Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1985 Feb 25;13(4):1073–1088. doi: 10.1093/nar/13.4.1073

Variability within the rabbit C repeats and sequences shared with other SINES.

R C Hardison, R Printz
PMCID: PMC341057  PMID: 4000935

Abstract

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.

Full text

PDF

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Adams J. W., Kaufman R. E., Kretschmer P. J., Harrison M., Nienhuis A. W. A family of long reiterated DNA sequences, one copy of which is next to the human beta globin gene. Nucleic Acids Res. 1980 Dec 20;8(24):6113–6128. doi: 10.1093/nar/8.24.6113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ariga H. Replication of cloned DNA containing the Alu family sequence during cell extract-promoting simian virus 40 DNA synthesis. Mol Cell Biol. 1984 Aug;4(8):1476–1482. doi: 10.1128/mcb.4.8.1476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barta A., Richards R. I., Baxter J. D., Shine J. Primary structure and evolution of rat growth hormone gene. Proc Natl Acad Sci U S A. 1981 Aug;78(8):4867–4871. doi: 10.1073/pnas.78.8.4867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bennett K. L., Hill R. E., Pietras D. F., Woodworth-Gutai M., Kane-Haas C., Houston J. M., Heath J. K., Hastie N. D. Most highly repeated dispersed DNA families in the mouse genome. Mol Cell Biol. 1984 Aug;4(8):1561–1571. doi: 10.1128/mcb.4.8.1561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cameron J. R., Loh E. Y., Davis R. W. Evidence for transposition of dispersed repetitive DNA families in yeast. Cell. 1979 Apr;16(4):739–751. doi: 10.1016/0092-8674(79)90090-4. [DOI] [PubMed] [Google Scholar]
  6. Cech T. R., Hearst J. E. Organization of highly repeated sequences in mouse main-band DNA. J Mol Biol. 1976 Jan 25;100(3):227–256. doi: 10.1016/s0022-2836(76)80061-7. [DOI] [PubMed] [Google Scholar]
  7. Cheng J. F., Printz R., Callaghan T., Shuey D., Hardison R. C. The rabbit C family of short, interspersed repeats. Nucleotide sequence determination and transcriptional analysis. J Mol Biol. 1984 Jun 15;176(1):1–20. doi: 10.1016/0022-2836(84)90379-6. [DOI] [PubMed] [Google Scholar]
  8. Ciliberto G., Castagnoli L., Cortese R. Transcription by RNA polymerase III. Curr Top Dev Biol. 1983;18:59–88. doi: 10.1016/s0070-2153(08)60579-7. [DOI] [PubMed] [Google Scholar]
  9. Davidson E. H., Hough B. R., Amenson C. S., Britten R. J. General interspersion of repetitive with non-repetitive sequence elements in the DNA of Xenopus. J Mol Biol. 1973 Jun 15;77(1):1–23. doi: 10.1016/0022-2836(73)90359-8. [DOI] [PubMed] [Google Scholar]
  10. Di Nocera P. P., Digan M. E., Dawid I. B. A family of oligo-adenylate-terminated transposable sequences in Drosophila melanogaster. J Mol Biol. 1983 Aug 25;168(4):715–727. doi: 10.1016/s0022-2836(83)80071-0. [DOI] [PubMed] [Google Scholar]
  11. DiGiovanni L., Haynes S. R., Misra R., Jelinek W. R. Kpn I family of long-dispersed repeated DNA sequences of man: evidence for entry into genomic DNA of DNA copies of poly(A)-terminated Kpn I RNAs. Proc Natl Acad Sci U S A. 1983 Nov;80(21):6533–6537. doi: 10.1073/pnas.80.21.6533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Eden F. C., Graham D. E., Davidson E. H., Britten R. J. Exploration of long and short repetitive sequence relationships in the sea urchin genome. Nucleic Acids Res. 1977;4(5):1553–1567. doi: 10.1093/nar/4.5.1553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fanning T. G. Size and structure of the highly repetitive BAM HI element in mice. Nucleic Acids Res. 1983 Aug 11;11(15):5073–5091. doi: 10.1093/nar/11.15.5073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gebhard W., Meitinger T., Höchtl J., Zachau H. G. A new family of interspersed repetitive DNA sequences in the mouse genome. J Mol Biol. 1982 May 25;157(3):453–471. doi: 10.1016/0022-2836(82)90471-5. [DOI] [PubMed] [Google Scholar]
  15. Genbauffe F. S., Chisholm G. E., Cooper T. G. Tau, sigma, and delta. A family of repeated elements in yeast. J Biol Chem. 1984 Aug 25;259(16):10518–10525. [PubMed] [Google Scholar]
  16. Hardison R. C., Butler E. T., 3rd, Lacy E., Maniatis T., Rosenthal N., Efstratiadis A. The structure and transcription of four linked rabbit beta-like globin genes. Cell. 1979 Dec;18(4):1285–1297. doi: 10.1016/0092-8674(79)90239-3. [DOI] [PubMed] [Google Scholar]
  17. Haynes S. R., Toomey T. P., Leinwand L., Jelinek W. R. The Chinese hamster Alu-equivalent sequence: a conserved highly repetitious, interspersed deoxyribonucleic acid sequence in mammals has a structure suggestive of a transposable element. Mol Cell Biol. 1981 Jul;1(7):573–583. doi: 10.1128/mcb.1.7.573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hess J. F., Fox M., Schmid C., Shen C. K. Molecular evolution of the human adult alpha-globin-like gene region: insertion and deletion of Alu family repeats and non-Alu DNA sequences. Proc Natl Acad Sci U S A. 1983 Oct;80(19):5970–5974. doi: 10.1073/pnas.80.19.5970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jagadeeswaran P., Forget B. G., Weissman S. M. Short interspersed repetitive DNA elements in eucaryotes: transposable DNA elements generated by reverse transcription of RNA pol III transcripts? Cell. 1981 Oct;26(2 Pt 2):141–142. doi: 10.1016/0092-8674(81)90296-8. [DOI] [PubMed] [Google Scholar]
  20. Jelinek W. R., Toomey T. P., Leinwand L., Duncan C. H., Biro P. A., Choudary P. V., Weissman S. M., Rubin C. M., Houck C. M., Deininger P. L. Ubiquitous, interspersed repeated sequences in mammalian genomes. Proc Natl Acad Sci U S A. 1980 Mar;77(3):1398–1402. doi: 10.1073/pnas.77.3.1398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kalb V. F., Glasser S., King D., Lingrel J. B. A cluster of repetitive elements within a 700 base pair region in the mouse genome. Nucleic Acids Res. 1983 Apr 11;11(7):2177–2184. doi: 10.1093/nar/11.7.2177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Krayev A. S., Kramerov D. A., Skryabin K. G., Ryskov A. P., Bayev A. A., Georgiev G. P. The nucleotide sequence of the ubiquitous repetitive DNA sequence B1 complementary to the most abundant class of mouse fold-back RNA. Nucleic Acids Res. 1980 Mar 25;8(6):1201–1215. doi: 10.1093/nar/8.6.1201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Krayev A. S., Markusheva T. V., Kramerov D. A., Ryskov A. P., Skryabin K. G., Bayev A. A., Georgiev G. P. Ubiquitous transposon-like repeats B1 and B2 of the mouse genome: B2 sequencing. Nucleic Acids Res. 1982 Dec 11;10(23):7461–7475. doi: 10.1093/nar/10.23.7461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lacy E., Hardison R. C., Quon D., Maniatis T. The linkage arrangement of four rabbit beta-like globin genes. Cell. 1979 Dec;18(4):1273–1283. doi: 10.1016/0092-8674(79)90238-1. [DOI] [PubMed] [Google Scholar]
  25. Lemischka I., Sharp P. A. The sequences of an expressed rat alpha-tubulin gene and a pseudogene with an inserted repetitive element. Nature. 1982 Nov 25;300(5890):330–335. doi: 10.1038/300330a0. [DOI] [PubMed] [Google Scholar]
  26. Lerman M. I., Thayer R. E., Singer M. F. Kpn I family of long interspersed repeated DNA sequences in primates: polymorphism of family members and evidence for transcription. Proc Natl Acad Sci U S A. 1983 Jul;80(13):3966–3970. doi: 10.1073/pnas.80.13.3966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lueders K. K., Kuff E. L. Intracisternal A-particle genes: identification in the genome of Mus musculus and comparison of multiple isolates from a mouse gene library. Proc Natl Acad Sci U S A. 1980 Jun;77(6):3571–3575. doi: 10.1073/pnas.77.6.3571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Maxam A. M., Gilbert W. A new method for sequencing DNA. Proc Natl Acad Sci U S A. 1977 Feb;74(2):560–564. doi: 10.1073/pnas.74.2.560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Maxam A. M., Gilbert W. Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 1980;65(1):499–560. doi: 10.1016/s0076-6879(80)65059-9. [DOI] [PubMed] [Google Scholar]
  30. Miyake T., Migita K., Sakaki Y. Some KpnI family members are associated with the Alu family in the human genome. Nucleic Acids Res. 1983 Oct 11;11(19):6837–6846. doi: 10.1093/nar/11.19.6837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Moyzis R. K., Bonnet J., Li D. W., Ts'o P. O. An alternative view of mammalian DNA sequence organization. II. Short repetitive sequences are organized into scrambled tandem clusters in Syrian hamster DNA. J Mol Biol. 1981 Dec 25;153(4):871–896. doi: 10.1016/0022-2836(81)90457-5. [DOI] [PubMed] [Google Scholar]
  32. Perez-Stable C., Ayres T. M., Shen C. K. Distinctive sequence organization and functional programming of an Alu repeat promoter. Proc Natl Acad Sci U S A. 1984 Sep;81(17):5291–5295. doi: 10.1073/pnas.81.17.5291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Potter S. S. DNA sequence of a foldback transposable element in Drosophila. Nature. 1982 May 20;297(5863):201–204. doi: 10.1038/297201a0. [DOI] [PubMed] [Google Scholar]
  34. Reddy V. B., Thimmappaya B., Dhar R., Subramanian K. N., Zain B. S., Pan J., Ghosh P. K., Celma M. L., Weissman S. M. The genome of simian virus 40. Science. 1978 May 5;200(4341):494–502. doi: 10.1126/science.205947. [DOI] [PubMed] [Google Scholar]
  35. Rogers J. A straight LINE story. Nature. 1983 Nov 10;306(5939):113–114. doi: 10.1038/306113a0. [DOI] [PubMed] [Google Scholar]
  36. Sawada I., Beal M. P., Shen C. K., Chapman B., Wilson A. C., Schmid C. Intergenic DNA sequences flanking the pseudo alpha globin genes of human and chimpanzee. Nucleic Acids Res. 1983 Nov 25;11(22):8087–8101. doi: 10.1093/nar/11.22.8087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Schimenti J. C., Duncan C. H. Ruminant globin gene structures suggest an evolutionary role for Alu-type repeats. Nucleic Acids Res. 1984 Feb 10;12(3):1641–1655. doi: 10.1093/nar/12.3.1641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Schmid C. W., Jelinek W. R. The Alu family of dispersed repetitive sequences. Science. 1982 Jun 4;216(4550):1065–1070. doi: 10.1126/science.6281889. [DOI] [PubMed] [Google Scholar]
  39. Schon E. A., Cleary M. L., Haynes J. R., Lingrel J. B. Structure and evolution of goat gamma-, beta C- and beta A-globin genes: three developmentally regulated genes contain inserted elements. Cell. 1981 Dec;27(2 Pt 1):359–369. doi: 10.1016/0092-8674(81)90419-0. [DOI] [PubMed] [Google Scholar]
  40. Shafit-Zagardo B., Brown F. L., Zavodny P. J., Maio J. J. Transcription of the KpnI families of long interspersed DNAs in human cells. Nature. 1983 Jul 21;304(5923):277–280. doi: 10.1038/304277a0. [DOI] [PubMed] [Google Scholar]
  41. Shen C. K., Maniatis T. The organization of repetitive sequences in a cluster of rabbit beta-like globin genes. Cell. 1980 Feb;19(2):379–391. doi: 10.1016/0092-8674(80)90512-7. [DOI] [PubMed] [Google Scholar]
  42. Singer M. F. SINEs and LINEs: highly repeated short and long interspersed sequences in mammalian genomes. Cell. 1982 Mar;28(3):433–434. doi: 10.1016/0092-8674(82)90194-5. [DOI] [PubMed] [Google Scholar]
  43. Singer M. F., Thayer R. E., Grimaldi G., Lerman M. I., Fanning T. G. Homology between the KpnI primate and BamH1 (M1F-1) rodent families of long interspersed repeated sequences. Nucleic Acids Res. 1983 Aug 25;11(16):5739–5745. doi: 10.1093/nar/11.16.5739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Spradling A. C., Rubin G. M. Drosophila genome organization: conserved and dynamic aspects. Annu Rev Genet. 1981;15:219–264. doi: 10.1146/annurev.ge.15.120181.001251. [DOI] [PubMed] [Google Scholar]
  45. Sun L., Paulson K. E., Schmid C. W., Kadyk L., Leinwand L. Non-Alu family interspersed repeats in human DNA and their transcriptional activity. Nucleic Acids Res. 1984 Mar 26;12(6):2669–2690. doi: 10.1093/nar/12.6.2669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Suske G., Wenz M., Cato A. C., Beato M. The uteroglobin gene region: hormonal regulation, repetitive elements and complete nucleotide sequence of the gene. Nucleic Acids Res. 1983 Apr 25;11(8):2257–2271. doi: 10.1093/nar/11.8.2257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Van Arsdell S. W., Denison R. A., Bernstein L. B., Weiner A. M., Manser T., Gesteland R. F. Direct repeats flank three small nuclear RNA pseudogenes in the human genome. Cell. 1981 Oct;26(1 Pt 1):11–17. doi: 10.1016/0092-8674(81)90028-3. [DOI] [PubMed] [Google Scholar]
  48. Voliva C. F., Jahn C. L., Comer M. B., Hutchison C. A., 3rd, Edgell M. H. The L1Md long interspersed repeat family in the mouse: almost all examples are truncated at one end. Nucleic Acids Res. 1983 Dec 20;11(24):8847–8859. doi: 10.1093/nar/11.24.8847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Watanabe Y., Tsukada T., Notake M., Nakanishi S., Numa S. Structural analysis of repetitive DNA sequences in the bovine corticotropin-beta-lipotropin precursor gene region. Nucleic Acids Res. 1982 Mar 11;10(5):1459–1469. doi: 10.1093/nar/10.5.1459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Witney F. R., Furano A. V. Highly repeated DNA families in the rat. J Biol Chem. 1984 Aug 25;259(16):10481–10492. [PubMed] [Google Scholar]
  51. Yang R. C., Wu R. BK virus DNA: complete nucleotide sequence of a human tumor virus. Science. 1979 Oct 26;206(4417):456–462. doi: 10.1126/science.228391. [DOI] [PubMed] [Google Scholar]
  52. Zweig S. E. Analysis of large nucleic acid dot matrices on small computers. Nucleic Acids Res. 1984 Jan 11;12(1 Pt 2):767–776. doi: 10.1093/nar/12.1part2.767. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES