Skip to main content
NCBI home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2012 Aug;78(16):5845–5854. doi: 10.1128/AEM.00218-12

Expression of the Laccase Gene from a White Rot Fungus in Pichia pastoris Can Enhance the Resistance of This Yeast to H2O2-Mediated Oxidative Stress by Stimulating the Glutathione-Based Antioxidative System

Yang Yang a,b,✉, Fangfang Fan a,b, Rui Zhuo a,b, Fuying Ma a, Yangmin Gong b, Xia Wan b, Mulan Jiang b, Xiaoyu Zhang a,✉
PMCID: PMC3406150  PMID: 22706050

Abstract

Laccase is a copper-containing polyphenol oxidase that has great potential in industrial and biotechnological applications. Previous research has suggested that fungal laccase may be involved in the defense against oxidative stress, but there is little direct evidence supporting this hypothesis, and the mechanism by which laccase protects cells from oxidative stress also remains unclear. Here, we report that the expression of the laccase gene from white rot fungus in Pichia pastoris can significantly enhance the resistance of yeast to H2O2-mediated oxidative stress. The expression of laccase in yeast was found to confer a strong ability to scavenge intracellular H2O2 and to protect cells from lipid oxidative damage. The mechanism by which laccase gene expression increases resistance to oxidative stress was then investigated further. We found that laccase gene expression in Pichia pastoris could increase the level of glutathione-based antioxidative activity, including the intracellular glutathione levels and the enzymatic activity of glutathione peroxidase, glutathione reductase, and γ-glutamylcysteine synthetase. The transcription of the laccase gene in Pichia pastoris was found to be enhanced by the oxidative stress caused by exogenous H2O2. The stimulation of laccase gene expression in response to exogenous H2O2 stress further contributed to the transcriptional induction of the genes involved in the glutathione-dependent antioxidative system, including PpYAP1, PpGPX1, PpPMP20, PpGLR1, and PpGSH1. Taken together, these results suggest that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast to H2O2-mediated oxidative stress by stimulating the glutathione-based antioxidative system to protect the cell from oxidative damage.

INTRODUCTION

White rot fungus has a strong ability to degrade lignin because this kind of fungus can produce extracellular and nonspecific ligninolytic enzymes, which mainly include lignin peroxidase (LiP), manganese peroxidase (MnP), and laccase (10, 21, 22, 26, 46). Laccase belongs to a group of copper-containing polyphenol oxidases that can catalyze the four-electron reduction of O2 to H2O, with the concomitant oxidation of phenolic compounds. Due to its special characteristics, such as its wide range of substrates, its ability to oxidize many different phenolic compounds, and its use of molecular oxygen as the final electron acceptor, laccase has seen wide application in industry and biotechnology, including paper pulping and bleaching, bioremediation, and textile dye decolorization (1, 4, 8, 13, 25, 27, 31, 42, 44, 48, 59). Although laccase has great potential for industrial and biotechnological applications, the biological function of laccase has not been fully determined or confirmed. Previous research has indicated that fungal laccase may play a role in lignin degradation, the development of fruiting bodies, fungal morphogenesis, fungal pathogenicity, and the synthesis of pigments (3, 11, 14, 45, 51, 52, 61).

Recent research has suggested that laccase may play an important role in fungal defense against oxidative stress, which acts as an element of the stress response. It has been observed that oxidative stress can induce the expression of ligninolytic enzymes in some basidiomycetes (6, 33, 41). The extracellular laccase activity of some white rot basidiomycetes such as Fomes fomentarius, Tyromyces pubescens, Trametes versicolor, and Abortiporus biennis can be stimulated by the oxidative stress caused by exogenous menadione and paraquat. Enhanced extracellular laccase activity is considered part of the system for the adaptive response of white rot fungus to paraquat- and menadione-caused oxidative stress conditions (33, 34). A notable increase in the laccase activity of two fungal species, Trametes versicolor and Abortiporus biennis, can be observed after treatment with oxidative stress factors such as menadione, paraquat, and hydrogen peroxide (12). The laccase activity of some other species such as Cerrena unicolor, Abortiporus biennis, Ganoderma lucidum, and Ceriporiopsis subvermispora can also be significantly induced by other oxidative stress factors, such as Cd ions (32), the herbicides bentazon and diuron (16), and hydroquinone (2). These stress factors, which induce oxidative stress, can increase extracellular laccase activity and enhance both superoxide dismutase (SOD) and catalase (CAT) activity. This implies that laccase can participate in the adaptive response to oxidative stress in white rot fungus (33, 34).

The study of plant-pathogenic fungi has also suggested that laccase is involved in defense against oxidative stress in other fungi besides white rot fungus. One study on the plant-pathogenic fungus Rhizoctonia solani has revealed that copper, paraquat, and alcohol treatments, which are known to cause oxidative stress by promoting the formation of free radicals, can induce laccase activity and increase the level of lipid peroxidation. A straightforward link between oxidative stress and laccase induction was found in the case of paraquat treatment (20). A genetic study on another plant-pathogenic fungus, Fusarium oxysporum, has also suggested that laccase may have a role in protection against oxidative stress. Strains with null mutations in laccase genes showed higher sensitivity to oxidative stress than the wild-type strain, indicating the importance of laccase in the defense against oxidative stress (18, 19).

As mentioned above, fungal laccase may be involved in the adaptive response to oxidative stress. However, the hypothesis that laccase plays an important role in defense against oxidative stress is mainly based on the phenomenon that laccase activity can be induced by various oxidative stress factors (2, 12, 16, 20, 32–34). To our knowledge, there is little direct evidence supporting the involvement of laccase in the defense against oxidative stress. Therefore, additional efforts are needed to prove that laccase contributes to defense against oxidative stress. More direct experimental data are required to confirm that the induction of laccase is an element of the oxidative stress response. In addition, the mechanism by which laccase protects cells from oxidative stress has yet to be elucidated. Recently Kim et al. reported that expression of the laccase gene from the fungus Coprinellus congregatus in Saccharomyces cerevisiae could increase the survival rate of yeast under the oxidative stress caused by H2O2. Laccase expression was found to increase the survival rate of yeast exposed to oxidative stress. This study provides evidence that laccase is involved in resistance to oxidative stress (37). However, the mechanism underlying this protection remains unclear.

In order to determine the function and mechanism of laccase in the defense against oxidative stress, we expressed the laccase gene from white rot fungus in the heterologous yeast host Pichia pastoris and investigated the mechanism of resistance to oxidative stress conferred. Pichia pastoris has seen widespread use as a protein expression system because it has the advantages of higher eukaryotic expression systems such as protein processing, protein folding, and posttranslational modification (47, 49, 50). Pichia pastoris is a methanolotrophic yeast with the ability to metabolize methanol as its sole carbon source. High levels of hydrogen peroxide are produced during the first step of the yeast methanol metabolism process. This causes strong oxidative stress. The glutathione redox system, which includes synthesis and recycling, has been found to play an important role in scavenging hydrogen peroxide, detoxifying reactive oxygen species, and protecting against oxidative stress in Pichia pastoris (55, 56, 58). We have previously cloned and characterized a laccase gene, lac5930-1, and its corresponding full-length cDNA from white rot fungus Trametes sp. 5930, isolated from Shennongjia Nature Reserve in China (54). In this study, we found that the expression of this laccase gene in Pichia pastoris could significantly increase the resistance of yeast to H2O2-mediated oxidative stress. Laccase gene expression in yeast was found to confer a strong ability to scavenge intracellular H2O2 and protect cells from lipid oxidative damage. The mechanism by which the expression of the laccase gene increases the resistance to the oxidative stress was then investigated. Our research demonstrates that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast to H2O2-mediated oxidative stress by stimulating the glutathione-based antioxidative system. Our findings provide strong and direct evidence for the importance of laccase in the defense against oxidative stress. They also contribute to the determination of the mechanism by which laccase protects cells from oxidative stress.

MATERIALS AND METHODS

Strains and plasmids.

Pichia pastoris GS115 and the expression vector pPIC3.5K were purchased from Invitrogen. The plasmid pPIC3.5K-lac5930-1 was constructed in our previous work (54). The full-length cDNA of laccase gene lac5930-1, including its native signal peptide sequence, was cloned into the plasmid pPIC3.5K, generating the recombinant plasmid pPIC3.5K-lac5930-1 (containing the native signal peptide sequence of laccase). Thus, laccase can be secreted from cells using the native signal peptide sequence encoded by lac5930-1 as the secretion signal.

Buffered minimal glycerol (BMG) medium was composed of 100 mM potassium phosphate, pH 6.0, 1.34% YNB (yeast nitrogen base with ammonium sulfate without amino acids), 4 × 10−5% biotin, and 1% glycerol. Buffered minimal methanol (BMM) medium was composed of 100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4 × 10−5% biotin, and 0.5% methanol. Both of these media were prepared according to the instructions of the multicopy Pichia expression kit manual (Invitrogen). The yeast transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 were obtained in one of our previous studies (54). In pPIC3.5K-lac5930-1/GS115, the recombinant plasmid pPIC3.5K-lac5930-1, containing the full-length cDNA of the laccase gene lac5930-1 from white rot fungus Trametes sp. 5930, was introduced into Pichia pastoris GS115. In pPIC3.5K/GS115, the empty expression vector pPIC3.5K, which lacks the laccase gene, was introduced into Pichia pastoris GS115 to serve as the control.

Detection of laccase gene expression in Pichia pastoris transformants.

The yeast transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 were inoculated into separate 20-ml volumes of BMG medium in 250-ml Erlenmeyer flasks and incubated at 30°C to an optical density at 600 nm (OD600) of 10 with shaking at 200 rpm. Then the cultures were centrifuged at 3,000 × g for 5 min, and the cell pellets were suspended to an OD600 of 2.0 with 30 ml BMM medium (pH 6.0). The cultures were grown at 20°C with shaking at 200 rpm, with 0.5% (vol/vol) methanol being added daily.

Laccase activity in the culture supernatants was measured using the 2,2′-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) method (17). Assay mixtures contained 0.5 mM ABTS, 0.1 M sodium acetate (pH 5.0), and 100 μl culture fluid. Oxidation of ABTS was monitored by determining the increase in A420 (ϵ = 36,000 M−1 cm−1). One unit of enzyme activity was defined as the amount of enzyme required to oxidize 1 μmol of ABTS per min (17). The transcription of the laccase gene (lac5930-1) in Pichia pastoris transformants was detected by reverse transcription-PCR (RT-PCR) as follows. Total RNA was isolated from the cultures of yeast transformants using TRIzol reagent (Invitrogen) according to the manufacturer's instructions, followed by RNase-free DNase (Promega) digestion to remove the genomic DNA (gDNA) contamination. Then RT-PCR was performed to detect the transcription of the laccase gene in yeast using a PrimeScript RT-PCR kit (TaKaRa) according to the manufacturer's instructions. The PpGPD gene, encoding Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase, was used as the internal control. The sequences of laccase gene-specific primers (lac5930-1-Fw and lac5930-1-Rv) and PpGPD gene-specific primers (PpGPD-Fw and PpGPD-Rv) used for RT-PCR are listed in Table 1. All experiments were performed in triplicate.

Table 1.

Oligonucleotide primers used in this study

Primer Nucleotide sequence
lac5930-1-Fw ATGGTGGGACTACAGCGCTTC
lac5930-1-Rv CTATCGGTCCGTCAGCGAACC
PpGPD-Fw TCCAGAATTGAACGGTAAGCTGAC
PpGPD-Rv CGACGACTCTGGTGGAGTAAC
qRT-lac5930-1-Fw AGCGCTTCAGCTTCTTCGTTAC
qRT-lac5930-1-Rv CCAGTGGATACTGGTGGACTTG
qRT-PpGPX1-Fw ACCAGTTTGGTCATCAGGAACCAGG
qRT-PpGPX1-Rv ACCTTTGAATCCGAGGAGACCAGAC
qRT-PpPMP20-Fw GTGATCACTGCCAACGATGC
qRT-PpPMP20-Rv TGACCCAGTCCAGCAACTGA
qRT-PpGLR1-Fw TTGTGTCCATGTTCTATGCCATGTCC
qRT-PpGLR1-Rv TCTTCAGCACTGGTTGGATGGATAG
qRT-PpGSH1-Fw CCGAAGAGGTTGTAAAGTGGCTATC
qRT-PpGSH1-Rv AGCTTCTGCGTCACTGTATGGAAAC
qRT-PpYAP1-Fw CTGGCCGAGTTTGACCCTAC
qRT-PpYAP1-Rv TTGGATGTCGCTCTCAATGG
qRT-PpACT1-Fw GCCGGTAGAGATTTGACCGACTACTTGATG
qRT-PpACT1-Rv GTAAGTGGTTTGGTCGATACCAGAAGCCTC
qRT-PpGPD-Fw TAAGGCCGTCGGTAAGGTTATT
qRT-PpGPD-Rv TGTAACCCAAAACACCCTTGAG
Open in a new tab

Detection of the level of resistance to H2O2-mediated oxidative stress of two yeast transformants.

The Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 were inoculated into separate 20-ml volumes of BMG medium in 250-ml Erlenmeyer flasks and incubated at 28°C to an OD600 of 20 with shaking at 200 rpm. For adaptation to the oxidative stress caused by exogenous H2O2, the cultures were centrifuged at 3,000 × g for 5 min. The cell pellets were transferred to 30 ml BMM medium containing 100 μM H2O2. The cultures were then incubated at 20°C with shaking at 200 rpm for 7 days, with 0.5% (vol/vol) methanol being added daily. Adapted yeast cells were transferred to 30 ml of fresh BMM medium (initial OD600 was adjusted to 0.9) and then incubated at 20°C with shaking at 200 rpm. After 2 days, H2O2 was added into the cultures at concentrations of 0, 50, 100, and 200 mM. Then the cultures with different concentrations of exogenous H2O2 were grown at 20°C with shaking at 200 rpm. The growth of the yeast cells exposed to different concentrations of exogenous H2O2 was monitored by measuring the OD600 daily. The yeast cultures were withdrawn at different times for quantitative detection of the transcription of various genes and measurement of the physiological indexes. The points in time at which oxidation, enzyme levels, and transcription levels were measured were chosen based on the growth phases of Pichia (logarithmic phase). All experiments were performed in triplicate.

Preparation of yeast cell extracts.

Preparation of whole-cell homogenate for measurement of the physiological indexes related to yeast oxidative stress and antioxidative activity was performed as follows. Yeast cells were collected by centrifugation and washed three times with distilled water to remove the external H2O2 (used for exerting H2O2-mediated oxidative stress) and any traces of growth medium. Then cells were disrupted using the method enclosed with the multicopy Pichia expression kit (Invitrogen). Cell homogenates were clarified by centrifugation. The resulting supernatant was collected and used as cell extract for further analysis. Protein concentration was determined using the method described by Bradford (7).

Measurement of the physiological indexes related to the yeast oxidative stress and antioxidative activity. (i) Measurement of MDA and intracellular H2O2.

The level of malondialdehyde (MDA), an end product of the peroxidation of polyunsaturated fatty acids, was measured using an MDA spectrophotometric detection kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the method described previously (43). MDA was determined using the thiobarbituric acid (TBA) method based on its reaction with TBA to form thiobarbituric acid-reactive substances (TBARS). The MDA level is expressed as μmol/g of dry yeast cells. The level of intracellular H2O2 was measured according to the method described previously (23). All experiments were performed in triplicate.

(ii) Measurement of intracellular reduced GSH.

The amount of intracellular glutathione (GSH) was determined using a GSH detection kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) based on the method reported by Jollow et al. (35). 5,5′-Dithiobis-2-nitrobenzoic acid (DTNB) was used to develop color. The development of yellow color was monitored at 412 nm on a spectrophotometer. GSH content is expressed as μmol/g of dry yeast cells. All experiments were performed in triplicate.

(iii) Measurement of glutathione peroxidase activity.

The activity of glutathione peroxidase (GPx) was measured using a GSH-Px detection kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions; the kit was designed based on principles described by Hafeman et al. and Banni et al. (5, 29). Glutathione peroxidase degraded H2O2 in the presence of GSH, decreasing GSH levels. The remaining GSH was then measured using the reaction with DTNB. Absorbance was recorded at 412 nm. One unit of GPx enzyme activity was defined as that capable of consuming 1 μmol of GSH per minute. The activity of glutathione peroxidase is expressed as U/mg of dry yeast cells. All experiments were performed in triplicate.

(iv) Measurement of γ-GCS activity.

The activity of γ-glutamylcysteine synthetase (γ-GCS) was measured using a γ-glutamylcysteine synthetase detection kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions; the kit was designed using principles described by Chung et al. and Kenchappa et al. (15, 36). The amount of inorganic phosphate (Pi) released by γ-GCS was calculated from the standard curve. One unit of γ-GCS activity was defined as the amount of enzyme capable of synthesizing 1 μmol of Pi per hour under assay conditions. The activity of γ-GCS is expressed as U/mg of dry yeast cells. All experiments were performed in triplicate.

(v) Measurement of glutathione reductase activity.

The activity of glutathione reductase (GR) was measured using a GR detection kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions; the kit was designed based on the method described by Di Ilio et al. and Casalone et al. (9, 24). GR activity was determined by following the decrease in absorbance at 340 nm due to the oxidation of NADPH to NADP+. The activity of GR is expressed as mU/mg of dry yeast cells. All experiments were performed in triplicate.

(vi) Measurement of catalase activity.

The activity of CAT was measured using a CAT detection kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions. CAT activity was measured using the ammonium molybdate spectrophotometric method, which is based on the fact that ammonium molybdate can rapidly terminate the H2O2 degradation reaction catalyzed by CAT and react with the residual H2O2 to generate a yellow complex, which could be monitored by the absorbance at 405 nm (30). All experiments were performed in triplicate.

qRT-PCR detection of the transcription of various genes in yeast transformants under H2O2-mediated oxidative stress.

Total RNA was isolated from yeast cells using the TRIzol reagent (Invitrogen) according to the manufacturer's instructions. First-strand cDNA was then synthesized using a PrimeScript RT reagent kit with gDNA eraser (TaKaRa). Two microliters of RT product was used as a template for quantitative real-time RT-PCR (qRT-PCR). qRT-PCR was performed using an iCycler iQ5 real-time PCR system (Bio-Rad) and a SYBR Premix Ex Taq II kit (Tli RNaseH Plus; TaKaRa) according to the manufacturer's instructions. The primer pairs used for quantitative measurement of the transcription of the laccase gene (lac5930-1) and other genes related to the glutathione redox system (PpGPX1, PpPMP20, PpGLR1, PpGSH1, and PpYAP1) are listed in Table 1. The qRT-PCR mixture (25 μl) contained 2.0 μl of cDNA and 0.4 μM each gene-specific primer as well as 1× SYBR Premix Ex Taq II (TaKaRa). The qRT-PCR was performed as follows: 10 min at 95°C followed by 30 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C, followed by a melting cycle from 55°C to 95°C to check for amplification specificity. The PpACT1 gene, encoding actin, and PpGPD gene, encoding glyceraldehyde-3-phosphate dehydrogenase, were used as internal controls. The relative abundance of mRNAs was normalized against the levels of PpACT1. Each sample was amplified in triplicate in each experiment. Two independent experiments were performed, and they showed the same results.

RESULTS

Expression of laccase gene from Trametes sp. 5930 in Pichia pastoris.

The cDNA of the laccase gene from white rot fungus Trametes sp. 5930, lac5930-1 (54), was cloned into the expression vector of Pichia pastoris pPIC3.5K, producing the recombinant plasmid pPIC3.5K-lac5930-1. Then pPIC3.5K-lac5930-1 and the empty vector pPIC3.5K were transformed into Pichia pastoris GS115, generating two yeast transformants, pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115. Successful expression of the laccase gene in Pichia pastoris was confirmed by measuring the secreted laccase activity of these yeast transformants (Fig. 1A) and detecting the transcription level of the lac5930-1 gene by RT-PCR (Fig. 1B).

Fig 1.

Fig 1

Open in a new tab

Detection of laccase gene expression in Pichia pastoris transformants. (A) Measurement of the laccase activity produced by the two yeast transformants. In pPIC3.5K-lac5930-1/GS115, the recombinant plasmid pPIC3.5K-lac5930-1, carrying the laccase gene lac5930-1 from white rot fungus Trametes sp. 5930, was introduced into Pichia pastoris GS115. In pPIC3.5K/GS115, the empty expression vector pPIC3.5K, without the laccase gene, was introduced into Pichia pastoris GS115 as the control. Results are means ± standard deviations (n = 3). (B) RT-PCR for detection of the transcription of laccase gene lac5930-1 in Pichia pastoris transformants. Lane 1, pPIC3.5K/GS115 (control); lane 2, pPIC3.5K-lac5930-1/GS115. Transcription of the PpGPD gene, encoding Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase, was used as the internal control.

Expression of the laccase gene in Pichia pastoris could increase the level of resistance to H2O2-mediated oxidative stress and protect the yeast cells from lipid oxidative damage caused by exogenous H2O2.

The level of resistance to H2O2-mediated oxidative stress was analyzed by detection of the growth rate of pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 subjected to various concentrations of exogenous H2O2. As shown in Fig. 2A, the growth of pPIC3.5K-lac5930-1/GS115 and that of pPIC3.5K/GS115 were very similar in the absence of exogenous H2O2. As shown in Fig. 2B, the growth of pPIC3.5K/GS115 was strongly inhibited under oxidative stress caused by exogenous H2O2 when no laccase was expressed. However, the growth of pPIC3.5K-lac5930-1/GS115, in which laccase was successfully expressed, was not influenced by exogenous H2O2. pPIC3.5K-lac5930-1/GS115 was more resistant to exogenous H2O2 (50 mM) than pPIC3.5K/GS115 (Fig. 2B). We also found that pPIC3.5K-lac5930-1/GS115 could be resistant to higher concentrations of exogenous H2O2 (100 and 200 mM) (data not shown). These results indicate that the expression of laccase in Pichia pastoris can increase the resistance of yeast to H2O2-mediated oxidative stress.

Fig 2.

Fig 2

Open in a new tab

Growth curves of the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 under oxidative stress caused by 0 mM (A) or 50 mM (B) exogenous H2O2. Results are means ± standard deviations (n = 3).

The oxidative damage to the two yeast transformants exposed to different concentrations of H2O2 was evaluated further. The degree of oxidative damage to lipids was assessed by determining the levels of oxidized lipids. These were determined by measuring levels of malondialdehyde (MDA), an end product of the peroxidation of polyunsaturated fatty acids. As shown in Fig. 3A, the MDA levels of pPIC3.5K/GS115 exposed to 50 mM and 100 mM H2O2 became significantly higher than those of control cells not exposed to exogenous H2O2. For example, after 12 h, the MDA levels of pPIC3.5K/GS115 exposed to 50 mM and 100 mM H2O2 were found to be 1.06 and 1.85 μmol/g dry cells but the MDA content of pPIC3.5K/GS115 exposed to 0 mM H2O2 was only 0.13 μmol/g dry cells. The MDA level of pPIC3.5K/GS115 increased as exogenous H2O2 stress increased. The high level of oxidized lipids confirmed the development of severe oxidative stress in the yeast cultures subjected to exogenous H2O2 (Fig. 3A). As shown in Fig. 3A, the MDA levels of pPIC3.5K-lac5930-1/GS115 exposed to 50 mM and 100 mM H2O2 were much lower than those of pPIC3.5K/GS115 under the same concentrations of H2O2 for the same time. For example, the MDA contents of pPIC3.5K-lac5930-1/GS115 exposed to 50 mM and 100 mM H2O2 for 12 h were found to be only 0.36 and 0.45 μmol/g dry cells, respectively, much lower than those of pPIC3.5K/GS115 (Fig. 3A). These results suggest that the degree of lipid oxidative damage to pPIC3.5K-lac5930-1/GS115 upon exposure to exogenous H2O2 is much less than that to pPIC3.5K/GS115. Laccase gene expression in pPIC3.5K-lac5930-1/GS115 can protect the yeast cells from lipid oxidative damage caused by exogenous H2O2.

Fig 3.

Fig 3

Open in a new tab

Detection of the malondialdehyde (MDA) and the intracellular H2O2 contents of the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when subjected to different concentrations of exogenous H2O2 (0, 50, and 100 mM). (A) MDA content of yeast cells exposed to H2O2 for 12 h. (B) Intracellular H2O2 content of yeast cells exposed to H2O2 for 12 h. Results are means ± standard deviations (n = 3).

The intracellular H2O2 concentrations of two yeast transformants exposed to different concentrations of H2O2 were also determined. As shown in Fig. 3B, the intracellular concentrations of H2O2 in pPIC3.5K/GS115 exposed to 50 mM and 100 mM exogenous H2O2 were much higher than those in pPIC3.5K-lac5930-1/GS115. For example, the intracellular H2O2 concentrations in pPIC3.5K/GS115 exposed to 50 mM and 100 mM H2O2 for 12 h were found to be 21.1 and 32.0 mmol/g dry cells, respectively, but the intracellular H2O2 concentrations in pPIC3.5K-lac5930-1/GS115 under the same conditions were only 6.9 and 7.2 mmol/g dry cells (Fig. 3B). The concentration of intracellular H2O2 in pPIC3.5K/GS115 increased as exogenous H2O2 stress increased. These results indicate that pPIC3.5K-lac5930-1/GS115 has a greater ability to scavenge intracellular H2O2 than pPIC3.5K/GS115. This implies that laccase gene expression in pPIC3.5K-lac5930-1/GS115 can contribute to the scavenging of intracellular H2O2 and protect cells against H2O2-mediated oxidative stress.

Expression of the laccase gene in Pichia pastoris could enhance the level of resistance to H2O2-mediated oxidative stress by stimulating the glutathione redox system of yeast.

The above results indicated that the expression of the laccase gene in Pichia pastoris could enhance resistance to H2O2-mediated oxidative stress. pPIC3.5K-lac5930-1/GS115 had greater ability to resist this oxidative stress than pPIC3.5K/GS115. Based on this finding, we studied the mechanism of how laccase gene expression increased the resistance of yeast to H2O2-mediated oxidative stress. In order to determine the mechanism underlying the differences in resistance to H2O2-mediated oxidative stress between pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115, the levels of antioxidant defense activity of these two yeast transformants in the presence of H2O2 were evaluated.

First, the levels of glutathione-based antioxidative activity of the two yeast transformants exposed to exogenous H2O2 were investigated. As shown in Fig. 4 and 5, the levels of glutathione redox activity of pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115, including the intracellular GSH content and the activities of glutathione peroxidase, glutathione reductase, and γ-glutamylcysteine synthetase, were very similar in the absence of exogenous H2O2. In contrast, the level of glutathione redox activity of pPIC3.5K-lac5930-1/GS115 was much higher than that of pPIC3.5K/GS115 when the yeast transformants were exposed to exogenous H2O2. A significant increase in the level of glutathione redox activity was observed when pPIC3.5K-lac5930-1/GS115 was exposed to exogenous H2O2. However, the activity of the glutathione redox system of pPIC3.5K/GS115 remained very low under H2O2 stress conditions (Fig. 4 and 5). As shown in Fig. 4A, the intracellular GSH content of pPIC3.5K-lac5930-1/GS115 was significantly higher than that of pPIC3.5K/GS115 when the yeast transformants were exposed to exogenous H2O2 (50 and 100 mM) for 12 h (Fig. 4A). The activities of glutathione peroxidase (Fig. 4B), γ-GCS (Fig. 5A), and glutathione reductase (Fig. 5B) of pPIC3.5K-lac5930-1/GS115 were also always higher than those of pPIC3.5K/GS115 when the yeast transformants were exposed to exogenous H2O2 for 12 h. We also observed that the levels of intracellular GSH and the activities of glutathione peroxidase, γ-GCS, and glutathione reductase in pPIC3.5K-lac5930-1/GS115 all increased as the concentration of exogenous H2O2 increased (Fig. 4 and 5).

Fig 4.

Fig 4

Open in a new tab

Detection of the intracellular glutathione content and glutathione peroxidase activity of the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when subjected to different concentrations of exogenous H2O2 (0, 50, and 100 mM). (A) Intracellular glutathione content of yeast cells exposed to H2O2 for 12 h. (B) Intracellular glutathione peroxidase activity of yeast cells exposed to H2O2 for 12 h. Results are means ± standard deviations (n = 3).

Fig 5.

Fig 5

Open in a new tab

Detection of intracellular γ-glutamylcysteine synthetase (γ-GCS) activity and glutathione reductase activity of the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when subjected to different concentrations of exogenous H2O2 (0, 50, and 100 mM). (A) Intracellular γ-GCS activity of yeast cells exposed to H2O2 for 12 h. (B) Intracellular glutathione reductase activity of yeast cells exposed to H2O2 for 12 h. Results are means ± standard deviations (n = 3).

The activity of another antioxidative enzyme, catalase, was also measured. It was found that the catalase activity of pPIC3.5K-lac5930-1/GS115 exposed to exogenous H2O2 was similar to that of pPIC3.5K/GS115 (data not shown).

The transcription of the laccase gene in pPIC3.5K-lac5930-1/GS115 could be stimulated by the oxidative stress caused by exogenous H2O2.

The effects of the level of oxidative stress on laccase gene transcription in pPIC3.5K-lac5930-1/GS115 were investigated. A time course detection of laccase gene transcription in pPIC3.5K-lac5930-1/GS115 exposed to different concentrations of H2O2 was performed. As shown in Fig. 6A and B, the transcription of the laccase gene increased over time when pPIC3.5K-lac5930-1/GS115 was exposed to 50 or 100 mM exogenous H2O2 but not when it was exposed to 0 mM H2O2. It instead remained low throughout the incubation (Fig. 6A and B). This suggested that the transcription of the laccase gene in pPIC3.5K-lac5930-1/GS115 was significantly increased upon exposure to exogenous H2O2. The transcription levels of the laccase gene in pPIC3.5K-lac5930-1/GS115 exposed to 50 mM and 100 mM H2O2 for 12 h were about 5.3 and 9.2 times higher than the level of transcription in pPIC3.5K-lac5930-1/GS115 not exposed to H2O2. The transcription levels of the laccase gene in pPIC3.5K-lac5930-1/GS115 exposed to 50 mM and 100 mM H2O2 for 24 h were about 7.8 and 9.8 times higher (Fig. 6A and B).

Fig 6.

Fig 6

Open in a new tab

Quantitative real-time RT-PCR (qRT-PCR) for detecting the transcription level of the laccase gene in pPIC3.5K-lac5930-1/GS115 exposed to different concentrations of exogenous H2O2 (0, 50, and 100 mM). (A) Time course detection of the transcription level of the laccase gene in pPIC3.5K-lac5930-1/GS115 exposed to 0 and 50 mM H2O2. (B) Time course detection of the transcription level of the laccase gene in pPIC3.5K-lac5930-1/GS115 exposed to 0 and 100 mM H2O2. (C) Effect of different growth phases on the transcription of the housekeeping gene PpACT1 in pPIC3.5K-lac5930-1/GS115 when exposed to 0 or 100 mM H2O2. The transcription levels of PpACT1 in pPIC3.5K-lac5930-1/GS115 exposed to 0 or 100 mM H2O2 for 12 h were set as 1-fold. Results are means ± standard deviations (n = 3).

We also compared laccase transcription levels in pPIC3.5K-lac5930-1/GS115 exposed to different concentrations of H2O2 (50 and 100 mM). As shown in Fig. 6A and B, the transcription levels of the laccase gene in pPIC3.5K-lac5930-1/GS115 subjected to 100 mM H2O2 for 2, 8, and 12 h were increased to about 2.1, 2.8, and 1.9 times, respectively, that of the same transformant subjected to 50 mM H2O2 for the same amount of time. This suggested that the transcription of laccase genes in yeast increased as the level of oxidative stress increased.

The effects of phases of growth on the transcription of the housekeeping gene PpACT1 in pPIC3.5K-lac5930-1/GS115 were also detected. Another housekeeping gene, PpGPD, encoding glyceraldehyde-3-phosphate dehydrogenase, was used as an internal control. The transcription levels of PpACT1 (used as the negative control in the quantitative real-time RT-PCR in Fig. 6A and B) in different phases of growth were measured by qRT-PCR. As shown in Fig. 6C, the transcription levels of PpACT1 did not differ across phases.

Expression of the laccase gene in Pichia pastoris could stimulate the transcription of genes involved in the glutathione-based antioxidative system in response to H2O2-mediated oxidative stress.

The above results suggested that the expression of the laccase gene in Pichia pastoris could stimulate the level of glutathione-based antioxidative activity. Based on this, the transcription levels of genes related to the glutathione-based antioxidative system, such as PpGPX1, which encodes glutathione peroxidase, PpPMP20, which encodes peroxisome glutathione peroxidase, PpGLR1, which encodes glutathione reductase, PpGSH1, which encodes γ-glutamylcysteine synthetase, and PpYAP1, which encodes the PpYAP1 transcription factor (55), were also measured by qRT-PCR under H2O2-mediated oxidative stress.

First, the transcription levels of genes related to the glutathione redox systems of the two yeast transformants exposed to exogenous H2O2 were compared. As shown in Fig. 7F, the transcription levels of PpGPX1, PpPMP20, PpGLR1, PpGSH1, and PpYAP1 in pPIC3.5K-lac5930-1/GS115 exposed to 50 mM H2O2 for 12 h were much higher than those in pPIC3.5K/GS115 exposed to H2O2 for the same amount of time (Fig. 7F).The transcription levels of PpGPX1, PpPMP20, PpGLR1, PpGSH1, and PpYAP1 in pPIC3.5K-lac5930-1/GS115 exposed to 50 mM H2O2 for 12 h were increased to about 7.8, 5.7, 5.5, 10.2, and 12.1 times, respectively, those of the corresponding genes in pPIC3.5K/GS115 (Fig. 7F).

Fig 7.

Fig 7

Open in a new tab

qRT-PCR for detecting the transcription levels of genes related to the glutathione-based antioxidative system, including PpGPX1, PpGLR1, PpGSH1, PpYAP1, and PpPMP20, in the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when exposed to 50 mM H2O2. (A to E) Time course detection of the transcription level of PpGPX1 (A), PpGLR1 (B), PpGSH1 (C), PpYAP1 (D), and PpPMP20 (E) in the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when exposed to 50 mM H2O2. To evaluate the change of gene transcription over time, the transcription levels of various genes at 0 h were set as 1-fold. (F) Comparison of the transcription levels of PpGPX1, PpPMP20, PpGLR1, PpGSH1, and PpYAP1 between pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 exposed to 50 mM H2O2 for 12 h. The transcription levels of various genes in pPIC3.5K/GS115 were set as 1-fold. PpACT1 is the housekeeping gene that encodes the actin of Pichia pastoris. PpGPX1 encodes glutathione peroxidase. PpPMP20 encodes peroxisome glutathione peroxidase. PpGLR1 encodes glutathione reductase. PpGSH1 encodes γ-glutamylcysteine synthetase. PpYAP1 encodes the PpYAP1 transcription factor. Results are means ± standard deviations (n = 3).

The time course of the transcription of genes involved in the glutathione-based antioxidative system was determined in two yeast transformants subjected to exogenous H2O2 stress. Figure 7A to E show the change in the transcription levels of PpGPX1, PpGLR1, PpGSH1, PpYAP1, and PpPMP20 over a 12-hour period when pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 were exposed to 50 mM H2O2. To evaluate changes in gene transcription over time, the transcription levels of various genes at 0 h were set as baseline. As shown in Fig. 7A to E, the transcription levels of PpGPX1, PpGLR1, PpGSH1, PpYAP1, and PpPMP20 in pPIC3.5K/GS115 upon exposure to exogenous H2O2 increased slightly over time. In contrast, the transcription levels of PpGPX1, PpGLR1, PpGSH1, PpYAP1, and PpPMP20 in pPIC3.5K-lac5930-1/GS115 were markedly stimulated over time under oxidative stress (Fig. 7A to E). This suggested that the expression of the laccase gene in Pichia pastoris could stimulate the transcription of genes involved in the glutathione-based antioxidative system in response to the H2O2-mediated oxidative stress. PpYAP1 was the first gene to be induced. After only 2 h of exposure to 50 mM H2O2, the transcription of the PpYAP1 gene in pPIC3.5K-lac5930-1/GS115 was increased to about 5.4 times the baseline level (Fig. 7D).

DISCUSSION

Our work suggests that the expression of the laccase gene in Pichia pastoris can enhance resistance to H2O2-mediated oxidative stress. This is consistent with the results of a previous study that showed that expression of the laccase gene from the fungus Coprinellus congregatus in Saccharomyces cerevisiae increased yeast survival under the oxidative stress caused by H2O2 (37). There have been few reports of increased resistance to oxidative stress induced by heterologous expression of fungal genes in yeast. Zhang et al. have reported that the expression of the superoxide dismutase (SOD) gene from the thermophilic fungus Chaetomium thermophilum in Pichia pastoris could increase the yeast resistance to paraquat- and menadione-mediated oxidative stress (60). Yoo et al. have found that the overexpression of the human Cu/Zn superoxide dismutase gene in Saccharomyces cerevisiae increased the resistance to oxidative stresses caused by paraquat, menadione, and heat shock (57). Superoxide dismutase can catalyze the removal of superoxide radicals. It is thought to be the first line of cellular defense against oxidative damage caused by superoxide anion radicals (57). This shows that the expression of SOD genes from other species in yeast can increase the resistance of yeast to paraquat and menadione, both of which generate superoxide radicals. Laccase is a group of copper-containing polyphenol oxidases that can catalyze the four-electron reduction of O2 to H2O, with the concomitant oxidation of phenolic compounds. The mechanism of the antioxidative role of laccase may be quite different from that found in previous studies using the SOD gene to increase the resistance of yeast to oxidative stress (57, 60).

One previous study only showed that the expression of the laccase gene from the fungus Coprinellus congregatus in Saccharomyces cerevisiae could increase the survival rate of yeast subjected to oxidative stress caused by H2O2. However, the mechanism by which yeast resistance to H2O2 stress was increased and its connection to the laccase gene remained unknown (37). In our research, the mechanism by which laccase protects yeast from H2O2 stress was further investigated. This study is the first to reveal the mechanism by which laccase gene expression increases the resistance of yeast to oxidative stress. Our results indicate that the expression of laccase in Pichia pastoris can increase the resistance of yeast to H2O2-mediated oxidative stress by stimulating the activity of the glutathione-based antioxidative system (including GSH, glutathione peroxidase, γ-glutamylcysteine synthetase, and glutathione reductase). The high level of glutathione-based antioxidative activity can increase the cell's ability to detoxify H2O2 and protect itself from oxidative damage.

To determine whether expression of the laccase gene is really linked to defense mechanisms like enhanced glutathione production, we expressed gene cdh, encoding cellobiose dehydrogenase, which was cloned from white rot fungus Trametes sp. 5930, in Pichia pastoris and then determined whether the heterologous expression of cellobiose dehydrogenase could also enhance yeast resistance to H2O2-mediated oxidative stress. Our results showed that cdh could be successfully expressed in Pichia pastoris. However, the growth of the yeast transformant expressing cdh was inhibited under the oxidative stress caused by exogenous H2O2. Our results indicate that the expression of the cdh gene in Pichia pastoris cannot increase the resistance of the yeast to H2O2-mediated oxidative stress by enhancing the glutathione-dependent antioxidative system. Our work also suggested that it was not a coincidence that the heterologous expression of the laccase gene in Pichia pastoris could enhance the resistance of the yeast to H2O2-mediated oxidative stress by stimulating the glutathione-dependent antioxidative system. The heterologous expression of another enzyme, such as cellobiose dehydrogenase, did not lead to effects similar to those observed in cells expressing laccase.

Although our work has suggested that a real link between laccase expression and enhancement of the glutathione-dependent antioxidative system exists, the question of how laccase expression is linked to defense mechanisms like enhanced glutathione production remains unclear. The mechanism by which laccase expression in Pichia pastoris can stimulate the glutathione-dependent antioxidative system remains unknown. We here put forward one hypothesis that may answer this question based on the following findings. In this study, we found that laccase gene expression in Pichia pastoris could significantly stimulate the transcription of the PpYAP1 gene in response to the oxidative stress caused by exogenous H2O2. Time course analysis revealed that the transcription of various genes related to the glutathione-dependent antioxidative system in pPIC3.5K-lac5930-1/GS115 was stimulated over time under the oxidative stress caused by exogenous H2O2 (Fig. 7A to E). Out of the five genes studied here, PpYAP1 was the first to be induced. The transcription of PpYAP1 in pPIC3.5K-lac5930-1/GS115 exposed to 50 mM H2O2 was stimulated after only 2 h, increasing 5.4-fold over the baseline (0-h) level (Fig. 7D). After 12 h of exposure to 50 mM H2O2, PpYAP1 showed the highest level of transcriptional induction among the five genes related to the glutathione-dependent antioxidative system (Fig. 7F). In Pichia pastoris, the PpYAP1 gene encodes the PpYAP1 transcription factor, which is the Pichia pastoris homologue of ScYAP1, which was first discovered in Saccharomyces cerevisiae. Previous research has revealed that ScYAP1 is an important transcription factor in Saccharomyces cerevisiae, in which it can stimulate the expression of several genes of the glutathione-dependent antioxidative system, such as GLR1, GPX2, and GSH1 (28, 38–40, 53, 55). Recent studies have shown that the PpYAP1-regulated glutathione redox system plays an important role in the detoxification of reactive oxygen species in the methanol metabolism of Pichia pastoris (55). PpYAP1 can act as a regulator of the redox system in Pichia pastoris. It plays an important role in the defense against oxidative stress by activating the expression of other antioxidative genes involved in the glutathione-based antioxidant system (55, 56). Based on our results and previous research, we propose the following hypothesis to address the issue of how laccase expression is linked to defense mechanisms like enhanced glutathione production. The transcription of the laccase gene can be stimulated by the oxidative stress caused by exogenous H2O2. The stimulation of laccase gene expression in response to exogenous H2O2 stress may further activate some transcriptional activator that can specially stimulate the transcription of the PpYAP1 gene. Laccase expression first contributes to the transcriptional induction of the PpYAP1 gene, increasing the production of the PpYAP1 transcription regulator. Then PpYAP1 induces the expression of other important genes involved in the glutathione-dependent antioxidative system, including PpGPX1, PpGLR1, PpGSH1, and PpPMP20. In this way, the level of glutathione-based antioxidative activity in yeast (including the intracellular GSH level and the enzymatic activities of glutathione peroxidase, glutathione reductase, and γ-GCS) is elevated correspondingly, which confers a strong ability to scavenge intracellular H2O2 and protect against oxidative stress. Further studies need to be performed to validate this hypothesis. Research into the molecular mechanism underlying the connection between laccase expression and stimulation of the glutathione-dependent antioxidative system in Pichia pastoris is ongoing in our laboratory.

In conclusion, we found that the heterologous expression of laccase gene in Pichia pastoris can enhance the resistance of yeast to H2O2-mediated oxidative stress by stimulating the glutathione-dependent antioxidative system. Our work will shed light on the function and mechanism of laccase in the defense against oxidative stress. This study may be of interest especially for the understanding of laccase's physiological role and function. Pichia pastoris has been widely applied as a heterologous expression system for eukaryotic proteins. Our findings may help increase the efficiency of Pichia pastoris systems expressing useful proteins by enhancing the resistance of yeast to oxidative stress.

ACKNOWLEDGMENTS

This work was supported by the National Natural Sciences Foundation of China (no. 31070069, 30800007, and 31170104), the Doctoral Fund of the New Teacher Program of the Ministry of Education of China (no. 200804871024), the Fundamental Research Funds for the Central Universities (HUST M2009046 and 2011TS083), the Natural Sciences Foundation of Hubei Province (no. 2009CDB009), Major S&T Projects on the Cultivation of New Varieties of Genetically Modified Organisms (grant 2009ZX08009-120B), the Major State Basic Research Development Program of China (2007CB210200), and the Open Fund of Key Laboratory of Oil Crops Biology of the Ministry of Agriculture in China.

Footnotes

Published ahead of print 15 June 2012

REFERENCES

  • 1. Abadulla E, et al. 2000. Decolorization and detoxification of textile dyes with a laccase from Trametes hirsuta. Appl. Environ. Microbiol. 66:3357–3362 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Amoroso A, Mancilla RA, Gonzalez B, Vicuna R. 2009. Hydroquinone and H2O2 differentially affect the ultrastructure and expression of ligninolytic genes in the basidiomycete Ceriporiopsis subvermispora. FEMS Microbiol. Lett. 294:232–238 [DOI] [PubMed] [Google Scholar]
  • 3. Ardon O, Kerem Z, Hadar Y. 1998. Enhancement of lignin degradation and laccase activity in Pleurotus ostreatus by cotton stalk extract. Can. J. Microbiol. 44:676–680 [Google Scholar]
  • 4. Baldrian P. 2006. Laccases—occurrence and properties. FEMS Microbiol. Rev. 30:215–242 [DOI] [PubMed] [Google Scholar]
  • 5. Banni M, Chouchene L, Said K, Kerkeni A, Messaoudi I. 2011. Mechanisms underlying the protective effect of zinc and selenium against cadmium-induced oxidative stress in zebrafish Danio rerio. Biometals 24:981–992 [DOI] [PubMed] [Google Scholar]
  • 6. Belinky PA, Flikshtein N, Lechenko S, Gepstein S, Dosoretz CG. 2003. Reactive oxygen species and induction of lignin peroxidase in Phanerochaete chrysosporium. Appl. Environ. Microbiol. 69:6500–6506 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248–254 [DOI] [PubMed] [Google Scholar]
  • 8. Camarero S, et al. 2004. Efficient bleaching of non-wood high-quality paper pulp using laccase-mediator system. Enzyme Microb. Technol. 35:113–120 [Google Scholar]
  • 9. Casalone E, Dillio C, Federici G, Polsinelli M. 1988. Glutathione and glutathione metabolizing enzymes in yeasts. Antonie Van Leeuwenhoek 54:367–375 [DOI] [PubMed] [Google Scholar]
  • 10. Chairattanamanokorn P, et al. 2005. Decolorization of alcohol distillery wastewater by thermotolerant white rot fungi. Appl. Biochem. Microbiol. 41:662–667 [PubMed] [Google Scholar]
  • 11. Chen SC, Ge W, Buswell JA. 2004. Molecular cloning of a new laccase from the edible straw mushroom Volvariella volvacea: possible involvement in fruit body development. FEMS Microbiol. Lett. 230:171–176 [DOI] [PubMed] [Google Scholar]
  • 12. Cho NS, Wilkolazka AJ, Staszczak M, Cho HY, Ohga S. 2009. The role of laccase from white rot fungi to stress conditions. J. Fac. Agr. Kyushu Univ. 54:81–83 [Google Scholar]
  • 13. Cho SJ, Park SJ, Lim JS, Rhee YH, Shin KS. 2002. Oxidation of polycyclic aromatic hydrocarbons by laccase of Coriolus hirsutus. Biotechnol. Lett. 24:1337–1340 [Google Scholar]
  • 14. Choi GH, Larson TG, Nuss DL. 1992. Molecular analysis of the laccase gene from the chestnut blight fungus and selective suppression of its expression in an isogenic hypovirulent strain. Mol. Plant Microbe Interact. 5:119–128 [DOI] [PubMed] [Google Scholar]
  • 15. Chung AS, Maines MD, Reynolds NA. 1982. Inhibition of the enzymes of glutathione metabolism by mercuric chloride in the rat kidney; reversal by selenium. Biochem. Pharmacol. 31:3093–3100 [DOI] [PubMed] [Google Scholar]
  • 16. Coelho JS, Oliveira AL, Souza CGM, Bracht A, Peralta RM. 2010. Effect of the herbicides bentazon and diuron on the production of ligninolytic enzymes by Ganoderma lucidum. Int. Biodeterior. Biodegradation 64:156–161 [Google Scholar]
  • 17. Collins PJ, Dobson ADW. 1997. Regulation of laccase gene transcription in Trametes versicolor. Appl. Environ. Microbiol. 63:3444–3450 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Cordoba Canero D, Roncero MIG. 2008. Functional analyses of laccase genes from Fusarium oxysporum. Phytopathology 98:509–518 [DOI] [PubMed] [Google Scholar]
  • 19. Cordoba Canero D, Roncero MIG. 2008. Influence of the chloride channel of Fusarium oxysporum on extracellular laccase activity and virulence on tomato plants. Microbiology 154:1474–1481 [DOI] [PubMed] [Google Scholar]
  • 20. Crowe JD, Olsson S. 2001. Induction of laccase activity in Rhizoctonia solani by antagonistic Pseudomonas fluorescens strains and a range of chemical treatments. Appl. Environ. Microbiol. 67:2088–2094 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Cullen D. 1997. Recent advances on the molecular genetics of ligninolytic fungi. J. Biotechnol. 53:273–289 [DOI] [PubMed] [Google Scholar]
  • 22. Cullen D, Kersten PJ. 2004. Enzymology and molecular biology of lignin degradation, p. 249–273 In Brambl R, Marzluf GA. (ed), The mycota III: biochemistry and molecular biology, 2nd ed Springer-Verlag, Berlin, Germany [Google Scholar]
  • 23. Deiana L, Carru C, Pes G, Tadolini B. 1999. Spectrophotometric measurement of hydroperoxides at increased sensitivity by oxidation of Fe2+ in the presence of xylenol orange. Free Radic. Res. 31:237–244 [DOI] [PubMed] [Google Scholar]
  • 24. Di Ilio C, Polidoro G, Arduini A, Muccini A, Federici G. 1983. Glutathione peroxidase, glutathione reductase, glutathione S-transferase, and gamma-glutamyltranspeptidase activities in the human early pregnancy placenta. Biochem. Med. 29:143–148 [DOI] [PubMed] [Google Scholar]
  • 25. Dodor DE, Hwang HM, Ekunwe SIN. 2004. Oxidation of anthracene and benzo[a] pyrene by immobilized laccase from Trametes versicolor. Enzyme Microb. Technol. 35:210–217 [Google Scholar]
  • 26. Erkurt EA, Unyayar A, Kumbur H. 2007. Decolorization of synthetic dyes by white rot fungi involving laccase enzyme in the process. Process Biochem. 42:1429–1435 [Google Scholar]
  • 27. Fillat A, Roncero MB, Vidal T. 2012. Elucidating the effects of laccase-modifying compounds treatments on bast and core fibers in flax pulp. Biotechnol. Bioeng. 109:225–233 [DOI] [PubMed] [Google Scholar]
  • 28. Grant CM, Maciver FH, Dawes IW. 1996. Stationary-phase induction of GLR1 expression is mediated by the yAP-1 transcriptional regulatory protein in the yeast Saccharomyces cerevisiae. Mol. Microbiol. 22:739–746 [DOI] [PubMed] [Google Scholar]
  • 29. Hafeman DG, Sunde RA, Hoekstra WG. 1974. Effect of dietary selenium on erythrocyte and liver glutathione peroxidase in the rat. J. Nutr. 104:580–587 [DOI] [PubMed] [Google Scholar]
  • 30. Hou H, et al. 2009. The effect of pacific cod (Gadus macrocephalus) skin gelatin polypeptides on UV radiation-induced skin photoaging in ICR mice. Food Chem. 115:945–950 [Google Scholar]
  • 31. Jaouani A, Guillen F, Penninckx MJ, Martinez AT, Martinez MJ. 2005. Role of Pycnoporus coccineus laccase in the degradation of aromatic compounds in olive oil mill wastewater. Enzyme Microb. Technol. 36:478–486 [Google Scholar]
  • 32. Jarosz-Wilkołazka A, et al. 2006. Species-specific Cd-stress response in the white rot basidiomycetes Abortiporus biennis and Cerrena unicolor. BioMetals 19:39–49 [DOI] [PubMed] [Google Scholar]
  • 33. Jaszek M, et al. 2006. Ligninolytic enzymes can participate in a multiple response system to oxidative stress in white-rot basidiomycetes: Fomes fomentarius and Tyromyces pubescens. Int. Biodeterior. Biodegradation 58:168–175 [Google Scholar]
  • 34. Jaszek M, Grzywnowicz K, Malarczyk E, Leonowicz A. 2006. Enhanced extracellular laccase activity as a part of the response system of white rot fungi: Trametes versicolor and Abortiporus biennis to paraquat-caused oxidative stress conditions. Pestic. Biochem. Physiol. 85:147–154 [Google Scholar]
  • 35. Jollow DJ, Mitchell JR, Zampaglione N, Gillette JR. 1974. Bromobenzene-induced liver necrosis. Protective role of glutathione and evidence for 3,4-bromobenzene oxide as the hepatotoxic metabolite. Pharmacology 11:151–169 [DOI] [PubMed] [Google Scholar]
  • 36. Kenchappaa RS, Ravindranath V. 2003. γ-Glutamyl cysteine synthetase is up-regulated during recovery of brain mitochondrial complex I following neurotoxic insult in mice. Neurosci. Lett. 350:51–55 [DOI] [PubMed] [Google Scholar]
  • 37. Kim D, Kwak E, Choi HT. 2006. Increase of yeast survival under oxidative stress by the expression of the laccase gene from Coprinellus congregatus. J. Microbiol. 44:617–621 [PubMed] [Google Scholar]
  • 38. Kuge S, Jones N, Nomoto A. 1997. Regulation of yAP-1 nuclear localization in response to oxidative stress. EMBO J. 16:1710–1720 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Kuge S, Toda T, Iizuka N, Nomoto A. 1998. Crm1 (XpoI) dependent nuclear export of the budding yeast transcription factor yAP-1 is sensitive to oxidative stress. Genes Cells 3:521–532 [DOI] [PubMed] [Google Scholar]
  • 40. Lee J, et al. 1999. Yap1 and Skn7 control two specialized oxidative stress response regulons in yeast. J. Biol. Chem. 274:16040–16046 [DOI] [PubMed] [Google Scholar]
  • 41. Li D, Alic M, Brown JA, Gold MH. 1995. Regulation of manganese peroxidase gene transcription by hydrogen peroxide, chemical stress, and molecular oxygen. Appl. Environ. Microbiol. 61:341–345 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Lu CX, Wang HY, Luo YM, Guo L. 2010. An efficient system for pre-delignification of gramineous biofuel feedstock in vitro: Application of a laccase from Pycnoporus sanguineus H275. Process Biochem. 45:1141–1147 [Google Scholar]
  • 43. Mihara M, Uchiyama M. 1978. Determination of malonaldehyde precursor in tissues by thiobarbituric acid test. Anal. Biochem. 86:271–278 [DOI] [PubMed] [Google Scholar]
  • 44. Murugesan K, et al. 2006. Purification and characterization of laccase produced by a white rot fungus Pleurotus sajor-caju under submerged culture condition and its potential in decolorization of azo dyes. Appl. Microbiol. Biotechnol. 72:939–946 [DOI] [PubMed] [Google Scholar]
  • 45. Nagai M, et al. 2003. Important role of fungal intracellular laccase for melanin synthesis, purification and characterization of an intracellular laccase from Lentinula edodes fruit bodies. Microbiology 149:2455–2462 [DOI] [PubMed] [Google Scholar]
  • 46. Pointing SB. 2001. Feasibility of bioremediation by white-rot fungi. Appl. Microbiol. Biotechnol. 57:20–33 [DOI] [PubMed] [Google Scholar]
  • 47. Porro D, et al. 2011. Production of recombinant proteins and metabolites in yeasts. Appl. Microbiol. Biotechnol. 89:939–948 [DOI] [PubMed] [Google Scholar]
  • 48. Rodríguez Couto S, Toca Herrera JL. 2006. Industrial and biotechnology applications of laccases: a review. Biotechnol. Adv. 24:500–513 [DOI] [PubMed] [Google Scholar]
  • 49. Romanos M. 1995. Advances in the use of Pichia pastoris for high-level expression. Curr. Opin. Biotechnol. 6:527–533 [Google Scholar]
  • 50. Soden DM, O'Callaghan J, Dobson ADW. 2002. Molecular cloning of a laccase isozyme gene from Pleurotus sajor-caju and expression in the heterologous Pichia pastoris host. Microbiology 148:4003–4014 [DOI] [PubMed] [Google Scholar]
  • 51. Suguimoto HH, Barbosa AM, Dekker RFH, Castro-Gomez RJH. 2001. Veratryl alcohol stimulates fruiting body formation in the oyster mushroom, Pleurotus ostreatus. FEMS Microbiol. Lett. 194:235–238 [DOI] [PubMed] [Google Scholar]
  • 52. Wei DS, et al. 2010. Laccase and its role in production of extracellular reactive oxygen species during wood decay by the brown rot basidiomycete Postia placenta. Appl. Environ. Microbiol. 76:2091–2097 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Wu AL, Moye-Rowley WS. 1994. GSH1, which encodes Υ-glutamylcysteine synthetase, is a target gene for yAP-1 transcriptional regulation. Mol. Cell. Biol. 14:5832–5839 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Yang Y, et al. 2011. Characterization of a laccase gene from the white-rot fungi Trametes sp. 5930 isolated from Shennongjia Nature Reserve in China and studying on the capability of decolorization of different synthetic dyes. Biochem. Eng. J. 57:13–22 [Google Scholar]
  • 55. Yano T, Takigami E, Yurimoto H, Sakai Y. 2009. Yap1-regulated glutathione redox system curtails accumulation of formaldehyde and reactive oxygen species in methanol metabolism of Pichia pastoris. Eukaryot. Cell 8:540–549 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Yano T, Yurimoto H, Sakai Y. 2009. Activation of the oxidative stress regulator PpYap1 through conserved cysteine residues during methanol metabolism in the yeast Pichia pastoris. Biosci. Biotechnol. Biochem. 73:1404–1411 [DOI] [PubMed] [Google Scholar]
  • 57. Yoo HY, Kim SS, Rho HM. 1999. Over-expression and simple purification of human superoxide dismutase (SOD1) in yeast and its resistance to oxidative stress. J. Biotechnol. 68:29–35 [DOI] [PubMed] [Google Scholar]
  • 58. Yurimoto H, Oku M, Sakai Y. 7 July 2011. Yeast methylotrophy: metabolism, gene regulation and peroxisome homeostasis. Int. J. Microbiol. doi:10.1155/2011/101298 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Zeng XK, et al. 2012. Anthraquinone dye assisted the decolorization of azo dyes by a novel Trametes trogii laccase. Process Biochem. 47:160–163 [Google Scholar]
  • 60. Zhang LQ, et al. 2011. Expression of a novel thermostable Cu, Zn-superoxide dismutase from Chaetomium thermophilum in Pichia pastoris and its antioxidant properties. Biotechnol. Lett. 33:1127–1132 [DOI] [PubMed] [Google Scholar]
  • 61. Zhao J, Kwan HS. 1999. Characterization, molecular cloning, and differential expression analysis of laccase genes from the edible mushroom Lentinula edodes. Appl. Environ. Microbiol. 65:4908–4913 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES