Skip to main content
NCBI home page
Breeding Science logoLink to Breeding Science
. 2011 Dec 15;61(4):373–379. doi: 10.1270/jsbbs.61.373

Production and characterization of an alloplasmic and monosomic addition line of Brassica rapa carrying the cytoplasm and one chromosome of Moricandia arvensis

Kota Tsutsui 1,3, Bum Hee Jeong 2, Yukiko Ito 1, Sang Woo Bang 1,*, Yukio Kaneko 1
PMCID: PMC3406767  PMID: 23136474

Abstract

Intergeneric hybridization was performed between Moricandia arvensis and four inbred lines of Brassica rapa following embryo rescue. Three F1 hybrid plants were developed from three cross combinations of M. arvensis × B. rapa, and amphidiploids were synthesized by colchicine treatment. Six BC1 plants were generated from a single cross combination of amphidipolid × B. rapa ‘Ko1-303’ through embryo rescue. One BC2 and three BC3 plants were obtained from successive backcrossing with B. rapa ‘Ko1-303’ employing embryo rescue. Alloplasmic and monosomic addition lines of B. rapa (Allo-MALs, 2n = 21) were obtained from backcrossed progeny of three BC3 plants (2n = 21, 22 and 23) without embryo rescue. An alloplasmic line of B. rapa (2n = 20) degenerated before floliation on 1/2 MS medium due to severe chlorosis. Allo-MALs of B. rapa (2n = 21) showed stable male sterility without any abnormal traits in vegetative growth and female fertility. Molecular analyses revealed that the same chromosome and cytoplasm of M. arvensis had been added to each Allo-MAL of B. rapa. This Allo-MAL of B. rapa may be useful material for producing cytoplasmic male sterile lines of B. rapa.

Keywords: intergeneric hybridization, Brassica rapa, Moricandia arvensis, alloplasmic line, monosomic addition line, chlorosis, cytoplasmic male sterility

Introduction

Brassica rapa, composed of a number of subspecies, such as chinensis, japonica, narinosa, oleifera, pekinensis and rapifera, has been used as a vegetable and oilseed crop throughout the world. In particular, it is a very important vegetable crop in East Asia. Commercial seeds of B. rapa cultivars in the market largely depend on F1 hybrid seeds because of their higher productivity and uniform traits. Most F1 hybrid seeds are produced using self-incompatibility controlled by S-alleles. However, self-incompatibility is not always suitable for production of F1 hybrid seeds because it can be unstable under some environmental conditions (Horisaki and Niikura 2004). On the other hand, F1 hybrid seed production of radish (Raphanus sativus), which also belongs to the Cruciferae, is based on both self-incompatibility and cytoplasmic male sterility (CMS). The Ogura cytoplasm found in Japanese radish (Ogura 1968) is most widely used as the male sterile cytoplasm of radish, and has been modified for introduction in Brassica crops with a restorer gene (Heyn 1976). CMS, a maternally inherited trait coded by the mitochondrial genome, is a more useful characteristic for stable F1 hybrid seed production, and has been used in many crops (onion, maize and sugar beet, etc.).

In several Brassica crop species (B. rapa, B. juncea and B. napus), a number of male sterile cytoplasms from related Brassica species have been introduced aggressively through interspecific and intergeneric hybridization or protoplast fusion followed by successive backcrossing: Diplotaxis muralis (Hinata and Konno 1979), Brassica tournefortii (Mathias 1985), Brassica oxyrrhina (Prakash and Chopra 1988), Diplotaxis siifolia (Rao et al. 1994), Trachystoma ballii (Kirti et al. 1995), Eruca sativa (Matsuzawa et al. 1999), Erucastrum canariense (Prakash et al. 1998), Diplotaxis catholica (Pathania et al. 2003), Enarthrocarpus lyratus (Deol et al. 2003), Diplotaxis erucoides (Bhat et al. 2006) and Diplotaxis berthautii (Bhat et al. 2008). On the other hand, the cytoplasm of Moricandia arvensis, which was first reported as a C3-C4 intermediate species, has also been introduced to B. juncea (Prakash et al. 1998) and R. sativus (Bang et al. 2002). Furthermore, the B. juncea CMS line has been approved for commercial cultivation by Indian Council for Agricultural Research in India, after overcoming chlorosis through chloroplast substitution (Kirti et al. 1998) and introgression of the Rf gene(s) from M. arvensis nucleus (Prakash et al. 1998). However, no alloplasmic B. rapa line carrying M. arvensis cytoplasm has been reported. A number of intergeneric hybrids between M. arvensis and B. rapa have been produced by embryo rescue (Takahata and Takeda 1990). However, no back-crossed progeny have been produced because of the low fertility encountered in their breeding. Bang et al. (2002) were able to obtain alloplasmic R. sativus carrying the M. arvensis cytoplasm and M. arvensis monosomic addition lines of R. sativus by overcoming barriers in intergeneric hybridization between M. arvensis and R. sativus and in the back-crossing of an F1 hybrid to R. sativus through embryo rescue followed by chromosome doubling of the F1 hybrid.

In the present study, we describe the production of an alloplasmic and monosomic addition line of B. rapa carrying the cytoplasm and one chromosome of M. arvensis, and discuss its morphologic, cytogenetic and molecular characteristics.

Materials and Methods

Plant materials

Moricandia arvensis (L.) DC. strain ‘MOR-ARV-4’ (2n = 28, MaMa) which is preserved in the Tohoku University Brassica Seed Bank, Japan was used as the pistillate parent. Four inbred lines of Brassica rapa L. (2n = 20, AA) were used as the pollen parent: ssp. pekinensis strain ‘Ha1-W10’, ‘Ha1-W610’, ssp. perviridis strain ‘Ko1-303’ and ssp. rapifera strain ‘Ka1-302’ provided by the Tohoku Seed Company, Japan. Moreover, B. rapa L. ssp. perviridis cv. ‘Syosai’, a commercial F1 cultivar provided by Tohoku Seed Company, was employed for comparison of morphological and molecular characteristics.

Production of intergeneric F1 hybrids and their progeny by successive backcrossing

Intergeneric hybridization between M. arvensis and B. rapa was performed using conventional crossing followed by embryo rescue. Flower buds were emasculated one day before flowering, immediately pollinated with fresh pollen and then bagged for approximately one week. Ovary culture followed by embryo culture was carried out for embryo rescue, according to Bang et al. (1996a). The embryo rescue technique was used to produce not only F1 plants but also BC1, BC2 and BC3 plants. In order to synthesize amphidiploids, 0.2% colchicine solution was applied to the apical meristem of some F1 seedlings. The seeds obtained from BC3 plants by backcrossing were sown on soil and on solidified 1/2 MS medium (Murashige and Skoog 1962) containing 500 mg/L casein hydrolysate, 3.0% sucrose and 1.1% agar.

Morphological and cytogenetic investigation of intergeneric F1 hybrids and backcrossed progeny (BC1 to BC4 plants)

Morphology of flowers and siliques of BC3 plants and seedlings of BC4 plants by backcrossing with B. rapa was characterized. Meiotic chromosome behavior in pollen mother cells (PMCs) and pollen tetrads were observed using the 1% acetic orcein smear method. Somatic chromosome number in root tip cells was examined using the Feulgen stain squash method followed by 1% acetocarmine staining. Pollen fertility was ascertained by observing 1000 pollen grains after staining with 1% acetocarmine.

Molecular biological analysis in BC4 plants derived from BC3 plants carrying the cytoplasm and chromosomes of M. arvensis

Total DNA of BC4 plants and their parent plants was extracted according to the CTAB method (Doyle and Doyle 1987). In order to clarify the organelle genome, we performed PCR analysis using a primer pair specific to mitochondrial 32 genes, described in Nahm et al. (2005), and to the chloroplast intergenic region (forward primer; 5′GAACGACGGGAATTGAACC3′, reverse primer; 5′TGCTGTTGAGGCTCCATCTA3′), which was designed based on the sequence of trnH and psbA in Arabidopsis thaliana (accession number AP000423). The 10 μl reaction mixtures contained 100 ng genomic DNA, 0.5 μM primers, 0.2 mM dNTPs (Fermentas, Vilnius, Lithuania), 1 × DreamTaq buffer and 0.5 unit of DreamTaq DNA polymerase (Fermentas) in 0.2 ml tubes, and PCR was carried out using a Program Temp Control system PC-320 (ASTEC Co., Fukuoka, Japan). Amplification conditions using primer pairs specific to mitochondrial genes were 94°C for 5 min followed by 35 cycles of 94°C for 30 sec, 54°C for 30 sec and 72°C for 2 min and finally 72°C for 10 min. For the primer pair specific to the chloroplast intergenic region, PCR conditions were 94°C for 5 min followed by 45 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 1.5 min and finally 72°C for 10 min. PCR products were mixed with loading dye and applied to a 0.7% or 3.0% agarose gel. After electrophoresis, the gel was stained by EtBr and observed on a transilluminator. For random amplified polymorphic DNA (RAPD) analysis, polyacrylamide gel electrophoresis was performed according to Kaneko et al. (2001) with some modifications. RAPD-specific markers detectable using 400 random primers of 12-mer sequences (Common A to D, BEX, Tokyo, Japan) were employed for identification of the additional chromosome in BC4 plants. The reaction mixture composition was as above except using 20 ng genomic DNA and 0.2 μM primer. Amplification conditions were as described in Akaba et al. (2009). After carrying out electrophoresis on a 0.5% polyacrylamide gel, the gel was viewed as above.

Results

Production and characterization of intergeneric F1 hybrids and backcrossed progeny up to the BC3 generation

In intergeneric hybridization between M. arvensis and four inbred lines of B. rapa, three amphidiploid plants (2n = 48, MaMaAA) were synthesized from three cross combinations through embryo rescue followed by colchicine treatment (Table 1). When the amphidiploid plants were backcrossed with the same inbred line of B. rapa as pollen parent of each amphidiploid, six BC1 plants (2n = 34, MaAA) were derived, but only from the amphidiploid plant (MaMaAA-1) backcrossed with ‘Ko1-303’ through embryo rescue. Only one BC2 plant (2n = 24) was generated from backcrossing of the BC1 plants to ‘Ko1-303’ by embryo rescue; none were generated through conventional crossing. In production of BC3 plant through successive backcrossing, no BC3 plant developed from 20 seeds obtained by conventional crossing. However, three BC3 plants developed from ten embryos cultured by embryo rescue; their somatic chromosome numbers were 2n = 21, 22 and 23, respectively (Table 1).

Table 1.

Production of intergeneric hybrids between Moricandia arvensis and Brassica rapa and BC1, BC2 and BC3 plants by successive back-crossing with B. rapa using ovary culture followed by embryo culture

Generations Cross combinations (2n) No. of flowers pollinated No. of ovaries cultured No. of embryos cultured No. of seeds obtained No. of hybrid plants (2n)
F1 M. arvensis × ‘Ka1-302’ 184 28 0 –
M. arvensis × ‘Ko1-303’ 74 20 2 1 (48)a
M. arvensis × ‘Ha1-W10’ 150 10 1 1 (48)a
M. arvensis × ‘Ha1-W610’ 162 30 6 1 (48)a
BC1 MaMaAA-1 (48)b × ‘Ko1-303’ 25 18 6 6 (34)
MaMaAA-2 (48)c × ‘Ha1-W10’ 36 30 0 –
MaMaAA-3 (48)d × ‘Ha1-W610’ 18 4 0 –
BC2 MaAA-BC1-1 (34) × ‘Ko1-303’ 103 0 –
MaAA-BC1-2 (34) × ‘Ko1-303’ 140 2 1 (24)
BC3 BC2-1 (24) × ‘Ko1-303’ 118 20 0
56 56 10 3 (21, 22, 23)
Open in a new tab
a

The plant was synthesized to amphidiploids by colchicine treatment.

b

MaMaAA-1 was amphidiploid F1 plant between M. arvensis and ‘Kol-303’.

c

MaMaAA-2 was amphidiploid F1 plant between M. arvensis and ‘Hal-W10’.

d

MaMaAA-3 was amphidiploid F1 plant between M. arvensis and ‘Hal-W610’

Meiotic chromosome configuration in PMCs of BC3-1 (2n = 21) was 10II + 1I in metaphase I and 10 + 11 in metaphase II (Fig. 1A, 1B). A BC3-1 (2n = 21) plant showed brown anthers with a few sterile pollen grains though formation of normal pollen tetrads (Fig. 1C–1G). There were few other differences in floral morphology between BC3-1 (2n = 21) and B. rapa ‘Syosai’. On the other hand, the ovules of BC3-1 (2n = 21) formed both green and white embryos when backcrossed with B. rapa ‘Ko1-303’ (Fig. 1H).

Fig. 1.

Fig. 1

Open in a new tab

Morphological and cytogenetical characteristics of BC3 and BC4 plants obtained by successive backcrossing with B. rapa. A and B; chromosome behavior in Metaphase I (10II + 1I) and Metaphase II (10 + 11), respectively. C; Pollen tetrads, D; Sterile pollen grains of BC3-1 (2n = 21). E; Fertile pollen grains of B. rapa ‘Syosai’. F and G; Floral morphology of BC3-1 (left) and B. rapa ‘Syosai’ (right). H; Green (arrows) and white ovules existing in the silique of the BC3-1 by backcrossing with B. rapa. I and J; Green (I) and white seedlings (J) after two weeks of sowing. K and L; Somatic chromosome numbers of green seedling (2n = 21) and white seedling (2n = 20), respectively. Bars indicate 0.5 cm.

Production and characterization of the Allo-MAL of B. rapa (Allo-MAL, 2n = 21) derived from BC3 plants by backcrossing

Seeds obtained from three BC3 plants by backcrossing were sown on soil in pots or on 1/2 MS medium. When the BC4 seeds were sown on soil, their germination rate showed approximately 50% in each line which was generated from the BC3 plants with chromosome number 2n = 21 and 2n = 22, and all progenies showed chromosome number 2n = 21 (Table 2). On the other hand, when the rest BC4 seeds were sown on 1/2 MS medium, green and white seedlings were developed and their chromosome numbers showed 2n = 21 and 2n = 20, respectively (Table 2 and Fig. 1I–1L). Green seedlings grew well without any abnormality in vegetative growth but white seedlings degenerated before floliation because of severe chlorosis. Accordingly, the low germination rate on soil seemed to be caused by the severe chlorosis which is appeared on the plant with chromosome number 2n = 20.

Table 2.

Production of BC4 plants derived from BC3 plants (2n = 21, 22 and 23) by sowing on soil and medium, and their morphological and cytogenetical characteristics

Cross combinations (2n) No. of seeds obtained Place of sowing No. of seeds sown Color of seedling
White Green
No. of seedlings No. of BC4 plants (2n)
20 21 22 23
BC3-1 (21) × ‘Ko1-303’ 155 Soil 50 0 0 26 – –
Mediuma 40 26 0 2 – –
BC3-2 (22) × ‘Ko1-303’ 81 Soil 40 0 0 23 0 –
Mediuma 20 0 0 2 0 –
BC3-3 (23) × ‘Ko1-303’ 12 Soil 12 0 0 3 0 0
Open in a new tab
a

1/2 MS medium

In PCR analysis using forward primer for atp6 and reverse primer for rrn18, a marker of approximately 6000 bp specific to M. arvensis was detected in both green and white seedlings produced from backcrossing of BC3-1 (2n = 21) and BC3-2 (2n = 22) to B. rapa ‘Ko1-303’ (Fig. 2A), although the PCR product was not sequenced. No other markers specific to M. arvensis was detected from the primer pairs to mitochondrial 32 genes. Furthermore, using a primer pair specific to the chloroplast intergenic region, a major marker (about 400 bp) in addition to two minor markers specific to M. arvensis was observed in both green and white seedlings (Fig. 2B). This is clear evidence that both green and white seedlings in BC4 generation are alloplasmic lines of B. rapa carrying M. arvensis cytoplasm. On the other hand, 17 RAPD markers specific to M. arvensis were detected by 14 random primers in each green seedling (2n = 21) produced from backcrossing of BC3-1 (2n = 21) and BC3-2 (2n = 22) with B. rapa ‘Ko1-303’, such as B09700bp, B41620bp, B41520bp, B43920bp, B441000bp, B63620bp, B67920bp, B711200bp, C35700bp, D061400bp, D15820bp, D22700bp, D764000bp, D76920bp, D77720bp, D77210bp and D901100bp but these markers were not detected in white seedlings (Fig. 2C). When the other random primers were employed, there was not polymorphism between green and white seedlings. Therefore, molecular analyses showed that all Allo-MALs of B. rapa (green seedlings, 2n = 21) carried the cytoplasm and the same chromosome of M. arvensis, while white seedlings (2n = 20) carried the cytoplasm of M. arvensis with no extra chromosomes from M. arvensis.

Fig. 2.

Fig. 2

Open in a new tab

Molecular analyses in BC4 plants obtained from BC3 plants with chromosome numbers 2n = 21 and 2n = 22 by backcrossing to B. rapa. PCR analysis using primer pairs specific to mitochondrial genes (A) and chloroplast intergenic region (B) and RAPD analysis using Common D22 as random primer (C). Primer pairs in A are forward primer for atp6 and reverse primer for rrn18. Primer pair in B is specific to intergenic region between trnH and psbA. The 21 and 22 lines are backcrossing progenies derived from BC3-1 (2n = 21) and BC3-2 (2n = 22), respectively. Ma; M. arvensis. W; White seedling (2n = 20). G; Green seedling (2n = 21). Br; B. rapa ‘Syosai’. M; Size marker. Arrow indicates marker specific to M. arvensis.

Discussion

Some wild relatives in the Cruciferae have been evaluated as genetic resources for potentially useful agricultural traits providing biotic and abiotic resistance (Warwick, 1993). Therefore, diverse wide crosses between Brassica crops and wild relatives have been carried out (Kaneko et al. 2009). One of these wild relatives, M. arvensis, has useful characteristics of a C3-C4 intermediate trait and CMS (Apel et al. 1978, Prakash et al. 1998). Sexual and somatic hybridization between M. arvensis and cruciferous crops employed as pollen parents or parents in cell fusion have been carried out to introduce the CMS trait of M. arvensis cytoplasm to B. rapa (Takahata and Takeda 1990), B. nigra (Takahata and Takeda 1990), B. oleracea (Takahata 1990, Ishikawa et al. 2003, Bang et al. 2007), B. juncea (Kirti et al. 1992, Takahata et al. 1993), B. napus (Takahata et al. 1993) and R. sativus (Bang et al. 1996b). However, only two alloplasmic lines of B. juncea and R. sativus carrying M. arvensis cytoplasm have been reported (Bang et al. 2002, Prakash et al. 1998).

In the present study, intergeneric hybrids between M. arvensis and B. rapa, and their backcrossed progeny up to the BC3 generation, were produced using embryo rescue (Table 1). However, alloplasmic lines of B. rapa, in which the nuclear genome was completely substituted with B. rapa, were not able to reproduce. Three plants in the BC3 generation showed 2n = 21, 22 and 23, and seemed to have one to three chromosomes of M. arvensis added to the B. rapa chromosome number (2n = 20) based on meiotic chromosome behavior in PMCs (Table 1 and Fig. 1A, 1B). After the BC3 generation, each backcrossed progeny was able to reproduce through conventional crossing without embryo rescue, and showed chromosome number 2n = 21, with only one chromosome of M. arvensis added to B. rapa (2n = 20) (Table 2). Alloplasmic lines of B. rapa (2n = 20) were only obtained after sowing on 1/2 MS medium, but they degenerated without foliation due to severe chlorosis (Table 2 and Fig. 1J, 1L). The siliques obtained from BC3 plants (2n = 21) by backcrossing to B. rapa formed both green and white ovules (Fig. 1H), and the Allo-MAL of B. rapa (Allo-MAL, 2n = 21) also formed two kinds of ovules after BC4 generation. We concluded that the Allo-MALs of B. rapa (2n = 21) and the alloplasmic B. rapa lines (2n = 20) were generated from green and white ovules, respectively, and they were formed according to the theoretical value because the formation rate of Allo-MAL of B. rapa (2n = 21) in the BC4 generation was approximately fifty percent.

Each result of the cytogenetic and molecular analyses in this study revealed that the Allo-MALs of B. rapa (2n = 21) generated from two BC3 plants having chromosome numbers 2n = 21 and 22 all contained M. arvensis substitution cytoplasm and an identical chromosome from M. arvensis. In addition to that, the white seedlings with chromosome number 2n = 20 generated from the BC3 plants by backcrossing to B. rapa were alloplasmic lines of B. rapa without any additional chromosome. Consequently, the alloplasmic B. rapa substituted with M. arvensis cytoplasm was not able to survive due to severe chlorosis, but the additional chromosome in the Allo-MALs of B. rapa (2n = 21) seemed to maintain the gene(s) for overcoming the chlorosis. An alloplasmic R. sativus line carrying M. arvensis cytoplasm, which was produced in the BC2 generation through successive backcrossing of an intergeneric hybrid between M. arvensis and R. sativus, showed light green leaves (Bang et al. 2002). On the other hand, an alloplasmic B. juncea line carrying the chloroplast and mitochondria genomes of M. arvensis, which was obtained in the BC3 generation following backcrossing of a somatic hybrid between B. juncea and M. arvensis, showed yellowish leaves (Prakash et al. 1998). As mentioned above, no alloplasmic B. rapa substituted with M. arvensis cytoplasm was obtained up to the BC4 generation due to severe chlorosis. Accordingly, the varying degrees of leaf chlorosis occurring in the alloplasmic lines substituted with the M. arvensis cytoplasm seemed to originate from incongruous interaction between the chloroplast genome of M. arvensis and the nuclear genome of the recipient species, and to be closely related to the female sterility in backcross progeny of interspecific and intergeneric hybridizations.

The Allo-MALs of B. rapa (2n = 21) we obtained showed stable male sterility without any abnormal traits in vegetative growth or female fertility. The flowers were normal except for slender anthers containing only sterile pollen and excellent nectaries (Fig. 1F, 1G). The pollen degeneration of Allo-MALs of B. rapa (2n = 21) seemed to occur at the microspore based on normal chromosome behavior and formation of normal pollen tetrads (Fig. 1A–1D). The M. arvensis cytoplasm may be a novel CMS source in B. rapa in addition to B. juncea and R. sativus. However, the CMS system in B. rapa may be not used without overcoming the severe chlorosis. Kirti et al. (1998) was able to overcome chlorosis occurring in alloplasmic B. juncea carrying M. arvensis cytoplasm through replacement of the chloroplasts of alloplasmic B. juncea with those of normal green B. juncea by protoplast fusion. As indicated by Namai (1987), the introgression of desirable genes from one species to another of the Cruciferae has been accomplished via meiotic allo-synthesis in Brassica crops. Such homoeologous chromosome pairing is a practical method for intergenomic introgression. For example, the restorer genes for alloplasmic CMS B. juncea carrying the cytoplasm of D. catholica, M. arvensis or T. ballii were introduced by homoeologous recombination between chromosomes of B. juncea and cytoplasmic donors (Kirti et al. 1997, Pathania et al. 2003, Prakash et al. 1998). Takahata and Takeda (1990) reported that allosyndesis was observed in amphihaploid plants (2n = 24, MaA) between M. arvensis and B. rapa. If the alloplasmic B. rapa line (2n = 20) with normal green leaves is produced by backcrossing progeny of Allo-MAL of B. rapa (2n = 21) through homoeologous chromosome pairing, it might be a novel method for overcoming chlorosis in alloplasmic CMS lines carrying the M. arvensis cytoplasm. Therefore, the Allo-MAL of B. rapa (2n = 21) obtained through successive backcrossing of intergeneric hybrids between M. arvensis and B. rapa may be useful breeding material for producing a cytoplasmic male sterile line of B. rapa having green leaves.

Acknowledgements

This research was supported by the Program for Promotion of Basic and Applied Researches for Innovations in Bio-oriented Industry (BRAIN).

Literature Cited

  1. Akaba M, Kaneko Y, Ito Y, Nakata Y, Bang SW, Matsuzawa Y. Production and characterization of Brassica napus–Raphanus sativus monosomic addition lines mediated by the synthetic amphidiploid “Raphanobrassica”. Breed Sci. 2009;59:109–118. [Google Scholar]
  2. Apel P, Ticha I, Peisker M. CO2 compensation concentration in leaves of Moricandia arvensis (L.) DC. at different insertion levels and O2 concentrations. Biochem Physiol Pflanz. 1978;172:547–552. [Google Scholar]
  3. Bang SW, Kaneko Y, Matsuzawa Y. Production of intergeneric hybrids between Raphanus and Sinapis and the cytogenetics of their progenies. Breed Sci. 1996a;46:45–51. [Google Scholar]
  4. Bang SW, Kaneko Y, Matsuzawa Y. Production of intergeneric hybrids between Raphanus and Moricandia. Plant Breed. 1996b;115:385–390. [Google Scholar]
  5. Bang SW, Kaneko Y, Matsuzawa Y, Bang KS. Breeding of Moricandia arvensis monosomic chromosome addition lines (2n = 19) of alloplasmic (M. arvensis) Raphanus sativus. Breed Sci. 2002;52:193–199. [Google Scholar]
  6. Bang SW, Sugihara K, Jeong BH, Kaneko R, Satake E, Kaneko Y, Matsuzawa Y. Production and characterization of intergeneric hybrids between Brassica oleracea and a wild relative Moricandia arvensis. Plant Breed. 2007;126:101–103. [Google Scholar]
  7. Bhat SR, Priya V, Ashutosh, Dwivedi KK, Prakash S. Diplotaxis ercoides induced cytoplasmic male sterility in Brassica juncea is rescued by the Moricandia arvensis restorer: genetic and molecular analyses. Plant Breed. 2006;125:150–155. [Google Scholar]
  8. Bhat SR, Kumar P, Prakash S. An improved cytoplasmic male sterile (Diplotaxis berthautii) Brassica juncea: identification of restorer and molecular characterization. Euphytica. 2008;159:145–152. [Google Scholar]
  9. Deol JS, Shivanna KR, Prakash S, Banga SS. Enarthrocarpus lyratus-based cytoplasmic male sterility and fertility restorer system in Brassica rapa. Plant Breed. 2003;122:438–440. [Google Scholar]
  10. Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin. 1987;19:11–15. [Google Scholar]
  11. Heyn FW. Transfer of restorer genes from Raphanus to cytoplasmic male sterile Brassica napus. Eucarpia Cruciferae Newslett. 1976;1:15–16. [Google Scholar]
  12. Hinata K, Konno N. Studies on a male-sterile strain having the Brassica campestris nucleus and the Diplotaxis muralis cytoplasm. Jpn J Breed. 1979;29:305–311. [Google Scholar]
  13. Horisaki A, Nikura S. Effectiveness of insect-pollination to evaluate the level of self-incompatibility and genetic variation in Brassica rapa L. Breed Sci. 2004;54:291–295. [Google Scholar]
  14. Ishikawa S, Bang SW, Kaneko Y, Matsuzawa Y. Production and characterization of intergeneric somatic hybrids between Moricandia arvensis and Brassica olerasea. Plant Breed. 2003;122:233–238. [Google Scholar]
  15. Kaneko Y, Yano H, Bang SW, Matsuzawa Y. Production and characterization of Raphanus sativus-Brassica rapa monosomic chromosome addition lines. Plant Breed. 2001;120:163–168. [Google Scholar]
  16. Kaneko Y, Bang SW, Matsuzawa Y. 11 Distant hybridization. In: Gupta SK, editor. Biology and Breeding of Crucifers. CRC Press; Boca Raton: 2009. pp. 207–247. [Google Scholar]
  17. Kirti PB, Nrasimhulu SB, Prakash S, Chopra VL. Somatic hybridization between Brassica juncea and Moricandia arvensis by protoplast fusion. Plant Cell Rep. 1992;11:318–321. doi: 10.1007/BF00235090. [DOI] [PubMed] [Google Scholar]
  18. Kirti PB, Mohapatra T, Prakash S, Chopra VL. Development of a stable cytoplasmic male sterile line of Brassica juncea from somatic hybrid Trachystoma ballii + Brassica juncea. Plant Breed. 1995;114:434–438. [Google Scholar]
  19. Kirti PB, Baldev A, Galkwad K, Bhat SR, Kumar VD, Prakash S, Chopra VL. Introgression of a gene restoring fertility to CMS (Trachystoma) Brassica juncea and genetics of restoration. Plant Breed. 1997;116:259–262. [Google Scholar]
  20. Kirti PB, Prakash S, Gaikwad K, Kumar VD, Bhat SR, Chopra VL. Chloroplast substitution overcomes leaf chlorosis in a Moricandia arvensis-based cytoplasmic male sterile Brassica juncea. Theor Appl Genet. 1998;97:1179–1182. [Google Scholar]
  21. Mathias R. Transfer of cytoplasmic male sterility from brown mustard (Brassica juncea L. Czern.) into rapeseed (Brassica napus L.) Zeitschrift fuer Pflanzenzuechtung. 1985;95:371–374. [Google Scholar]
  22. Matsuzawa Y, Mekiyanon S, Kaneko Y, Bang SW, Wakui K, Takahata Y. Male sterility in alloplasmic Brassica rapa L. carring Eruca sativa cytoplasm. Plant Breed. 1999;118:82–84. [Google Scholar]
  23. Murashige T, Skoog F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant. 1962;15:473–497. [Google Scholar]
  24. Nahm SH, Lee HJ, Lee SW, Joo GY, Harn CH, Yang SG, Min BW. Development of a molecular marker specific to a novel CMS line in radish (Raphanus sativus L.) Theor Appl Genet. 2005;111:1191–1200. doi: 10.1007/s00122-005-0052-x. [DOI] [PubMed] [Google Scholar]
  25. Namai H. Inducing cytogenetical alterations by means of interspecific and intergeneric hybridization in Brassica crops. Gamma Field Symp. 1987;26:41–89. [Google Scholar]
  26. Ogura H. Studies on the new male sterility in Japanese radish, with special reference on the utilization of this sterility towards the practical raising of hybrid seeds. Mem Fac Agric Kagoshima Univ. 1968;6:39–78. [Google Scholar]
  27. Pathania A, Bhat SR, Kumar VD, Ashutosh, Kirti PB, Prakash S, Chopra VL. Cytoplasmic male sterility in alloplasmic Brassica juncea carrying Diplotaxis catholica cytoplasm: molecular characterization and genetics of fertility restoration. Theor Appl Genet. 2003;107:455–461. doi: 10.1007/s00122-003-1266-4. [DOI] [PubMed] [Google Scholar]
  28. Prakash S, Chopra VL. Synthesis of alloplasmic Brassica campestris as a new source of cytoplasmic male sterility. Plant Breed. 1988;101:235–237. [Google Scholar]
  29. Prakash S, Kirti PB, Bhat SR, Gaikwad K, Dineshkumar V, Chopra VL. A Moricandia arvensis-based cytoplasmic male sterility and fertility restoration system in Brassica juncea. Theor Appl Genet. 1998;97:488–492. [Google Scholar]
  30. Rao GU, Batra VS, Prakash S, Shivanna KR. Development of a new cytoplasmic male sterile system in Brassica juncea through wide hybridization. Plant Breed. 1994;112:171–174. [Google Scholar]
  31. Takahata Y. Production of intergeneric hybrids between a C3-C4 intermediate species Moricandia arvensis and a C3 species Brassica oleracea through ovary culture. Euphytica. 1990;46:259–264. [Google Scholar]
  32. Takahata Y, Takeda T. Intergeneric (intersubtribe) hybridization between Moricandia arvensis and Brassica A and B genome species by ovary culture. Theor Appl Genet. 1990;80:38–42. doi: 10.1007/BF00224013. [DOI] [PubMed] [Google Scholar]
  33. Takahata Y, Takeda T, Kaizuma N. Wide hybridization between Moricandia arvensis and Brassica amphidiploid species (B. napus and B. juncea) Euphytica. 1993;69:155–160. [Google Scholar]
  34. Warwick SI. Guide to the wild germplasm of Brassica and allied crops. Part IV. Wild species in the Tribe Brassiceae (Cruciferae) as sources of agronomic traits. Agriculture Canada Research Branch, Technical Bulletin 17E; Ottawa: 1993. p. 19. [Google Scholar]

Articles from Breeding Science are provided here courtesy of Japanese Society of Breeding

RESOURCES