Skip to main content
NCBI home page
Breeding Science logoLink to Breeding Science
. 2011 Dec 15;61(4):413–419. doi: 10.1270/jsbbs.61.413

Development of genomic and EST-SSR markers in radish (Raphanus sativus L.)

Ryoichi Nakatsuji 1, Tomoko Hashida 1, Naoko Matsumoto 2, Masato Tsuro 3, Nakao Kubo 1,*, Masashi Hirai 1
PMCID: PMC3406777  PMID: 23136479

Abstract

Radish (Raphanus sativus L.) belongs to Brassicaceae family and is a close relative of Brassica. This species shows a wide morphological diversity, and is an important vegetable especially in Asia. However, molecular research of radish is behind compared to that of Brassica. For example, reports on SSR (simple sequence repeat) markers are limited. Here, we designed 417 radish SSR markers from SSR-enriched genomic libraries and the cDNA data. Of the 256 SSR markers succeeded in PCR, 130 showed clear polymorphisms between two radish lines; a rat-tail radish and a Japanese cultivar, ‘Harufuku’. As a test case for evaluation of the present SSRs, we conducted two studies. First, we selected 16 SSRs to calculate polymorphism information contents (PICs) using 16 radish cultivars and four other Brassicaceae species. These markers detected 3–15 alleles (average = 9.6). PIC values ranged from 0.54 to 0.92 (average = 0.78). Second, part of the present SSRs were tested for mapping using our previously-examined mapping population. The map spanned 672.7 cM with nine linkage groups (LGs). The 21 radish SSR markers were distributed throughout the LGs. The SSR markers developed here would be informative and useful for genetic analysis in radish and its related species.

Keywords: Radish, Raphanus sativus, SSR (simple sequence repeat) marker

Introduction

Radish (Raphanus sativus L., 2n = 18) is a member of Brassicaceae family, and has a relatively small genome size. The size is similar to those of other Brassicaceae species such as Brassica rapa (Johnston et al. 2005). Radish is thought to have originated in Mediterranean areas, and is now widely cultivated in East Asian countries as an important vegetable root crop (Kaneko et al. 2007). The edible part of this crop is called root, but in histology, it consists of the true root and the hypocotyl. A wide morphological diversity of this part is known in this species, and many cultivars having various shapes of thickened root have been developed in East Asia (Kitamura 1958). In contrast, a rat-tail radish produces no thickened root, and is cultivated in tropical Asia for edible puffed pods (Banga 1976).

Though radish has an extreme importance from the economic and agricultural views, molecular research of radish such as genome mapping and genetic diversity is behind compared to that of Brassica species. Molecular markers have been extensively used to study genetic diversity, genetic relationships and mapping studies in various crop species. Of these, simple sequence repeats (SSRs) or microsatellites are frequently utilized as DNA markers. The SSR is a DNA repeat consisting of 1–6 nucleotide repeat units, abundantly distributed in most eukaryotic genomes. The SSR marker has the advantages of high variability, ease of detection, codominant inheritance nature, and good transferability between populations and in different research groups (see Jones et al. 2009 for a review). For these reasons, SSRs have become an important marker system in cultivar fingerprinting, diversity studies, molecular mapping and marker-assisted selection. On the other hand, because isolation of SSRs and establishment of the specific primers generally require high cost and a long development time, the number of available SSR markers differs in species. Actually, despite a number of SSR markers in Brassica species, there have been only a few reports on development of SSR markers in radish (Kamei et al. 2010, Ohsako et al. 2010, Wang et al. 2007, Yamane et al. 2009). In the previous studies, we have made linkage maps of radish to detect loci for morphological characters and clubroot resistance (Kamei et al. 2010, Tsuro et al. 2005, 2008). Even including our efforts, reports on the linkage map are still limited in radish compared to other Brassicaceae species (Bett and Lydiate 2003, Budahn et al. 2009, Kamei et al. 2010, Tsuro et al. 2005, 2008). Since limited numbers of SSR markers were used in these studies, correspondence of the published linkage groups (LGs) is mostly unclear. Under such circumstances, increasing the number of available SSR markers would be of importance to conduct further genetic studies in radish.

Here, we designed a total of 417 SSR primer pairs in radish from SSR-enriched genomic libraries and cDNA data in the database. Utilities of the radish SSR markers were tested in the two following ways. To assess the usefulness of these markers among radish and other related species in Brassicaceae, the polymorphism information contents (PICs) were calculated. Of the 73 SSR markers tested for mapping, 21 markers were located on a radish linkage map. These results showed effectiveness of the SSRs for mapping study in addition to potential utility for the genetic diversity analysis.

Materials and Methods

Plant materials and DNA extraction

Three following radish lines were used for preparing genomic DNA libraries; a rat-tail radish, a Japanese cultivar, ‘Harufuku’, and an F1 plant derived from a cross between them. The homozygosity of the two parental lines was increased by five or six successive selfings. DNA was extracted from plant leaves using DNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). For allele analysis, 16 radish cultivars and four lines of other Brassicaceae species were used (Table 1).

Table 1.

Cultivars, lines and an ecotype used in this study

Species name Cultivars, lines and an ecotype Origin
Raphanus sativus Akasuji Takii & Co., Ltd
Everest Takii & Co., Ltd
Harufuku National Institute of Vegetable and Tea Science
Horyo Takii & Co., Ltd
Koga-benimaru Sakata Seed Co.
Kunitomi Matsunaga Seed Co., Ltd
Kurobakei-Minowase Takii & Co., Ltd
Miyashige ohnaga Takii & Co., Ltd
Moriguchi hosonaga Matsunaga Seed Co., Ltd
Rat-tail radish National Institute of Vegetable and Tea Science
Red Globe Tohoku & Co., Ltd
Sakurajima ohmaru Takii & Co., Ltd
Shogoin daikon Sakata Seed Co.
Tokinashi Marutane Co., Ltd
Wakayama Takii & Co., Ltd
Yakumidaikon Noguchi Seed Co.
Arabidopsis thaliana Columbia
Brassica juncea Akaohba takana Takii & Co., Ltd
Brassica oleracea Grand Duke Takii & Co., Ltd
Brassica rapa Shogoin ohmarukabu Takii & Co., Ltd
Open in a new tab

Development of SSR markers

The SSR-enriched genomic DNA libraries were constructed according to Nunome et al. (2006). The SSR-enriched fragments were ligated into a pCR-TOPO vector (Invitrogen, Carlsbad, CA, USA). Resultant plasmids were used to transform TOP10 competent cells (Invitrogen). Clones with a 0.5–1.5 kb insert were sequenced using a CEQ8800XL sequencer (Beckman Coulter, Fullerton, CA, USA). Nucleotide sequences of 47 redundant clones were removed manually. Nucleotide sequence data of the genomic SSRs developed here are deposited in the DDBJ/EMBL/GenBank databases under accession nos. AB425071, AB425072, AB425076-AB425078 and AB608338-AB608637 (Supplemental Table 1). EST-SSR markers were designed from cDNA contig data in the RadishDB (http://radish.plantbiology.msu.edu). Sequences containing SSR with >10 mononucleotide, >6 dinucleotide and >5 trinucleotide repeats were used for primer design as described previously (Hirai et al. 2010, Kubo et al. 2009). Primers were designed using the Primer3 software (Rozen and Skaletsky 2000). Amplification of primer pairs was tested in the two radish lines above. PCR amplification was carried out as described previously (Saito et al. 2006). The annealing temperature was initially fixed at 50°C and then slight modifications were made to achieve optimal amplification (Supplemental Table 1). The amplified products were electrophoresed in a 3% agarose gel or with the CEQ8800XL sequencer (Beckman Coulter). Primer pairs showing clear polymorphic bands in these lines were then used for further analysis.

Fragment analysis and allele detection

Out of the developed SSRs, 16 primer pairs were used for the analysis of cultivars listed in Table 1. The 5′-end of forward primer was labeled with a fluorescent dye (Sigma-Aldrich, St. Louis, MO, USA), and PCR amplification was carried out as described above. The fragment sizes of SSR loci were analyzed with the CEQ8800XL sequencer (Beckman Coulter). The value of the polymorphic information content (PIC) at each locus was calculated for the 16 radish cultivars as described (Anderson et al. 1993).

Linkage mapping

An improved linkage map of radish has been developed in this study based on our previous data (Tsuro et al. 2008) plus the SSR marker data as described below. For the mapping, 73 radish SSR markers developed here, seven already-reported radish SSRs (Kamei et al. 2010, Ohsako et al. 2010, Wang et al. 2007) and six B. rapa SSRs (Suwabe et al. 2002, 2006) were newly tested in this study. The polymorphic markers were then used for scoring the segregation in the F2 population (n = 106) (Tsuro et al. 2008). Linkage analysis was performed using the JoinMap ver. 3.0 software (Van Ooijen and Voorrips 2001), but markers deviating significantly (P < 0.001) from the expected segregation ratio were excluded from the analysis. The Kosambi map function (Kosambi 1944) was used to calculate the genetic distance between markers.

Results

Development of SSR markers in radish

Three SSR-enriched libraries were developed from the two radish lines (rat-tail radish and ‘Harufuku’) and their F1 plant. From the rat-tailed radish library, 326 clones were sequenced. Similarly, 92 and 299 clones were sequenced from ‘Harufuku’ and the F1 plant libraries, respectively (Table 2). Of these, 245 (75.2%), 63 (68.5%) and 191 (63.9%) contained SSR motifs in the sequenced clones, respectively. Out of the 293 primer pairs initially designed from the non-redundant SSR-containing sequences, 156 primer pairs amplified clear bands. Of the 156 pairs succeeded in PCR, 90 primer pairs (57.7%) showed polymorphisms between the two radish lines (Table 2). We also designed 124 primer pairs of EST-SSRs from cDNA contig data in the RadishDB. Of these EST-based primer pairs, 100 produced clear bands within the predicted size range. Of the 100 successful EST-SSRs, 40 primer pairs (40.0%) showed polymorphisms between the two radish lines (Table 2). Finally, 256 SSR markers (156 genomic and 100 EST-SSRs) resulted in clear bands, of which 130 markers were polymorphic between the two radish lines (Table 2 and bold types in Supplemental Table 1).

Table 2.

Development of radish SSR markers

Genomic SSRs EST-SSRs Total
Origina Rat-tail radish Harufuku F1 Subtotal RadishDB
No. of clones sequenced 326 92 299 717 – –
No. of clones containing SSR 245 63 191 499 – –
SSR enrichment (%) 75.2 68.5 63.9 69.6 – –
No. of primer pairs desinged 183 31 79 293 124 417
No. of primer pairs amplified clear bandsb 81 26 49 156 100 256
No. of polymorphic primer pairsb 48 17 25 90 40 130
Polymorphism (%)b 59.3 65.4 51.0 57.7 40.0 50.8
Open in a new tab
a

F1: an F1 hybrid of rat-tail radish and Harufuku. RadishDB: cDNA contig data from the RadishDB.

b

Data based on the experiments in rat-tail radish and Harufuku. See footnotes in Supplemental Table 1 for details.

Assessment of SSR polymorphisms by a fragment analysis

Out of the primers that amplified clear polymorphic bands, 16 SSR loci were tested for the ability to detect alleles using radish cultivars (Table 3). Of the markers tested, 13 primer pairs amplified clear polymorphic bands for all the 16 radish cultivars (Table 4). These markers detected 3–15 alleles with an average of 9.6. PIC values ranged from 0.54 to 0.92 with an average of 0.78. We also tested nine primer pairs for amplification in other Brassicaceae species. PCR gave detectable amplicons in more than half of the SSR markers tested in the Brassica species though their sizes were often different from those in radish (Table 4).

Table 3.

Radish SSR loci used for allele detection

Marker namea Primer sequence (5′-3′) Repeat motif Product size (bp)b No. of alleles detected Allele size range (nt)c PIC Accession No.
RsSA012 F: GGATCGTTCCTTTTTAGGGTAAT (GA)23 187 15 152–237 0.90 AB608423
R: GCTAAAAATCCGTGAGAAAGAG
RsSA014 F: AATAAGCATGTGGTGGGAAGTTA (GA)11 183 3 171–183 0.54 AB608424
R: GGGTTTATGAAAGGGATTTTGTC
RsSA020 F: TCAGGGGTAAAACCGTCAATTA (CT)17 227 8 193–227 0.76 AB608427
R: AGGATCGGAGATACGATTCAAA
RsSA027 F: CTAGCCGTTTCCAAATTTGTTC (GA)42 190 15 154–198 0.89 AB608430
R: AGTACTTTAACCACTGCCCAACA
RsSA033 F: ACAATTTCACGACAGTAAACATGAA (TC)26 228 14 181–285 0.87 AB608432
R: CCGAGTTGATTAAAACACACATACA
RsSA120 F: TCTTACCATTGGTGTAAGTCAATCC (GA)27 253 15 209–256 0.92 AB608477
R: GAAAGGTGGAGAAAATGAAGTAACA
RsSH001 F: AACTCAGGTCCCTTGTGCTAGA (TC)6(CA)7 237 4 201–243 0.65 AB608483
R: GGAACTATGTTGTTGTCGGAAA
RsSH016 F: GTTTGTTGTTGTTTGTGTCACCT (CT)4(GT)3(CT)10 136 6 132–140 0.76 AB608488
R: CAGAAGCAAGCACTATTTGAGAA
RsSH048 F: TCGTCCGTTATGTATGTTACTCTCA (GT)11 200 7 188–206 0.60 AB608489
R: TATGCGTACTCCGTAAGACAATGTA
RsSH093 F: CAATTCTTTGTATGCTTTTGTCTGAT (GA)17 233 7 231–239 0.76 AB608516
R: TGGCAAGATATATATAACCCTCGTTT
RsSR025 F: ACACTTTCAGTCACCGACACATA (GA)20 239 14 213–252 0.89 AB608556
R: ACTTTCTTTAGGTAACCCCACCA
RsSR040 F: CGTCTCTTTCTTTTTCAGACCAA (TC)14 221 10 202–228 0.73 AB608564
R: GCTTGAGATGAGATGAGGAGAAA
RsSR042 F: ATAAAGCAGCAGAAGATGGTGAG (AC)14 171 9 156–206 0.80 AB608565
R: GAATGAAACTCCTTTAAGAAGAAGC
RsHH016 F: CTGATCGAACTGGAACCACAATT (AG)24 189 10 179–209 0.82 AB608620
R: GAGGGTTTTAGGGCACCTGA
RsHH023 F: CTGGTCTCACAATCAAACATCT (TA)10(TG)13 169 11 162–206 0.83 AB608624
R: CTTATCTGTCACTTATTAATAGGCT
RsHR026 F: AAGCGTGTCATCAGATCCCAGA (GA)13 131 6 119–135 0.68 AB608635
R: CATTCTCTCAATGCATAAGATTGAGC
Average 9.6 0.78
Open in a new tab
a

A complete list of radish SSRs developed in this study is shown as Supplemental Table 1.

b

Estimated from the nucleotide sequences used for primer design.

c

Sizes determined by fragment analyses.

Table 4.

Alleles in 16 radish cultivars and 4 other Brassicaceae species

Marker name RsSA012 RsSA014 RsSA020 RsSA027 RsSA033 RsSA120 RsSH001 RsSH016 RsSH048 RsSH093 RsSR025 RsSR040 RsSR042 RsHH016 RsHH023 RsHR026
Sample name
Radish cultivars
Akasuji 192/192 174/174 213/225 162/197 278/278 210/253 243/243 132/139 200/200 233/234 222/241 221/221 161/171 181/189 198/198 131/133
Everest 152/152 171/171 203/203 186/186 226/242 233/253 239/239 134/134 198/200 231/231 213/251 221/221 159/171 189/189 169/186 135/135
Harufuku 224/237 171/171 203/203 186/186 236/236 250/250 237/237 163/163 200/200 233/233 241/241 223/223 161/161 189/189 169/169 131/131
Horyo 187/235 171/171 225/225 161/198 208/234 244/244 239/243 132/132 198/198 234/234 235/235 228/228 206/206 181/189 186/186 131/135
Koga-benimaru 187/187 171/171 217/217 154/158 181/190 215/228 243/243 134/139 188/190 234/234 240/252 223/223 171/171 179/179 164/164 133/135
Kunitomi 188/188 174/174 225/225 162/162 228/234 242/252 201/239 134/134 198/206 234/234 234/236 221/221 159/161 – – 135/135
Kurobakei-Minowase 190/228 174/174 213/225 165/165 279/279 257/257 239/239 132/132 198/200 234/234 222/222 221/221 169/171 181/181 211/211 119/135
Miyashige ohnaga 182/182 174/174 209/209 159/163 228/234 210/212 239/239 132/134 200/200 233/233 235/241 223/223 156/161 181/189 186/186 135/135
Moriguchi hosonaga 188/188 171/174 225/225 161/161 234/234 244/248 239/239 139/139 200/200 232/232 235/235 211/221 156/171 193/193 197/205 134/135
Rat-tail radish 187/187 183/183 227/227 190/190 228/228 253/253 237/237 136/136 200/200 233/233 239/239 221/221 171/171 181/181 186/186 133/133
Red Globe 232/232 174/174 193/193 165/165 285/285 215/228 243/243 136/140 198/200 237/237 217/217 204/221 156/157 179/179 162/162 135/135
Sakurajima ohmaru 187/231 174/174 216/217 161/161 234/234 210/212 237/239 132/132 198/198 233/234 250/250 213/221 165/167 181/189 186/186 131/131
Shogoin daikon 216/232 171/171 217/225 177/177 228/228 242/255 239/239 139/139 198/200 233/237 235/235 223/223 171/171 181/189 186/186 131/131
Tokinashi 228/228 171/174 225/227 177/192 222/234 212/256 237/237 132/132 197/198 232/239 213/236 220/220 161/161 185/185 174/174 131/135
Wakayama 222/222 174/174 225/225 161/161 232/232 210/250 237/243 139/139 199/200 234/235 242/241 221/221 159/161 191/195 169/169 130/131
Yakumidaikon 187/220 174/174 225/225 179/188 224/224 209/209 239/239 134/134 200/200 237/237 238/238 202/210 159/159 201/209 204/206 –
Expected size (bp)a 187 183 227 190 228 253 237 136 200 233 239 221 171 189 169 131
Size range (nt)a 152–237 171–183 193–227 154–198 181–285 209–256 201–243 132–140 188–206 231–239 213–252 202–228 156–206 179–209 162–206 119–135
PIC 0.90 0.54 0.76 0.89 0.87 0.92 0.65 0.76 0.60 0.76 0.89 0.73 0.80 0.82 0.83 0.68
Other Brassicaceae species
Arabidopsis thaliana (Columbia) – – 142/142 161/161 N.E. N.E. 193/193 204/204 N.E. N.E. – 210/210 – N.E. N.E. N.E.
Brassica juncea (Akaohba takana) 195/195 116/197 169/199 203/297 N.E. N.E. 231/242 113/113 N.E. N.E. 191/217 230/230 154/154 N.E. N.E. N.E.
B. oleacea (Grand Duke) 170/170 191/191 176/206 225/278 N.E. N.E. 246/246 113/119 N.E. N.E. 219/220 236/290 140/140 N.E. N.E. N.E.
B. rapa (Shogoin ohmarukabu) – 167/167 199/199 152/152 N.E. N.E. 179/179 113/113 N.E. N.E. 189/189 290/290 163/163 N.E. N.E. N.E.
Open in a new tab
a

See footnotes in Table 3.

–: no specific amplification detectable.

N.E.: not examined.

Linkage mapping of the radish SSRs

The present SSRs were tested for a mapping study. Of the 80 radish SSRs tested, 23 markers were successfully localized on the linkage map (Fig. 1, arrows), of which 21 were ones developed here (Fig. 1, bold types). Finally, the present map was constructed with the 336 loci (278 AFLPs, 23 radish SSRs, 34 B. rapa SSRs and 1 radish CAPS, see legend of Fig. 1 for marker nomenclatures), whereas only seven loci (4 AFLPs, 1 radish SSR and 2 B. rapa SSRs) were unmapped. This map spanned 672.7 cM with nine LGs, which are expected from the chromosome number of radish. The length of the LGs ranged from 35.6 to 122.4 cM, which contained from 22 to 56 markers, respectively, with an average map interval of 2.0 cM. The mapped SSR markers were distributed throughout the LGs.

Fig. 1.

Fig. 1

Open in a new tab

Positions of radish SSRs on a radish linkage map. Arrows indicate the radish SSRs, of which bold types are ones developed in this study. Asterisks indicate nine of the 16 SSR markers used in allele detection among 16 radish cultivars and four other Brassicaceae species. The loci denoted with BRMS- and SLG_CAPS are B. rapa SSRs (Suwabe et al. 2002, 2006) and a CAPS marker for S-locus specific glycoprotein gene (Niikura and Matsuura 1998), respectively. Others are AFLP markers.

Discussion

The present study seems to be successful in the SSR-enrichment from the radish genomes, judging from the efficiencies of SSR-enrichment as compared with those in the previous studies using cucumber (Fukino et al. 2008), Vaccinium (Hirai et al. 2010) and water lotus (Kubo et al. 2009). We have used three DNA materials (two radish lines and their F1 hybrid) for the SSR development. There was no obvious difference among the three with regard to the SSR-enrichment efficiency and the polymorphisms of markers (Table 2). Out of the 293 primer pairs initially designed for genomic SSR markers, 156 primer pairs succeeded in PCR amplifying clear bands (53.2%), whereas 81 pairs produced faint, smear or multiple bands (27.6%) (Supplemental Table 1). The rest of 56 pairs resulted in no amplification (19.1%). One of the reasons for failure in the PCR amplification could be due to the presence of repetitive DNA sequences or similar sequences in other genomic regions, as observed in marker development from species with large genomes (Song et al. 2005). The unsuccessful markers might be converted into useful markers by re-designing the primer pairs based on the nucleotide sequences flanked by the SSR repeats (Supplemental Table 1, accession nos.). The success rate of the PCR amplification in the EST-SSRs (80.6%) was higher than that in the genomic SSRs (53.2%). Similar observation has been reported in different crops such as coffee and common bean (e.g. Aggarwal et al. 2007, Blair et al. 2006). This could be because exon-derived sequences are more conservative than the intergenic regions. In spite of such the conservative nature of ESTs, some of the EST-derived SSRs were failed in stable amplification. This could be because some primer sites may have been designed across splicing sites or because of chimerical origins of the cDNA clones in the database, as discussed by Tsukazaki et al. (2010). Although polymorphism of EST-SSRs is generally lower than that of genomic SSRs (Blair et al. 2006) because of the conservative nature of exon sequences, no obvious difference was found in polymorphism rate between the genomic and EST-SSRs as long as comparison of the present two radish lines.

We previously applied B. rapa SSRs (Suwabe et al. 2002, 2006) to the radish mapping studies (Tsuro et al. 2005, 2008). In the present study, we showed that the inverse case was also effective in part. More than half of the tested radish SSRs clearly detected alleles in four lines of the Brassicaceae genera in addition to the radish cultivars (Table 4), suggesting the effectiveness of the radish SSRs across the Brassicaceae genera. The PIC values obtained in this study (average = 0.78) were comparable to those of Brassica species (Suwabe et al. 2002). Although limited numbers of SSRs were tested in this allele analysis as a test case, we confirmed that the radish SSRs developed in the previous and the present studies were applicable to the genetic diversity study in a wild radish (Ohsako et al. 2010) and Japanese radish landraces (data not shown). Therefore, the SSRs developed here would be informative at the level of within-species variation, and may be useful even in other Brassicaceae species.

Another aspect of usage of SSRs is for mapping study. We were able to map approximately one third of the applied SSRs on the radish map (Fig. 1, arrows). This ratio was similar to those of the mapping studies in Brassica species (Cheng et al. 2009, Kim et al. 2009, Li et al. 2011). Because the present map was integrated to the radish chromosome number (n = 9), the map location of radish-specific SSRs would be useful for comparison of the radish linkage maps in the previous and future studies. Further mapping of the radish SSRs will enable us to construct a denser, SSR-based radish map and to detect agronomically important loci. However, this is beyond scope of the present study that focused on the development of hundreds of radish SSRs and their evaluation. In conclusion, the radish SSRs developed here would provide the useful tools for genetic analysis in radish and its related species.

Supplementary Data

61-4-413suppl.pdf (73.4KB, pdf)

Acknowledgments

We thank Dr. H. Tsukazaki, the National Institute of Vegetable and Tea Science, Tsu, Japan, for providing the rat-tail radish, Dr. T. Nunome for helpful advice on the SSR-enriched library construction, Dr. S. Matsumoto for providing B. rapa SSR information, Dr. H. Budahn and Dr. T. Ohsako for valuable comments, and Ms. H. Kasaoka for technical assistance. This work was partly supported by the Program for Promotion of Basic and Applied Research for Innovations in the Bio-oriented Industry (BRAIN) and an ACTR grant from Kyoto Prefectural University to M.H.

Literature Cited

  1. Aggarwal RK, Hendre PS, Varshney RK, Bhat PR, Krishnakumar V, Singh L. Identification, characterization and utilization of EST-derived genic microsatellite markers for genome analyses of coffee and related species. Theor Appl Genet. 2007;114:359–372. doi: 10.1007/s00122-006-0440-x. [DOI] [PubMed] [Google Scholar]
  2. Anderson JA, Churchill GA, Autrique JE, Tanksley SD, Sorrells ME. Optimizing parental selection for genetic linkage maps. Genome. 1993;36:181–186. doi: 10.1139/g93-024. [DOI] [PubMed] [Google Scholar]
  3. Banga O. Radish. In: Simmonds NW, editor. Evolution of Crop Plants. Longman; London: 1976. pp. 60–62. [Google Scholar]
  4. Bett KE, Lydiate DJ. Genetic analysis and genome mapping in Raphanus. Genome. 2003;46:423–430. doi: 10.1139/g03-026. [DOI] [PubMed] [Google Scholar]
  5. Blair MW, Giraldo MC, Buendia HF, Tovar E, Duque MC, Beede SE. Microsatellite marker diversity in common bean (Phaselous vulgaris L.) Theor Appl Genet. 2006;113:100–109. doi: 10.1007/s00122-006-0276-4. [DOI] [PubMed] [Google Scholar]
  6. Budahn H, Peterka H, Mousa MA, Ding Y, Zhang S, Li J. Molecular mapping in oil radish (Raphanus sativus L.) and QTL analysis of resistance against beet cyst nematode (Heterodera schachtii) Theor Appl Genet. 2009;118:775–782. doi: 10.1007/s00122-008-0937-6. [DOI] [PubMed] [Google Scholar]
  7. Cheng X, Xu J, Xia S, Gu J, Yang Y, Fu J, Qian X, Zhang S, Wu J, Liu K. Development and genetic mapping of micro-satellite markers from genome survey sequences in Brassica napus. Theor Appl Genet. 2009;118:1121–1131. doi: 10.1007/s00122-009-0967-8. [DOI] [PubMed] [Google Scholar]
  8. Fukino N, Yoshioka Y, Kubo N, Hirai M, Sugiyama M, Sakata, Y, Matsumoto S. Development of 101 novel SSR markers and construction of an SSR-based genetic linkage map in cucumber (Cucumis sativus L.) Breed Sci. 2008;58:475–483. [Google Scholar]
  9. Hirai M, Yoshimura S, Ohosako T, Kubo N. Genetic diversity and phylogenetic relationships of the endangered species Vaccinium sieboldii and V. ciliatum (Ericaceae) Plant Sys Evol. 2010;287:75–84. [Google Scholar]
  10. Johnston JS, Pepper AE, Hall AE, Chen ZJ, Hodnett G, Drabek J, Lopez R, Price HJ. Evolution of genome size in Brassicaceae. Ann Bot. 2005;95:229–235. doi: 10.1093/aob/mci016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Jones N, Ougham H, Thomas H, Pasakinskiene I. Markers and mapping revisited: finding your gene. New Phytol. 2009;183:935–966. doi: 10.1111/j.1469-8137.2009.02933.x. [DOI] [PubMed] [Google Scholar]
  12. Kamei A, Tsuro M, Kubo N, Hayashi T, Wang N, Fujimura T, Hirai M. QTL mapping of clubroot resistance in radish (Raphanus sativus L.) Theor Appl Genet. 2010;120:1021–1027. doi: 10.1007/s00122-009-1230-z. [DOI] [PubMed] [Google Scholar]
  13. Kaneko Y, Kimizuka-Takagi C, Bang SW, Matsuzawa Y. Radish. Genome Mapping and Molecular Breeding in Plants. In: Kole C, editor. Vegetables. Vol. 5. Springer; Berlin Heidelberg: 2007. pp. 141–160. [Google Scholar]
  14. Kim H, Choi SR, Bae J, Hong CP, Lee SY, Hossain MJ, Van Nguyen D, Jin M, Park BS, Bang JW, et al. Sequenced BAC anchored reference genetic map that reconciles the ten individual chromosomes of Brassica rapa. BMC Genomics. 2009;10:432. doi: 10.1186/1471-2164-10-432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kitamura S. Varieties and transitions of radish. In: Nishiyama I, editor. Japanese Radish. Jpn Sci Soc; Tokyo: 1958. pp. 1–19. [Google Scholar]
  16. Kosambi DD. The estimation of map distance from recombination values. Ann Eugen. 1944;12:172–175. [Google Scholar]
  17. Kubo N, Hirai M, Kaneko A, Tanaka D, Kasumi K. Development and characterization of simple sequence repeat (SSR) markers in the water lotus (Nelumbo nucifera) Aquat Bot. 2009;90:191–194. [Google Scholar]
  18. Li H, Chen X, Yang Y, Xu J, Gu J, Fu J, Qian X, Zhang S, Wu J, Liu K. Development and genetic mapping of microsatellite markers from whole genome shotgun sequences in Brassica oleracea. Mol. Breed. 2011 doi: 10.1007/s00122-009-0967-8. (in press) [DOI] [PubMed] [Google Scholar]
  19. Niikura S, Matsuura S. Identification of self-incompatibility alleles (S) by PCR-RFLP in radish (Raphanus sativus L.) Euphytica. 1998;102:379–384. [Google Scholar]
  20. Nunome T, Negoro S, Miyatake K, Yamaguchi H, Fukuoka H. A protocol for the construction of microsatellite enriched genomic library. Plant Mol Biol Rep. 2006;24:305–312. [Google Scholar]
  21. Ohsako T, Hirai M, Yamabuki M. Spatial structure of microsatellite variability within and among populations of wild radish Raphanus sativus L. var. hortensis Backer f. raphanistroides Makino (Brassicaceae) in Japan. Breed Sci. 2010;60:195–202. [Google Scholar]
  22. Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press; Totowa, N.J: 2000. pp. 365–386. [DOI] [PubMed] [Google Scholar]
  23. Saito M, Kubo N, Matsumoto S, Suwabe K, Tsukada M, Hirai M. Fine mapping of the clubroot resistance gene, Crr3, in Brassica rapa. Theor Appl Genet. 2006;114:81–91. doi: 10.1007/s00122-006-0412-1. [DOI] [PubMed] [Google Scholar]
  24. Song QJ, Shi JR, Singh S, Fickus EW, Costa JM, Lewis J, Gill BS, Ward R, Cregan PB. Development and mapping of microsatellite (SSR) markers in wheat. Theor Appl Genet. 2005;110:550–560. doi: 10.1007/s00122-004-1871-x. [DOI] [PubMed] [Google Scholar]
  25. Suwabe K, Iketani H, Nunome T, Kage T, Hirai M. Isolation and characterization of microsatellites in Brassica rapa L. Theor Appl Genet. 2002;104:1092–1098. doi: 10.1007/s00122-002-0875-7. [DOI] [PubMed] [Google Scholar]
  26. Suwabe K, Tsukada H, Iketani H, Hatakeyama K, Kondo M, Fujimura M, Nunome T, Fukuoka H, Hirai M, Matsumoto S. Simple sequence repeat-based comparative genomics between Brassica rapa and Arabidopsis thaliana: the genetic origin of clubroot resistance. Genetics. 2006;173:309–319. doi: 10.1534/genetics.104.038968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Tsukazaki H, Honjo M, Yamashita K, Ohara T, Kojima A, Ohsawa R, Wako T. Classification and identification of bunching onion (Allium fistulosum) varieties based on SSR markers. Breed Sci. 2010;60:139–152. [Google Scholar]
  28. Tsuro M, Suwabe K, Kubo N, Matsumoto S, Hirai M. Construction of a linkage map of radish (Raphanus sativus L.), based on AFLP and Brassica-SSR markers. Breed Sci. 2005;55:107–111. [Google Scholar]
  29. Tsuro M, Suwabe K, Kubo N, Matsumoto S, Hirai M. Mapping of QTLs controlling for root shape and red pigmentation in radish, Raphanus sativus L. Breed Sci. 2008;58:55–61. [Google Scholar]
  30. Van Ooijen JW, Voorrips RE. JoinMap Version 30, Software for the Calculation of Genetic Linkage Maps. Plant Research International; Wageningen: 2001. [Google Scholar]
  31. Wang N, Hu J, Ohsawa R, Ohta M, Fujimura T. Identification and characterization of microsatellite markers derived from expressed sequence tags (ESTs) of radish (Raphanus sativus L.) Mol. Ecol Notes. 2007;7:503–506. [Google Scholar]
  32. Yamane K, Lü N, Ohnishi O. Multiple origins and high genetic diversity of cultivated radish inferred from polymorphism in chloroplast simple sequence repeats. Breed Sci. 2009;59:55–65. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

61-4-413suppl.pdf (73.4KB, pdf)

Articles from Breeding Science are provided here courtesy of Japanese Society of Breeding

RESOURCES