Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2012 Jul;50(7):2310–2314. doi: 10.1128/JCM.00303-12

Accurate Identification of Candida parapsilosis (Sensu Lato) by Use of Mitochondrial DNA and Real-Time PCR

Ana Carolina R Souza a, Renata C Ferreira a,b,c, Sarah S Gonçalves a, Guillermo Quindós d, Elena Eraso d, Fernando C Bizerra a, Marcelo R S Briones b,c, Arnaldo L Colombo a,✉
PMCID: PMC3405582  PMID: 22535986

Abstract

Candida parapsilosis is the Candida species isolated the second most frequently from blood cultures in South America and some European countries, such as Spain. Since 2005, this species has been considered a complex of 3 closely related species: C. parapsilosis, Candida metapsilosis, and Candida orthopsilosis. Here, we describe a real-time TaqMan-MGB PCR assay, using mitochondrial DNA (mtDNA) as the target, which readily distinguishes these 3 species. We first used comparative genomics to locate syntenic regions between these 3 mitochondrial genomes and then selected NADH5 as the target for the real-time PCR assay. Probes were designed to include a combination of different single-nucleotide polymorphisms that are able to differentiate each species within the C. parapsilosis complex. This new methodology was first tested using mtDNA and then genomic DNA from 4 reference and 5 clinical strains. For assay validation, a total of 96 clinical isolates and 4 American Type Culture Collection (ATCC) isolates previously identified by internal transcribed spacer (ITS) ribosomal DNA (rDNA) sequencing were tested. Real-time PCR using genomic DNA was able to differentiate the 3 species with 100% accuracy. No amplification was observed when DNA from other species was used as the template. We observed 100% congruence with ITS rDNA sequencing identification, including for 30 strains used in blind testing. This novel method allows a quick and accurate intracomplex identification of C. parapsilosis and saves time compared with sequencing, which so far has been considered the “gold standard” for Candida yeast identification. In addition, this assay provides a useful tool for epidemiological and clinical studies of these emergent species.

INTRODUCTION

Candida albicans remains the most prevalent species in human superficial and invasive Candida infections, although there is concern over the increasing rates of non-C. albicans infections worldwide (2, 18). C. parapsilosis is a relevant pathogen primarily in South America, where it causes from 19% to 38% of all episodes of candidemia (6, 25, 26). Similarly, data by Almirante et al. (2005) and Canton et al. (2011) show that C. parapsilosis causes from 15% to 23% of all hematogenous candidiasis cases in Spanish hospitals (1, 4).

Recently, the genetically heterogeneous taxon C. parapsilosis was reclassified into 3 species: Candida parapsilosis (sensu stricto), Candida orthopsilosis, and Candida metapsilosis (30). Although the epidemiological and clinical differences caused by these Candida species have not yet been fully determined, several in vitro studies have demonstrated biological differences between them, including th

e expression of virulence factors, susceptibility to antifungal agents, and geographical distribution (3, 10, 12, 13, 22, 24).

Currently, species identification within the C. parapsilosis complex is based on DNA techniques such as randomly amplified polymorphic DNA analysis, restriction fragment length polymorphism analysis of the SADH locus, and sequencing of the internal transcribed spacer (ITS) (13, 20, 31). These methods are time-consuming and labor-intensive and, with the exception of DNA sequencing, may have accuracy and reproducibility limitations (23, 27).

Because mutation rates in the mitochondrial genome are higher than those in the nuclear genome, it is possible to obtain sufficient resolution to distinguish close phylogenetic relationships (5). Indeed, our group has shown that mitochondrial DNA (mtDNA) sequences can be readily used to discriminate Candida glabrata isolates. Analysis of the cytochrome c oxidase subunit 2 (COX2) enables typing of C. glabrata and clustering of strains in association with their geographical origins (28).

In the present study, we describe a specific, fast, sensitive, and accurate real-time PCR method based on mtDNA-specific target detection that is capable of discriminating all 3 species within the C. parapsilosis complex.

MATERIALS AND METHODS

Microorganisms.

A total of 100 C. parapsilosis (sensu lato) strains were used to validate our assay: (i) four reference strains obtained from the American Type Culture Collection (ATCC), C. parapsilosis (sensu stricto) ATCC 22019 and ATCC 90018, C. orthopsilosis ATCC 96141, and C. metapsilosis ATCC 96143; (ii) a panel of 66 clinical isolates obtained from different body sites and geographical regions of Brazil previously identified to the species level by sequencing of the ITS region (part of this collection had already been deposited in GenBank [NCBI]) (13); and (iii) a group of 30 well-characterized C. parapsilosis (sensu lato) clinical isolates that were kindly provided in a blind fashion by G. Quindós (Bilbao, Spain) (see Table S1 in the supplemental material) (24). In addition, the reference strains C. albicans (ATCC 90029), Candida tropicalis (ATCC 750), C. glabrata (ATCC 90030), Candida lusitaniae (ATCC 66035), Candida krusei (ATCC 6258), and Lodderomyces elongisporus (CBS 2605) were also tested as controls. Tests for viability, purity, and phenotypic identification of the samples were performed as previously described (13).

Microorganism identification using amplification and sequencing of ITS region of ribosomal DNA.

The genomic DNA was extracted from single colonies using glass beads (19). Amplification and sequencing were performed with the universal primers ITS1 and ITS4 (Table 1) (32). PCR and sequencing were performed as previously described by our group (14).

Table 1.

Oligonucleotide primers and probes sequences used in this study

Oligonucleotidea Sequence 5′ to 3′ Modificationb
Purpose
5′ end 3′ end
ITS1c TCCGTAGGTGAACCTGCGG None None ITS sequencing
ITS4c GCATATCAATAAGCGGA None None ITS sequencing
NADH5 F GTGCTGGTTCTGTTATTCATAG None None NADH5 sequencing
NADH5 R GCCAGAGTCTACCATTAACCTAC None None NADH5 sequencing
RT-NADH5 F CATATACATGAAAATATACGTATG None None Real-time PCR
RT-NADH5 R CATTATCTCTATTAAATCCAATAA None None Real-time PCR
Cp NADH5 TTCCTATGATTATATTAGTTATCTAT FAM MGB C. parapsilosis NADH5 probe
Co NADH5 TACCTATGGTAATATTAGTAATATAT VIC MGB C. orthopsilosis NADH5 probe
Cm NADH5 TACCTATGGTTATTTTAGTAATTTAT NED MGB C. metapsilosis NADH5 probe
a

The letters F and R in the primer names describe the orientation of the primer 5′ to 3′: F for forward (sense) and R for reverse (antisense).

b

FAM, 6-carboxyfluorescein.

c

White et al. (17).

In silico selection of the mtDNA target gene for species identification.

Complete mitochondrial genome sequences from 3 Candida species were retrieved from GenBank (NCBI): C. parapsilosis CBS7157 (accession number X74411), C. parapsilosis CLIB214 (accession number DQ026513), C. orthopsilosis MCO456 (accession number AY962590), C. orthopsilosis MCO471 (accession number DQ026513), C. metapsilosis MCO448 (accession number NC006971), and C. metapsilosis PL448 (accession number AY391853). We generated a whole-genome alignment using the Progressive Mauve algorithm in the MAUVE program (7) to verify the synteny. Selected sequences were aligned using the Seaview program (version 4) (16).

Extraction and amplification of Candida yeast mitochondrial DNA for verification of single-nucleotide polymorphism (SNP) presence on the target gene.

Mitochondrial DNA was isolated as described elsewhere with a yield of 100 ng/μl (8). A 620-bp fragment of mitochondrial NADH5 was amplified and sequenced with specific primers (Table 1). PCR (25 μl) was performed using the MasterMix protocol (Promega, Madison, WI). The conditions of PCR cycles were 3 min at 95°C, followed by 40 cycles at 95°C for 45 s, 52°C for 45 s, and 1 min at 72°C and by a final 5-min extension at 72°C.

PCR products were purified using an Amicon Ultra-0.5 kit (Millipore, MA) and sequenced in an ABI3100 automated sequencer (Applied Biosystems). Phred-Phrap-Consed were used for the assembly and finishing of high-quality sequences (Phred scores, >40) (9, 15). Species were identified by use of the Basic Local Alignment Search Tool (BLAST) with an E value of <10−5 as the cutoff.

Identification of C. parapsilosis (sensu stricto), C. orthopsilosis, and C. metapsilosis strains by real-time PCR. (i) Primer and probe design.

Primers and probes specific for the NADH5 gene were designed using Primer Express software (Applied Biosystems). Sequences and characteristics of the primers and probes are shown in Table 1.

(ii) Real-time PCR assay.

Real-time PCR was performed in a StepOnePlus real-time PCR system (Applied Biosystems). The reaction mix contained 12.5 μl of TaqMan universal PCR master mix (Applied Biosystems), 400 nM each primer, 250 nM probe, and 160 ng of genomic DNA (or 40 ng of mtDNA) from the different tested strains in a final volume of 25 μl. A single-color simplex assay was used, in which each probe was added to different reaction tubes. Real-time PCR conditions were as follows: initial denaturation at 50°C for 2 min and 95°C for 10 min, 40 cycles of 95°C for 15 s and 51°C for 30 s, and a final elongation step of 1 min at 60°C. Fluorescence was measured for 1 min during the elongation step. The assay sensitivity was estimated by comparing the real-time identification results with the identification by ITS sequencing. To ensure the specificity of the assay, we used genomic DNA from L. elongisporus and different Candida species (C. albicans, C. tropicalis, C. glabrata, C. lusitaniae, and C. krusei) as the templates in the reaction.

Nucleotide sequence accession numbers.

The sequences generated in this study have been deposited in the GenBank (NCBI) database (http://www.ncbi.nlm.nih.gov/GenBank) under the following accession numbers: JQ963283, JQ963277, JQ952736, JQ952738, JQ952737, JQ952741, JQ963282, JQ952736, JQ952739, JQ952740, JQ952742, JQ963278, JQ963280, JQ963281, JQ963279, JN989516, JN989528, JN989517, JN989529, JN989518, JN989530, JN989519, JN989531, JN989532, JN989533, JN989520, JN989534, JN989535, JN989521, JN989522, JN989536, JN997459, JN989523, JN989524, JN989537, JN989525, JN989526, JQ963284, JN989527, JQ963285, JN989507, JN989508, JN989509, JN989510, JN989511, JN989498, JN989499, JN980098, JN980099, JN980100, JN989496, JN989500, JN989502, JN989503, JN989505, JN989512, JN989506, JN989501, JN989497, JN989504, JN585704, JQ585706, JQ585705, JQ585713, JQ585709, JQ585711, JQ585710, JQ585707, JQ585714, JN989513, JN989514, JN989515, and JQ585715.

RESULTS

Molecular identification by sequencing of the ITS region of all clinical isolates (66 Brazilian and 30 Spanish strains).

The strains were initially identified as C. parapsilosis (sensu lato) on the basis of their micromorphology characteristics and biochemical profiles using the ID32C system (bioMérieux, Marcy l′Etoile, France) (data not shown). ITS sequencing was used as the “gold standard” for the identification to the species level of all clinical strains tested. The amplicon lengths of the ITS regions were 593 bp to 612 bp, and sequences generated were used in BLAST searches (http://www.ncbi.nlm.nih.gov) to confirm the preliminary identifications. BLAST analysis with the ITS sequences was capable of identifying all reference and clinical strains as follows: 50 isolates were identified as C. parapsilosis (sensu stricto), 40 were identified as C. orthopsilosis, and 10 were identified as C. metapsilosis.

In silico analysis.

In silico analysis showed that the mitochondrial genomes of C. parapsilosis (sensu stricto), C. orthopsilosis, and C. metapsilosis are syntenic. The criterion for selecting the target gene was to find regions with different SNP profiles that were capable of discriminating the 3 species and that were flanked by conserved sequences in the same region of the chromosome. On the basis of the alignments from the 6 mitochondrial whole-genome sequences, we selected NADH5 as the target for real-time PCR. The pairwise uncorrected distances between three species for the complete sequence were 5.10% for C. parapsilosis (sensu stricto) and C. metapsilosis, 4.85% for C. parapsilosis (sensu stricto) and C. orthopsilosis, and 5.16% for C. metapsilosis and C. orthopsilosis. SNPs identified in silico were confirmed by sequencing 620 bp of NADH5 of the 4 reference strains and 6 clinical isolates (LEMI6492, LEMI6814, LEMI7685, LEMI8521, LEMI7787, LEMI7518) (Fig. 1). The partial sequences of C. parapsilosis (sensu stricto) and C. metapsilosis showed 100% sequence similarity with each of the control strains. Strain LEMI7518, identified as C. orthopsilosis, has seven nucleotide differences from the reference strain, with one nucleotide difference being inside the probe region (Fig. 1).

Fig 1.

Fig 1

Local alignment of the NADH5 gene. Primer regions are shown in boxes (forward primer from 223 to 246 bp; reverse primer from 284 to 307 bp), and the probe region (from 251 to 276 bp) is in the dashed box. The SNP between the C. orthopsilosis strains located in the probe region is at position 270 bp. Cp, C. parapsilosis (sensu stricto); Cm, C. metapsilosis; Co, C. orthopsilosis.

Molecular identification by real-time PCR.

Primers were designed to be specific for the C. parapsilosis species complex and to anneal to a highly conserved region of NADH5. Three different specific probes (TaqMan-MGB) targeting a region of NADH5 were designed for the 3 species within the C. parapsilosis complex. Initially, the ability of each probe to specifically identify its target was assessed using mtDNA from 4 reference strains and 5 clinical isolates (LEMI7294, LEMI6492, LEMI3523, LEMI3494, LEMI8521) as the template. Different annealing temperatures, probe concentrations, and mtDNA concentrations were tested to ensure specificity and good reproducibility (data not shown) of the PCR assay, and the best performance was obtained using 51°C, 250 nM, and 40 ng/reaction mixture, respectively. The assay was determined to be species specific because (i) all strains tested were correctly identified, (ii) nonspecific amplification was not observed, and (iii) no cross-species probe signal was observed.

To show that we obtain identical results using either purified mtDNA or total cellular DNA, we compared the specificity and sensitivity of the method using total DNA from reference strains as the template. We used the same annealing temperature and probe concentrations established for the mtDNA assays. Different genomic DNA concentrations were tested (data not shown), and a concentration of 160 ng/reaction mixture was selected. Similar to the mtDNA analysis, the probes were very specific at the species level, and all strains tested were correctly identified.

After the standardization of the real-time PCR assay, we applied this method to analyze the genomic DNA of all the clinical isolates from Brazil included in this study (n = 66). By real-time PCR, we identified 37 as C. parapsilosis (sensu stricto), 24 as C. orthopsilosis, and 5 as C. metapsilosis. The results generated by real-time PCR showed 100% concordance with the results obtained by ITS sequencing (Table 2). In addition, all isolates from G. Quindós tested in a blinded fashion (n = 30) were correctly identified as the following: 21 C. parapsilosis (sensu stricto), 5 C. orthopsilosis, and 4 C. metapsilosis. The Spanish strains were originally identified in G. Quindós's lab by ITS sequencing (24).

Table 2.

Comparison of the identification of C. parapsilosis species complex isolates by ITS sequencing and the real-time PCR assay

Strain group and species identified by ITS sequencing (no. of isolates tested) No. of isolates identified by real-time PCR assay
% agreementa
C. parapsilosis (sensu stricto) C. orthopsilosis C. metapsilosis
Reference strains (4) 100
    C. parapsilosis (sensu stricto) (2) 2 0 0
    C. orthopsilosis (1) 0 1 0
    C. metapsilosis (1) 0 0 1
Clinical isolates (66) 100
    C. parapsilosis (sensu stricto) (27) 27 0 0
    C. orthopsilosis (34) 0 34 0
    C. metapsilosis (5) 0 0 5
Blinded strains (30) 100
    C. parapsilosis (sensu stricto) (21) 21 0 0
    C. orthopsilosis (5) 0 5 0
    C. metapsilosis (4) 0 0 4
Control strains (5) NAb
    C. albicans (1) 0 0 0
    C. tropicalis (1) 0 0 0
    C. krusei (1) 0 0 0
    C. glabrata (1) 0 0 0
    C. lusitaniae (1) 0 0 0
    L. elongisporus (1) 0 0 0
a

Agreement analysis was performed between the real-time PCR assay described in the current study and the “gold standard” technique (ITS sequencing).

b

NA, not applicable.

DISCUSSION

In the present study, we describe a rapid and accurate method using mtDNA and TaqMan technology for identification of the 3 species within the C. parapsilosis complex. We decided to use mtDNA because it has been recognized to be a valuable target for evaluating close phylogenetic relationships because of its higher rate of mutation than nuclear DNA (5, 28, 33). To explore the potential of mtDNA for species identification, we first performed an in silico analysis to check for possible polymorphic regions capable of differentiating the 3 target species within the C. parapsilosis complex. After checking the whole mtDNA sequences of the 3 species, we found polymorphic regions within the NADH5 gene, which were chosen as targets for real-time PCR. The pairwise distances of NADH5 homologs are well balanced between the three pair groups and are higher than those found for ITS and COX3 in the C. parapsilosis complex and for COX2 in C. glabrata (28, 30).

The probes were designed to include a combination of different SNPs able to differentiate each species within the C. parapsilosis complex (Fig. 1). The large adenine and thymine content in mtDNA as a whole and, consequently, in the selected region impairs the design of probes with high annealing temperatures. This problem was solved using the TaqMan-MGB, which enhances the melting temperature of probes.

Despite all the progress obtaining specific probes based on mtDNA that has been made, we considered the protocol for its extraction to be time-consuming and labor-intensive (8). Therefore, we showed that during the genomic DNA extraction from yeast cells, some mtDNA is also obtained, making it possible to run the PCR assays on extracted total DNA and still correctly identify all strains (Table 2). Consequently, the new assay becomes more suitable for clinical laboratories.

In the present study, we tested 100 C. parapsilosis (sensu lato) strains and a control group of 6 other species (Table 2). Because all C. parapsilosis (sensu lato) strains were correctly identified, we have established that the primer and probe sets exhibited 100% specificity, with no background fluorescence detected within the species of the complex. No amplification was observed when DNA from other species was used as the template, including the DNA of L. elongisporus, which is biochemically indistinguishable from the C. parapsilosis species complex (21). Finally, we observed 100% concordance with the ITS sequencing identification, including for the 30 strains used for blind testing.

Recently, some authors proposed new identification assays to distinguish these closely related species. In 2011, Hays et al. described a real-time PCR assay using melting curve analysis on a portion of the SADH gene. This method provides a rapid identification; however, the assay may exhibit low reproducibility because it is possible to observe variations in the melting curve when different thermocyclers are used (17). Garcia-Effron et al. (11) proposed a new real-time PCR assay that can differentiate these 3 species using the molecular beacon technology and the ITS region as the target. This assay was highly specific, exhibited good reproducibility, and showed that the C. parapsilosis species complex can be identified quickly, thus demonstrating its suitability for clinical applications (11). Santos et al. (29) developed an assay using matrix-assisted laser desorption ionization–time of flight intact cell mass spectrometry (MALDI-TOF ICMS) for identification of some emerging pathogenic Candida species. These authors have shown that this method identifies the 3 species within the C. parapsilosis complex; however, a quality-controlled database must be available to provide an accurate analysis (29). In all methods described above, only limited numbers of C. metapsilosis isolates (1, 6, and 2, respectively) were tested by the authors (11, 17, 29). In our analysis, we were able to validate our strategy by testing 50 strains of C. parapsilosis (sensu stricto), 40 strains of C. orthopsilosis, and 10 strains of C. metapsilosis, including strains from 2 different countries.

In conclusion, we found an unexpected high variability in NADH5, a gene that encodes a respiratory chain protein and therefore that is expected to be under strong negative selection. Nevertheless, we described a level of variability whose analysis reveals that it can be exploited for epidemiological purposes. Our data show that the variability described in our study is sufficient to unequivocally distinguish the three species of the C. parapsilosis complex. We were able to validate a real-time PCR assay using mtDNA as the template. This new identification method allows the C. parapsilosis species complex to be identified quickly and accurately and saves time compared with conventional sequencing, which has been considered the gold standard for yeast identification. In addition, this assay provides a useful tool for epidemiological and clinical studies of these emergent species.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

This work was supported in part by the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), Brazil (grant 2007/08575-1), and the Conselho Nacional de Pesquisas Científicas e Tecnológicas (CNPq), Brazil (grant 308011/2010-4). A.C.R.S. received a master fellowship from FAPESP (2010/02752-1). R.C.F. and F.C.B. received postdoctoral fellowships from FAPESP (grants 2009/01230-4 and 2010/17179-5). S.S.G. received a postdoctoral fellowship from the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Brazil (PNPD 23038.007393/2011-11). A.L.C. received grants from FAPESP and CNPq. M.R.S.B. received grants from FAPESP, CNPq, and the International Program of the Howard Hughes Medical Institute.

Footnotes

Published ahead of print 25 April 2012

Supplemental material for this article may be found at http://jcm.asm.org/.

REFERENCES

  • 1. Almirante B, et al. 2005. Epidemiology and predictors of mortality in cases of Candida bloodstream infection: results from population-based surveillance, Barcelona, Spain, from 2002 to 2003. J. Clin. Microbiol. 43:1829–1835 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Azevedo AC, et al. 2011. In vitro susceptibility of a large collection of Candida strains against fluconazole and voriconazole by using the CLSI disk diffusion assay. Mycopathologia 171:411–416 [DOI] [PubMed] [Google Scholar]
  • 3. Bizerra FC, et al. 2011. Changes in cell wall synthesis and ultrastructure during paradoxical growth effect of caspofungin on four different Candida species. Antimicrob. Agents Chemother. 55:302–310 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Canton E, et al. 2011. Prospective multicenter study of the epidemiology, molecular identification, and antifungal susceptibility of Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis isolated from patients with candidemia. Antimicrob. Agents Chemother. 55:5590–5596 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Clark-Walker GD. 1991. Contrasting mutation rates in mitochondrial and nuclear genes of yeasts versus mammals. Curr. Genet. 20:195–198 [DOI] [PubMed] [Google Scholar]
  • 6. Colombo AL, et al. 2006. Epidemiology of candidemia in Brazil: a nationwide sentinel surveillance of candidemia in eleven medical centers. J. Clin. Microbiol. 44:2816–2823 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Darling AC, Mau B, Blattner FR, Perna NT. 2004. Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 14:1394–1403 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Defontaine A, Lecocq FM, Hallet JN. 1991. A rapid miniprep method for the preparation of yeast mitochondrial DNA. Nucleic Acids Res. 19:185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Ewing B, Hillier L, Wendl MC, Green P. 1998. Base-calling of automated sequencer traces using phred. I. Accuracy assessment. Genome Res. 8:175–185 [DOI] [PubMed] [Google Scholar]
  • 10. Gacser A, Schafer W, Nosanchuk JS, Salomon S, Nosanchuk JD. 2007. Virulence of Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis in reconstituted human tissue models. Fungal Genet. Biol. 44:1336–1341 [DOI] [PubMed] [Google Scholar]
  • 11. Garcia-Effron G, et al. 2011. Assessment of two new molecular methods for identification of Candida parapsilosis sensu lato species. J. Clin. Microbiol. 49:3257–3261 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Ge YP, Lu GX, Shen YN, Liu WD. 2011. In vitro evaluation of phospholipase, proteinase, and esterase activities of Candida parapsilosis and Candida metapsilosis. Mycopathologia 172:429–438 [DOI] [PubMed] [Google Scholar]
  • 13. Goncalves SS, et al. 2010. Prevalence rates and antifungal susceptibility profiles of the Candida parapsilosis species complex: results from a nationwide surveillance of candidaemia in Brazil. Clin. Microbiol. Infect. 16:885–887 [DOI] [PubMed] [Google Scholar]
  • 14. Goncalves SS, et al. 2012. Aspergillus novoparasiticus: a new clinical species of the section Flavi. Med. Mycol. 50:152–160 [DOI] [PubMed] [Google Scholar]
  • 15. Gordon D, Abajian C, Green P. 1998. Consed: a graphical tool for sequence finishing. Genome Res. 8:195–202 [DOI] [PubMed] [Google Scholar]
  • 16. Gouy M, Guindon S, Gascuel O. 2010. SeaView version 4: a multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol. Biol. Evol. 27:221–224 [DOI] [PubMed] [Google Scholar]
  • 17. Hays C, Duhamel C, Cattoir V, Bonhomme J. 2011. Rapid and accurate identification of species belonging to the Candida parapsilosis complex by real-time PCR and melting curve analysis. J. Med. Microbiol. 60:477–480 [DOI] [PubMed] [Google Scholar]
  • 18. Horn DL, et al. 2009. Epidemiology and outcomes of candidemia in 2019 patients: data from the prospective antifungal therapy alliance registry. Clin. Infect. Dis. 48:1695–1703 [DOI] [PubMed] [Google Scholar]
  • 19. Jain P, Khan ZK, Bhattacharya E, Ranade SA. 2001. Variation in random amplified polymorphic DNA (RAPD) profiles specific to fluconazole-resistant and -sensitive strains of Candida albicans. Diagn. Microbiol. Infect. Dis. 41:113–119 [DOI] [PubMed] [Google Scholar]
  • 20. Lehmann PF, Lin D, Lasker BA. 1992. Genotypic identification and characterization of species and strains within the genus Candida by using random amplified polymorphic DNA. J. Clin. Microbiol. 30:3249–3254 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Lockhart SR, Messer SA, Pfaller MA, Diekema DJ. 2008. Lodderomyces elongisporus masquerading as Candida parapsilosis as a cause of bloodstream infections. J. Clin. Microbiol. 46:374–376 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Melo AS, Bizerra FC, Freymuller E, Arthington-Skaggs BA, Colombo AL. 2011. Biofilm production and evaluation of antifungal susceptibility amongst clinical Candida spp. isolates, including strains of the Candida parapsilosis complex. Med. Mycol. 49:253–262 [DOI] [PubMed] [Google Scholar]
  • 23. Melo AS, de Almeida LP, Colombo AL, Briones MR. 1998. Evolutionary distances and identification of Candida species in clinical isolates by randomly amplified polymorphic DNA (RAPD). Mycopathologia 142:57–66 [DOI] [PubMed] [Google Scholar]
  • 24. Miranda-Zapico I, et al. 2011. Prevalence and antifungal susceptibility patterns of new cryptic species inside the species complexes Candida parapsilosis and Candida glabrata among blood isolates from a Spanish tertiary hospital. J. Antimicrob. Chemother. 66:2315–2322 [DOI] [PubMed] [Google Scholar]
  • 25. Nishikaku AS, Melo ASA, Colombo AL. 2010. Geographic trends in invasive candidiasis. Curr. Fungal Infect. Rep. 4:210–218 [Google Scholar]
  • 26. Pfaller MA, Diekema DJ. 2007. Epidemiology of invasive candidiasis: a persistent public health problem. Clin. Microbiol. Rev. 20:133–163 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Power EG. 1996. RAPD typing in microbiology—a technical review. J. Hosp. Infect. 34:247–265 [DOI] [PubMed] [Google Scholar]
  • 28. Sanson GF, Briones MR. 2000. Typing of Candida glabrata in clinical isolates by comparative sequence analysis of the cytochrome c oxidase subunit 2 gene distinguishes two clusters of strains associated with geographical sequence polymorphisms. J. Clin. Microbiol. 38:227–235 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Santos C, Lima N, Sampaio P, Pais C. 2011. Matrix-assisted laser desorption/ionization time-of-flight intact cell mass spectrometry to detect emerging pathogenic Candida species. Diagn. Microbiol. Infect. Dis. 71:304–308 [DOI] [PubMed] [Google Scholar]
  • 30. Tavanti A, Davidson AD, Gow NA, Maiden MC, Odds FC. 2005. Candida orthopsilosis and Candida metapsilosis spp. nov. to replace Candida parapsilosis groups II and III. J. Clin. Microbiol. 43:284–292 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Tavanti A, Hensgens LA, Ghelardi E, Campa M, Senesi S. 2007. Genotyping of Candida orthopsilosis clinical isolates by amplification fragment length polymorphism reveals genetic diversity among independent isolates and strain maintenance within patients. J. Clin. Microbiol. 45:1455–1462 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. White TJ, Bruns TD, Lee SB, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p 315–322 In Innis MA, Gelfand DH, Sninsky JJ, White TJ. (ed), PCR protocols: a guide to methods and applications. Academic Press, Inc, San Diego, CA [Google Scholar]
  • 33. Yokoyama K, Biswas SK, Miyaji M, Nishimura K. 2000. Identification and phylogenetic relationship of the most common pathogenic Candida species inferred from mitochondrial cytochrome b gene sequences. J. Clin. Microbiol. 38:4503–4510 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES