Abstract
Matrix metalloproteinases (MMPs) are involved in the degradation of the extracellular matrix and basement membranes. Due to this, MMPs have been thought to promote invasion and metastasis of cancer cells and angiogenesis in tumors. Even though the chicken is a useful animal model for studying human ovarian cancer, no reports exist of the MMP expression pattern in chicken ovarian cancer. Therefore, we investigated the expression pattern of MMPs in chicken ovarian cancer. Results of RT-PCR and quantitative RT-PCR analyses showed MMP3 to be over-expressed in cancerous hen ovaries. In situ hybridization analysis of cancerous chicken ovaries showed that MMP3 mRNA was predominantly localized in the stroma, which is similar to MMP3 expression in human cancers. The results suggest that the expression pattern of MMP3 mRNA in chicken ovarian cancer is similar to that in various types of human cancer. Moreover, MMP3 potentially plays a significant role in developing ovarian cancer in chickens. The cell type-specific expression of MMP3 makes this gene a unique marker for ovarian cancer in chickens.
Keywords: chicken, ovary, ovarian cancer, matrix metalloproteinases 3, in situ hybridization
Introduction
Of all the gynecologic cancers, ovarian cancer has the highest mortality rate. Even though the survival rate following early detection of the disease is relatively high, a diagnosis of ovarian cancer often occurs at a late stage in the disease. The mechanisms responsible for ovarian cancer are not completely known, and research is minimal due to a lack of suitable animal models (1).
The laying hen is a suitable animal model for human ovarian cancer due to the similarities between human and chicken ovarian cancers. Most human ovarian cancers arise spontaneously in cells derived from the ovarian surface epithelium (2,3). This is consistent with chicken ovarian cancer, which originates from ovarian epithelial cells (4). Support for the hypothesis regarding incessant ovulation that explains ovarian cancer in humans (2,3) is the fact that hens ovulate almost daily, resulting in genomic damage to the ovarian surface epithelium and increasing the likelihood of mutations that lead to the development of spontaneous ovarian adenocarcinoma (5). Moreover, anti-tumor antibodies common to human and chicken cancer carcinomas include cancer antigen 125, cytokeratin, pan cytokeratin, proliferating cell nuclear antigen (PCNA), carcinoembryonic antigen, cytokeratin AE1/AE3, epidermal growth factor receptor, ERBB2, Lewis Y, selenium-binding protein 1 and tumor-associated glycoprotein 72 (6–8). Despite these similarities, further characterization of chicken ovarian cancer is crucial for a comparative study of ovarian cancers in humans and chickens.
Proteases are involved in controlling multiple biological processes and multiple diseases, including cancer (9). It was recently reported that cysteine proteases, known as cathepsins, were involved in chicken ovarian cancer (10). One of the protease groups, matrix metalloproteinases (MMPs), is involved in the degradation of the extracellular matrix and basement membranes. Due to their function, MMPs have long been considered to play an essential role in cancer progression by promoting tumor cell invasion, angiogenesis and metastasis of cancer cells (11–13). In human ovarian cancer, certain MMPs are abundantly expressed in epithelial ovarian cancer cells (14,15). However, the expression of MMPs in cancerous chicken ovaries has yet to be investigated. We therefore examined the expression patterns of MMPs in cancerous and normal chicken ovaries, with a particular emphasis on MMP3.
Materials and methods
Animals
The care and experimental use of White Leghorn (WL) hens (Gallus gallus domesticus) was approved by the Institute of Laboratory Animal Resources, the Seoul National University (SNU-070823-5), Korea. The hens were maintained in a standard management program at the University Animal Farm at Seoul National University. The procedures used for animal management, reproduction and embryo manipulation followed the standard operating protocols of our laboratory.
Tissue samples
Cancerous (n=5) ovaries were obtained from 2- and 3-year-old WL hens with spontaneously developed ovarian cancer. Normal (n=3) ovaries were obtained from 2- and 3-year-old healthy WL hens without any histological changes in the ovaries. Sections of these ovaries were frozen or embedded in paraffin for further analysis. For diagnosis, paraffin-embedded tissues were sectioned at 5 μm and stained with hematoxylin and eosin.
RT-PCR analysis
Total RNA was extracted from frozen tissues by TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized using AccuPower® RT PreMix (Bioneer, Daejeon, Korea). Specific primer sets were used for RT-PCR (Table I). PCR amplification was performed as follows: 95°C for 3 min; followed by 30 cycles of 95°C for 20 sec, 60°C for 40 sec and 72°C for 1 min; and a final extension of 72°C for 5 min. PCR products were analyzed on a 1% agarose gel stained with ethidium bromide.
Table I.
Primer sequences used for RT-PCR and cloning.
| Gene | Sequence (5′-3′): forward and reverse | Gene bank accession no. | Product size (bp) |
|---|---|---|---|
| MMP1 | CTAATGGGCTGCTGGCTCA GACCTCTCAGGATGTTTGCG |
XM_417176 | 406 |
| MMP2 | GTGGCAATGGTGATGGACAG TCCTGAGAAAGGCGGAAGTT |
NM_204420 | 460 |
| MMP3 | CACTGGGATAGGAGGGGATG TCTGTGGGTGCCATTTCTGT |
XM_417175.2 | 348 |
| MMP7 | CCTCCTACTTTGTGCTGCCA ATGATGTCTGCCTGTCCCG |
NM_001006278.1 | 453 |
| MMP9 | CGGCTTAGAGGTGAAGACCC GGAAGGTGAAGGGGAAGACA |
NM_204667.1 | 416 |
| MMP11 | CCAGCCAGACCTTGAAACAA CAATCTCCTGTGGGACACCA |
XM_001232776 | 491 |
| MMP13 | CGGGTGCTGTGGAAGAAATA TTGGTGTAGTTGGGGCAGAC |
XM_001235204 | 407 |
| MMP15 | GACGCTGGAAAACACGGAC ACCACTTGCCCTTGAACACA |
XM_413995 | 422 |
| MMP16 | CAACTGACCCCAGAATGTCG AAAAATCCTCCCTCCCCATC |
NM_205197 | 454 |
| MMP17 | TTTGGGTATCTGCCTCCTCC CCTGCTGTGTGATGGTCTCC |
XM_415092 | 482 |
| MMP23B | CGTAGTGGCTTTGCTGGCTA CAAGTTCCCCTGTTGTTCCA |
XM_417569 | 425 |
| MMP24 | CGACTCTTCCTGTTCGCAGA TCGCTCTCTTGTCCTCGTTG |
XM_417326 | 498 |
| MMP27 | CAGGAAAACCAGACACCGAG GAGCAGCAACCAGGAACAAA |
NM_205000 | 423 |
| MMP28 | CAGCACCTACTACTGCCACTCC AATAGCGGTCATCCCGAAAG |
XM_415771 | 500 |
| GAPDH | CACAGCCACACAGAAGACGG CCATCAAGTCCACAACACGG |
NM_204305 | 443 |
Quantitative RT-PCR analysis
Quantitative RT-PCR was performed using SYBR-Green (Sigma, St. Louis, MO, USA) and a StepOnePlus real-time PCR system (Applied Biosystems, Foster City, CA, USA). Relative quantification of gene expression was calculated using the formula 2−ΔΔCt, where ΔΔCt= (Cttarget gene − CtGAPDH)cancerous tissue − (Cttarget gene − CtGAPDH)normal tissue. The information for the primer sets is shown in Table II.
Table II.
Primer sequences used for quantitative RT-PCR.
| Gene | Sequence (5′-3′): forward and reverse | Gene bank accession no. | Product size (bp) |
|---|---|---|---|
| MMP3 | ACCTGGGCTTTCCCAGAAGT CTGAAGGGCAGCATCAACGA |
XM_417175.2 | 194 |
| GAPDH | ACACAGAAGACGGTGGATGG GGCAGGTCAGGTCAACAACA |
NM_204305 | 193 |
In situ hybridization
In situ hybridization was conducted as previously described (16). For hybridization probes, PCR products were generated from ovarian cancer cDNA with the primers used in RT-PCR analysis. Products were then gel-extracted and cloned into pGEM-T Easy Vector (Promega, Madison, WI, USA). Following the verification of sequences, a DIG-labeled RNA probe was prepared using a DIG RNA labeling kit (Roche Applied Science, Indianapolis, IN, USA). Frozen sections (10 μm) were mounted on slides pretreated with 3-aminopropyltriethoxysilane (Sigma), dried on a 50°C slide warmer, fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS), treated with 1% Triton X-100 in PBS for 20 min, washed three times in PBS and incubated with a prehybridization mixture [50% formamide and 5X standard saline citrate (SSC)] for 15 min at room temperature. Following prehybridization, sections were incubated in a hybridization mixture (50% formamide, 5X SSC, 10% dextran sulfate sodium salt, 0.02% bovine serum albumin, 250 μg/ml yeast tRNA and denatured DIG-labeled cRNA probes) for 18 h at 55°C in a humidified chamber. Sections were then washed for stringency in a series of solutions containing formamide and SSC. Following blocking with 1% blocking reagent (Roche), sections were incubated overnight with sheep anti-DIG antibody conjugated to alkaline phosphatase (Roche). Following incubation, a visualization solution (0.4 mM 5-bromo-4-chloro-3-indolyl phosphate, 0.4 mM nitroblue tetrazolium, and 2 mM levamisole; Sigma) was used. Sections were counterstained with 1% (w/v) methyl green (Sigma). Images were captured with a Zeiss Axiophot light microscope equipped with an AxioCam HRc camera (Carl Zeiss, Inc., NY, USA).
Statistical analysis
Statistical analysis was performed using the Student’s t-test using the SAS program (SAS Institute, Cary, NC, USA). P<0.05 was considered to be statistically significant.
Results
Pathological characteristics of chicken ovarian cancer
Normal ovaries had typically developing follicles surrounded by stroma (Fig. 1A). The morphology of cancerous ovaries was entirely different, showing gland-like growth of cancer cells invading stromal tissues (Fig. 1B). The difference between normal and cancerous ovaries was similar to that reported previously (17,18).
Figure 1.

Hematoxylin and eosin staining of (A) normal and (B) cancerous hen ovary. Scale bar, 100 μm.
Increased expression of MMP3 in cancerous ovaries
We initially performed RT-PCR analysis to determine the expression of MMPs that have been identified in chickens. MMP3 mRNA was markedly expressed in cancerous ovaries but almost undetectable in normal ovaries (Fig. 2A), whereas the expression of the remaining MMPs were weak or undetectable in cancerous and normal ovaries (data not shown). Therefore, further study was focused on MMP3.
Figure 2.

Increased expression of MMP3 mRNA in normal and cancerous chicken ovaries. (A) RT-PCR analysis of ovaries. (B) Relative mRNA expression of MMP3 between normal and cancerous ovaries from chickens indicated that MMP3 mRNA was greater in cancerous ovaries (mean ± SEM, P<0.05).
To measure relative mRNA levels between normal and cancerous ovaries, we performed quantitative RT-PCR. As expected, MMP3 mRNA expression in cancerous ovaries was approximately 16-fold higher than that in normal ovaries (P<0.05, Fig. 2B).
Localization of MMP3 mRNA in normal and cancerous ovaries
The expression pattern for MMP3 was further analyzed by the localization of MMP3 mRNA by in situ hybridization. The results indicated an absence of the cell-specific expression of MMP3 mRNA in normal ovaries (Fig. 3A and D), whereas abundant MMP3 mRNA was observed in the stroma between the gland-like areas in the cancerous ovaries (Fig. 3B, C, E and F).
Figure 3.
In situ hybridization analysis of MMP3 mRNA in normal and cancerous chicken ovaries. (A) No cell-specific localization of MMP3 mRNA was observed in normal ovaries. (B and C) MMP3 mRNA was markedly expressed in the stroma of cancerous ovaries. (D-F) Negative controls with the sense probe. Scale bar, 100 μm (A, B, D and E) and 25 μm (C and F).
Discussion
MMP3 (also known as stromelysin-1) plays significant roles in regulating extracellular matrix remodeling and in activating other MMPs (19). Over-expression of MMP3 has also been demonstrated in various types of cancer (20). In human cancer, MMPs are also commonly expressed in the stromal cells rather than in the tumor cells: expression of MMPs in stromal cells has been reported in breast, colorectal, lung, prostate, and pancreatic cancers (20). Our results also show that MMP3 mRNA is localized in stromal cells in chicken ovarian cancer suggesting that the roles of MMP3 in cancer are conserved between chickens and humans, and the expression of MMP3 may be regulated by similar mechanisms in the two species. In humans, cancer cells induce MMP1, 2 and 3 expression by secreting signaling molecules known as extracellular matrix metalloproteinase inducers (21,22). However, further studies are necessary to determine the detailed mechanism(s) of tumorigenesis in chicken ovaries.
Although the role of MMP3 in cancer has not been fully elucidated, certain studies have revealed its tumorigenic functions. Sternlicht et al showed that MMP3 over-expression in transgenic mice leads to enhanced mammary carcinogenesis (23), and Witty et al showed that MMP3 targets relevant substrates to promote apoptosis in neighboring epithelial cells, which is relevant for cancer (24). In addition to their ability to degrade major protein components of the extracellular matrix or the basement membrane, MMPs play a role in the early stages of tumorigenesis by stimulating cell proliferation and modulation of angiogenesis (25). A focus on the early stages of ovarian cancer in chickens may reveal new roles for MMPs in the early developmental stages of cancer and thus improve the ability of medical professionals to make an early diagnosis.
In conclusion, this study has demonstrated the over-expression of MMP3 in chicken ovarian cancer. The expression pattern of MMP3 is relatively similar to that of MMPs in human cancer. The cell type-specific expression of the MMP3 gene renders this gene a unique marker for epithelial chicken ovarian cancer and suggests the crucial role MMP3 plays in its development.
Acknowledgements
This study was supported by the Mid-career Researcher Program through an NRF grant funded by the MEST (No. 2009-0083687) and the World Class University program (R31-10056) through the National Research Foundation of Korea funded by the Science and Technology Ministry of Education. The authors would like to express their appreciation to Dr Fuller W. Bazer (Texas A&M University, USA; and Seoul National University, Korea) for assistance with manuscript preparation and helpful discussions.
References
- 1.Orsulic S. Ovarian cancer. In: Holland EC, editor. Mouse Models of Human Cancer. Whiley-Liss, Inc; New Jersey: 2004. pp. 171–187. [Google Scholar]
- 2.Auersperg N, Edelson MI, Mok SC, Johnson SW, Hamilton TC. The biology of ovarian cancer. Semin Oncol. 1998;25:281–304. [PubMed] [Google Scholar]
- 3.Fathalla MF. Incessant ovulation-a factor in ovarian neoplasia? Lancet. 1971;2:163. doi: 10.1016/s0140-6736(71)92335-x. [DOI] [PubMed] [Google Scholar]
- 4.Fredrickson TN. Ovarian-tumors of the hen. Environ Health Perspect. 1987;73:35–51. doi: 10.1289/ehp.877335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Murdoch WJ, Van Kirk EA, Alexander BM. DNA damages in ovarian surface epithelial cells of ovulatory hens. Exp Biol Med. 2005;230:429–433. doi: 10.1177/15353702-0323006-11. [DOI] [PubMed] [Google Scholar]
- 6.Zhuge Y, Lagman JA, Ansenberger K, et al. CYP1B1 expression in ovarian cancer in the laying hen Gallus domesticus. Gynecol Oncol. 2009;112:171–178. doi: 10.1016/j.ygyno.2008.09.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Stammer K, Edassery SL, Barua A, et al. Selenium-binding protein 1 expression in ovaries and ovarian tumors in the laying hen, a spontaneous model of human ovarian cancer. Gynecol Oncol. 2008;109:115–121. doi: 10.1016/j.ygyno.2007.12.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Rodriguez-Burford C, Barnes MN, Berry W, Partridge EE, Grizzle WE. Immunohistochemical expression of molecular markers in an avian model: a potential model for preclinical evaluation of agents for ovarian cancer chemoprevention. Gynecol Oncol. 2001;81:373–379. doi: 10.1006/gyno.2001.6191. [DOI] [PubMed] [Google Scholar]
- 9.Lopez-Otin C, Bond JS. Proteases: Multifunctional enzymes in life and disease. J Biol Chem. 2008;283:30433–30437. doi: 10.1074/jbc.R800035200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ahn SE, Choi JW, Rengaraj D, et al. Increased expression of cysteine cathepsins in ovarian tissue from chickens with ovarian cancer. Reprod Biology and Endocrinol. 2010;8:100. doi: 10.1186/1477-7827-8-100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Wolf K, Wu YI, Liu Y, et al. Multi-step pericellular proteolysis controls the transition from individual to collective cancer cell invasion. Nat Cell Biol. 2007;9:893–904. doi: 10.1038/ncb1616. [DOI] [PubMed] [Google Scholar]
- 12.Bartolome RA, Ferreiro S, Miquilena-Colina ME, et al. The chemokine receptor CXCR4 and the metalloproteinase MT1-MMP are mutually required during melanoma metastasis to lungs. Am J Pathol. 2009;174:602–612. doi: 10.2353/ajpath.2009.080636. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bergers G, Brekken R, McMahon G, et al. Matrix metalloproteinase-9 triggers the angiogenic switch during carcinogenesis. Nat Cell Biol. 2000;2:737–744. doi: 10.1038/35036374. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Stadlmann S, Pollheimer J, Moser PL, et al. Cytokine-regulated expression of collagenase-2 (MMP-8) is involved in the progression of ovarian cancer. Eur J Cancer. 2003;39:2499–2505. doi: 10.1016/j.ejca.2003.08.011. [DOI] [PubMed] [Google Scholar]
- 15.Kenny HA, Lengyel E. MMP-2 functions as an early response protein in ovarian cancer metastasis. Cell Cycle. 2009;8:683–688. doi: 10.4161/cc.8.5.7703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Rengaraj D, Kim DK, Zheng YH, Lee SI, Kim H, Han JY. Testis-specific novel transcripts in chicken: in situ localization and expression pattern profiling during sexual development. Biol Reprod. 2008;79:413–420. doi: 10.1095/biolreprod.108.067959. [DOI] [PubMed] [Google Scholar]
- 17.Giles JR, Shivaprasad HL, Johnson PA. Ovarian tumor expression of an oviductal protein in the hen: a model for human serous ovarian adenocarcinoma. Gynecol Oncol. 2004;95:530–533. doi: 10.1016/j.ygyno.2004.07.061. [DOI] [PubMed] [Google Scholar]
- 18.Hales DB, Zhuge Y, Lagman JAJ, et al. Cyclooxygenases expression and distribution in the normal ovary and their role in ovarian cancer in the domestic hen (Gallus domesticus) Endocrine. 2008;33:235–244. doi: 10.1007/s12020-008-9080-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kucukali CI, Aydin M, Ozkok E, et al. Do schizophrenia and bipolar disorders share a common disease susceptibility variant at the MMP3 gene? Prog Neuro-Psychopharmacol Biol Psychiatry. 2009;33:557–561. doi: 10.1016/j.pnpbp.2009.02.012. [DOI] [PubMed] [Google Scholar]
- 20.Nelson AR, Fingleton B, Rothenberg ML, Matrisian LM. Matrix metalloproteinases: biologic activity and clinical implications. J Clin Oncol. 2000;18:1135–1149. doi: 10.1200/JCO.2000.18.5.1135. [DOI] [PubMed] [Google Scholar]
- 21.Kataoka H, DeCastro R, Zucker S, Biswas C. Tumor cell-derived collagenase-stimulatory factor increases expression of interstitial collagenase, stromelysin, and 72-kDa gelatinase. Cancer Res. 1993;53:3154–3158. [PubMed] [Google Scholar]
- 22.Biswas C, Zhang Y, Decastro R, et al. Human tumor cell-derived collagenase stimulatory factor (renamed Emmprin) is a member of the immunoglobulin superfamily. Cancer Res. 1995;55:434–439. [PubMed] [Google Scholar]
- 23.Sternlicht MD, Lochter A, Sympson CJ, et al. The stromal proteinase MMP3/stromelysin-1 promotes mammary carcinogenesis. Cell. 1999;98:137–146. doi: 10.1016/s0092-8674(00)81009-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Witty JP, Lempka T, Coffey RJ, Matrisian LM. Decreased tumor-formation in 7,12-dimethylbenzanthracene-treated stromelysin-1 transgenic mice is associated with alterations in mammary epithelial-cell apoptosis. Cancer Res. 1995;55:1401–1406. [PubMed] [Google Scholar]
- 25.Egeblad M, Werb Z. New functions for the matrix metallo proteinases in cancer progression. Nat Rev Cancer. 2002;2:161–174. doi: 10.1038/nrc745. [DOI] [PubMed] [Google Scholar]

