of targets identified is reported in File S9 in Supplementary Material.

Intra- and inter-samples analysis

The average Pearson correlation between all the possible pairs of replicates belonging to the same biological sample was calculated, in order to evaluate whether it was in agreement with the “Standards, guidelines, and best practices for RNA-seq” adopted by ENCODE Consortium.4 Average correlation coefficients were equal to 0.98 for BF, 0.95 for F, 0.98 for GF, 0.95 for GL, and 0.97 for O. For the sake of completeness and in order to allow a comparison between related and unrelated samples, we also calculated the average Pearson correlation between samples of different tissues, which was equal to 0.66 on the basis of the reads reported in Table 2. All the Pearson coefficients are reported in File S10 in Supplementary Material. Figure 1A reports the results obtained from clustering the five samples on the basis of all the reads frequencies (average frequencies of three replicates, reads included miRNA*-related reads; reads assigned by miRDeep-P to more than one locus were counted once) at the 26 loci analyzed. Additionally, a clustering analysis was performed by considering only the count of the most frequent read in each locus. The analysis included those loci where the most frequent read was the same in all the samples (16 different reads, Figure 1B). Figure A1 in Appendix reports clustering results obtained without averaging the three replicates of each sample. As it can be seen, replicates are always grouped correctly.

Figure 1.

Figure 1

Open in a new tab

Reports the results obtained by cluster analysis of the five tissues on the basis of the frequencies of all the reads (A) or on the basis of the frequency of the most frequent read in each locus (B). For each tissue, the average frequency across the three replicates was considered (miRNA* -related reads are included). In (B), the analysis included only those loci where the most frequent read was the same in all the samples. BF, pink; F, bloom; GF, swollen flower bud; O, half-inch green; GL, swollen leaf bud.

A t-test was also performed for all the possible comparisons of biological samples (File S11 in Supplementary Material). The most frequent isomiR (highlighted in yellow in File S11 in Supplementary Material) is frequently the one able to distinguish the higher number of samples (e.g., locus 4_21, locus 6_4). Some miRNA-related reads are able to differentiate most of the analyzed samples: e.g., miR398 and miR167 got 8 significant comparisons out of 10.

Discussion

To assess the putative biological significance of isomiRs in peach, in the present study we carried out miRNAs profiling by sequencing three replicates of five biological samples arising from a set of different organs and/or phenological stages. Actually, variants of miRNAs are commonly found in deep sequencing experiments but their functional meaning and stability is still under investigation in plants.

Twenty-six miRNA putative loci expressed in all samples analyzed have been identified by miRdeep-P and analyzed for miRNA population heterogeneity. The average length of miRNA associated reads was included between 18 nt and 24 nt. Several previous works reported a miRNA length in plants included between 22 nt and 24 nt. The identification of miRNA* associated reads provides more evidence about reliability of the loci identified by miRDeep-P.

All the analyzed loci show miRNA length variants but tend to maintain the uridine at the 5′ end, in those cases where uridine is the first base of the most abundant isomiR. As reported above, uridine is the most frequent nucleotide in AGO1 association, perhaps explaining the drive to maintain it at the 5′ end. Ebhardt et al. (2009) reported examples of miRNA with 5′ deletions and 3′ uridine additions that create a different distribution in AGO complexes. As an example, ath-miR822 was determined to reside almost exclusively in the AGO1 complex while its modified variant with a U deletion at 5′ end and a UU addition at 3′end was found equally in AGO1 and AGO4 complexes.

The difference in read count between the first most frequent read and the second most frequent read varies among loci being in some cases minimal (e.g., locus 1_5) while in some others it is quite consistent (e.g., loci 4_21, 6_4). In some loci the second most frequent read was the same in all the replicates of a sample and in all the different samples. The presence of the same isomiRs in different biological replicates of a sample and in different tissues demonstrate that the generation of most of the detected isomiRs is not random. The importance of evaluating the correlation between biological replicates from RNA-seq experiments has been discussed previously in several papers (Oshlack et al., 2010; Hansen et al., 2011). As above reported, the correlation among biological replicates has been calculated to check the reliability of the experiment on the basis of the “Standards, guidelines, and best practices for RNA-seq” adopted by ENCODE Consortium which requires that the Pearson correlation of gene expression between two biological replicates for RNAs that are detected in both samples using RPKM or read counts should be between 0.92 and 0.98. Regarding the present work, the average Pearson correlation between all the possible pairs of replicates belonging to the same biological sample was greater than or equal to 0.95 for all the tested samples, in agreement with the required standards. Clustering results and t-test reported in Figure 1 and File S11 in Supplementary Material, respectively, show that it is possible to clearly distinguish among samples and to group them in a functional way. However, when considering Figure A1 in Appendix obtained without averaging replicates of each sample, it should be noted that clustering results seem to be more confident when only the most frequent read is taken into account: BF (pink) and F (bloom) are more strictly related being two subsequent phenological stages so it is expected to find a closer relationship between them.

The co-existence of different variants with a similar level of expression could imply a biological role for all of them. Locus 1_26 shows such an example: in this case there are two prevalent isomiRs (HE860305 and HE860450) that differ for one T at the 5′ end. For both the isomiRs there are then variants at the 3′ end with different lengths.

Target analysis carried out by psRNATarget (File S9 in Supplementary Material) revealed that in many cases isomiRs share the same target. However, because AGO invariably catalyzes the cleavage of targets opposite the bond between nucleotides 10 and 11 from the 5′ end of the miRNA, the cleavage products are different when there is a shift toward the 5′ end or nucleotide addition at the 5′ end of the miRNA mature sequence. Differences in cleavage sites among members of the same miRNA family have been recently studied in rice by Jeong et al. (2011) highlighting a different abundance of specific cleavage sites among plant organs.

A very interesting finding is related to the biological role of miRNA*. Despite the general consensus that miRNAs* have no regulatory activity, several recent publications have provided evidence about their biological function (Mah et al., 2010). In our results, isomiRs have been found also for miRNAs*. As an example, at locus 3_16 the conserved miRNA* has a high number of length variants, most due to a variable 3′end. Locus 3_16 codes for miR482: the miRNA* sequence deposited in miRBase was actually the most frequent read (HE860347) in all the three replicates of sample O (half-inch green) with an average ratio miRNA/miRNA* equal to 0.4. GF and GL showed an average ratio of miRNA/miRNA* equal to 5.7, while in BF and F the ratio was close to one in two out of three replicates. Similar results have been previously found in mammals by Kuchenbauer et al. (2012) that classified miRNA/miRNA* ratios into groups showing that about 50% of all miRNA duplexes revealed high ratios (>100) consistent with a strong preferential processing of one dominant miRNA strand. About 24% had intermediate ratios (between 100 and 10), about 13% showed low ratios (between 10 and 1), while another 13% showed inverted ratios (<1). The finding that miRNAs can display tissue-dependent miRNA arm selection opposes the general consensus that only one strand is highly dominant for any given miRNA duplex and opens insights into the possible biological function of selective accumulation of miRNA*. A recent review of Sunkar et al. (2012), discusses several studies showing that miRNA* tend to accumulate at a high level under particular conditions. As an example, miR393* accumulates at a high level during infection of P. syringae in Arabidopsis leaves and promotes plant resistance to bacterial infection. Mir399* is accumulated at high levels during phosphate deprivation in Arabidopsis and miR395* accumulates at high levels in Sorghum grown in optimal nutrient conditions.

PsRNATarget has been used to investigate possible target genes for miR482 and miR482* at locus 3_16. MiRNA482 target a peach sequence coding for a “probable receptor-like protein kinase” (expectation = 2, target accessibility = 17.288), while miRNA482* targets a NADH dehydrogenase gene (expectation = 3, target accessibility = 8.463). Examples of different targets for a pair of miRNA/miRNA* are reported in previous studies (Sunkar et al., 2012). Mir393 and miR393* target two entirely different gene families (TIR1 and SNARE) both involved in pathogen resistance of host plant. The possibility that a target-dependent strand selection based on the presence in the cell of miRNA or miRNA* targets might influence the selection of the active miRNA arm has been discussed by other authors. For instance Chatterjee and Grosshans (2009) reported that mRNAs can stabilize their cognate miRNAs thus suggesting coordinated RISC assembly which depends on a miRNA and its target levels.

Results obtained in the present work contribute to a deeper view of the miRNome complexity and to a better exploitation of the mechanism of action of these tiny regulators. The exact definition of the entire repertoire of peach miRNAs is in fact a prerequisite for a correct description of miRNAs whose expression is altered in response to specific developmental conditions or environmental stimuli. Future experiments based on small RNA-seq coupled with RNA-seq on the same samples will be carried out to highlight more clearly the possible biological role of miRNA isomiRs in plants.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary Material

The Supplementary Material for this article can be found online at: http://www.frontiersin.org/Plant_Genetics_and_Genomics/10.3389/fpls.2012.00165/abstract

File S1

Reports the miRNA coding loci identified by miRDeep-P in pink sample.

Click here for additional data file. (62KB, ZIP)
File S2

Reports the miRNA coding loci identified by miRDeep-P in bloom sample.

Click here for additional data file. (36.7KB, ZIP)
File S3

Reports the miRNA coding loci identified by miRDeep-P in swollen flower bud sample.

Click here for additional data file. (60.9KB, ZIP)
File S4

Reports the miRNA coding loci identified by miRDeep-P in half-green sample.

Click here for additional data file. (40.2KB, ZIP)
File S5

Reports the miRNA coding loci identified by miRDeep-P in swollen leaf bud sample.

Click here for additional data file. (50.1KB, ZIP)
File S6

Reports a summary of the miRNA coding loci identified by miRDeep-P.

Click here for additional data file. (10.4MB, XLS)
File S7

Reports the link between locus name and locus position.

Click here for additional data file. (45KB, XLS)
File S8

Reports the results of the blast analysis against known plant miRNAs.

Click here for additional data file. (170.5KB, XLS)
File S9

Reports target analysis for all the identified isomiRs.

Click here for additional data file. (81.5KB, DOCX)
File S10

Reports Pearson correlation coefficients between all the possible pairs of replicates belonging to the same biological sample, as well as samples from different tissues.

Click here for additional data file. (37KB, XLS)
File S11

Reports the results of the t-test which was performed for all the possible comparisons of biological samples. The most frequent isomiR in each locus is highlighted in yellow.

Click here for additional data file. (130.5KB, XLS)

Acknowledgments

We thank Keith Anthony Grimaldi for helping with the preparation of the manuscript. The present work has been supported by Drupomics Project (Italian Ministry for Agriculture). We acknowledge the International Peach Genome Initiative for pre-publication access to the peach genome sequence.

Appendix

Figure A1.

Figure A1

Open in a new tab

Reports the results obtained by cluster analysis as in Figure 1 but in this case without averaging the replicates of each sample. In details, (A) reports the results obtained by cluster analysis of the five tissues on the basis of the frequencies of all the reads, while (B) reports results obtained on the basis of the frequency of the most frequent read in each locus. Abbreviations: pink = BF, bloom = F, swollen flower bud = GF, half-inch green = O, swollen leaf bud = GL.

Footnotes

References

  1. Chapman P. J., Catlin G. A. (1976). Growth stages in fruit trees from dormant to fruit set. N. Y. Food Life Sci. Bull. 58 [Google Scholar]
  2. Chatterjee S., Grosshans H. (2009). Active turnover modulates mature miRNA activity in Caenorhabditis elegans. Nature 461, 546–549 10.1038/nature08349 [DOI] [PubMed] [Google Scholar]
  3. Dai X., Zhao P. X. (2011). PsRNATarget: a plant small RNA target analysis server. Nucleic Acids Res. 39, W155–W159 10.1093/nar/gkr319 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Eamens A. L., Smith N. A., Curtin S. J., Wang M. B., Waterhouse P. M. (2009). The Arabidopsis thaliana double-stranded RNA binding protein DRB1 directs guide strand selection from microRNA duplexes. RNA 15, 2219–2235 10.1261/rna.1646909 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Ebhardt H. A., Tsang H. H., Dai D. C., Liu Y., Bostan B., Fahlman P. (2009). Meta-analysis of small RNA-sequencing errors reveals ubiquitous post-transcriptional RNA modifications. Nucleic Acids Res. 37, 2461–2470 10.1093/nar/gkp093 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Guo L., Lu Z. (2010). Global expression analysis of miRNA gene cluster and family based on isomiRs from deep sequencing data. Comput. Biol. Chem. 34, 165–171 10.1016/j.compbiolchem.2010.06.001 [DOI] [PubMed] [Google Scholar]
  7. Hansen K. D., Wu Z., Irizarry R. A., Leek J. T. (2011). Sequencing technology does not eliminate biological variability. Nature Biotechnol. 29, 572–573 10.1038/nbt.1910 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Jeong D.-H., Park S., Zhai J., Gurazada S. G. R., de Paoli E., Meyers B. C., Green P. J. (2011). Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage. Plant Cell 23, 4185–4207 10.1105/tpc.111.089045 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Jones-Rhoades M. W., Bartel D. P., Bartel B. (2006). MicroRNAs and their regulatory roles in plants. Annu. Rev. Plant Biol. 57, 19–53 10.1146/annurev.arplant.57.032905.105218 [DOI] [PubMed] [Google Scholar]
  10. Kozomara A., Griffith-Jones S. (2011). miRBase: Integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res. 39, D152–D157 10.1093/nar/gkq1027 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kuchenbauer F., Mah S. M., Heuser M., McPherson A., Rüschmann J., Rouhi A., Berg T., Bullinger L., Argiropoulos B., Morin R. D., Lai D., Starczynowski D. T., Karsan A., Eaves C. J., Watahiki A., Wang Y., Aparicio S. A., Ganser A., Krauter J., Döhner H., Döhner K., Marra M. A., Camargo F. D., Palmqvist L., Buske C., Humphries R. K. (2012). Comprehensive analysis of mammalian miRNA* species and their role in myeloid cells. Blood 118, 3350–3358 10.1182/blood-2010-10-312454 [DOI] [PubMed] [Google Scholar]
  12. Lee L. W., Zhang S., Etheridge A., Ma L., Martin D., Galas D. (2012). Complexity of the microRNA repertoire revealed by next-generation sequencing. RNA 16, 2170–2180 10.1261/rna.2225110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Mah S. M., Buske C., Humphries R. K., Kuchenbauer F. (2010). miRNA*: a passenger stranded in RNA-indiced silencing complex? Crit. Rev. Eukaryot. Gene Expr. 20, 141–148 10.1615/CritRevEukarGeneExpr.v20.i2.40 [DOI] [PubMed] [Google Scholar]
  14. Mi S., Cai T., Hu Y., Chen Y., Hodges E., Ni F., Wu L., Li S., Zhou H., Long C., Chen S., Hannon G. J., Qi Y. (2008). Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5′ terminal nucleotide. Cell 133, 116–127 10.1016/j.cell.2008.02.034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Moxon S., Schwach F., Dalmay T., MacLean D., Studholme D. J., Moulton V. (2008). A toolkit for analyzing large-scale plant small RNA datasets. Bioinformatics 24, 2252–2253 10.1093/bioinformatics/btn428 [DOI] [PubMed] [Google Scholar]
  16. Mückstein U., Tafer H., Hackermüller J., Bernhart S. H., Stadler P. F., Hofacker I. L. (2006). Thermodynamics of RNA–RNA binding. Bioinformatics 22, 1177–1182 10.1093/bioinformatics/btl024 [DOI] [PubMed] [Google Scholar]
  17. Oshlack A., Robinson M. D., Young M. D. (2010). From RNA-seq reads to differential expression results. Genome Biol. 11, 220. 10.1186/gb-2010-11-12-220 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Sunkar R., Li Y.-F., Jagadeeswaran G. (2012). Functions of microRNAS in plant stress responses. Trends Plant Sci. 17, 196–203 10.1016/j.tplants.2012.01.010 [DOI] [PubMed] [Google Scholar]
  19. Takeda A., Iwasaki S., Watanabe T., Utsumi M., Watanabe Y. (2008). The mechanism selecting the guide strand from small RNA duplexes is different among argonaute proteins. Plant Cell Physiol. 49, 493–500 10.1093/pcp/pcn043 [DOI] [PubMed] [Google Scholar]
  20. Vaucheret H. (2009). AGO1 homeostasis involves differential production of 21-nt and 22-nt miR168 species by miR168a and miR168b. PLoS ONE 4, e6442. 10.1371/journal.pone.0006442 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Voinnet O. (2009). Origin, biogenesis, and activity of plant microRNAs. Cell 136, 669–687 10.1016/j.cell.2009.01.046 [DOI] [PubMed] [Google Scholar]
  22. Xie Z., Khanna K., Ruan S. (2010). Expression of microRNAs and its regulation in plants. Semin. Cell Dev. Biol. 21, 790–797 10.1016/j.semcdb.2010.03.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Yang X., Li L. (2011). miRDeep-P: A computational tool for analyzing the microRNA transcriptome in plants. Bioinformatics 27, 2614–2615 10.1093/bioinformatics/btr041 [DOI] [PubMed] [Google Scholar]
  24. Zhang Y. (2005). miRU: An automated plant miRNA target prediction server. Nucleic Acids Res. 33(Suppl. 2), W701–W704 10.1093/nar/gki479 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

File S1

Reports the miRNA coding loci identified by miRDeep-P in pink sample.

Click here for additional data file. (62KB, ZIP)
File S2

Reports the miRNA coding loci identified by miRDeep-P in bloom sample.

Click here for additional data file. (36.7KB, ZIP)
File S3

Reports the miRNA coding loci identified by miRDeep-P in swollen flower bud sample.

Click here for additional data file. (60.9KB, ZIP)
File S4

Reports the miRNA coding loci identified by miRDeep-P in half-green sample.

Click here for additional data file. (40.2KB, ZIP)
File S5

Reports the miRNA coding loci identified by miRDeep-P in swollen leaf bud sample.

Click here for additional data file. (50.1KB, ZIP)
File S6

Reports a summary of the miRNA coding loci identified by miRDeep-P.

Click here for additional data file. (10.4MB, XLS)
File S7

Reports the link between locus name and locus position.

Click here for additional data file. (45KB, XLS)
File S8

Reports the results of the blast analysis against known plant miRNAs.

Click here for additional data file. (170.5KB, XLS)
File S9

Reports target analysis for all the identified isomiRs.

Click here for additional data file. (81.5KB, DOCX)
File S10

Reports Pearson correlation coefficients between all the possible pairs of replicates belonging to the same biological sample, as well as samples from different tissues.

Click here for additional data file. (37KB, XLS)
File S11

Reports the results of the t-test which was performed for all the possible comparisons of biological samples. The most frequent isomiR in each locus is highlighted in yellow.

Click here for additional data file. (130.5KB, XLS)

Articles from Frontiers in Plant Science are provided here courtesy of Frontiers Media SA

RESOURCES