Improvement of FK506 Production in Streptomyces tsukubaensis by Genetic Enhancement of the Supply of Unusual Polyketide Extender Units via Utilization of Two Distinct Site-Specific Recombination Systems

Abstract

FK506 is a potent immunosuppressant that has a wide range of clinical applications. Its 23-member macrocyclic scaffold, mainly with a polyketide origin, features two methoxy groups at C-13 and C-15 and one allyl side chain at C-21, due to the region-specific incorporation of two unusual extender units derived from methoxymalonyl-acyl carrier protein (ACP) and allylmalonyl-coenzyme A (CoA), respectively. Whether their intracellular formations can be a bottleneck for FK506 production remains elusive. In this study, we report the improvement of FK506 yield in the producing strain Streptomyces tsukubaensis by the duplication of two sets of pathway-specific genes individually encoding the biosyntheses of these two extender units, thereby providing a promising approach to generate high-FK506-producing strains via genetic manipulation. Taking advantage of the fact that S. tsukubaensis is amenable to two actinophage (ΦC31 and VWB) integrase-mediated recombination systems, we genetically enhanced the biosyntheses of methoxymalonyl-ACP and allylmalonyl-CoA, as indicated by transcriptional analysis. Together with the optimization of glucose supplementation, the maximal FK506 titer eventually increased by approximately 150% in comparison with that of the original strain. The strategy of engineering the biosynthesis of unusual extender units described here may be applicable to improving the production of other polyketide or nonribosomal peptide natural products that contain pathway-specific building blocks.

INTRODUCTION

FK506 (tacrolimus), isolated from a variety of soil Streptomyces species, is a natural product with potent immunosuppressive activity. FK506 interacts with a receptor known as FK506-binding protein 12 (FKBP12); the FK506-FKBP12 complex then acts on a target protein, calcineurin, by inhibiting its Ser/Thr phosphatase activity. This leads to the arrest of T cell proliferation at the G₀-G₁ stage (18). As a consequence, FK506 has been clinically approved as an immunosuppressant to prevent the rejection of transplanted organs and for the treatment of various inflammatory diseases. Recently, other promising biological activities, such as neuroprotection and regeneration, were reported (9, 31), creating significant interest in the further development of FK506 for different medicinal uses.

FK506 biosynthesis involves a hybrid polyketide synthase (PKS)-nonribosomal peptide synthetase (NRPS) system, in line with the fact that the corresponding structure belongs to an amide bond-containing macrolide family with members that include its naturally occurring analogues FK520 and rapamycin (21, 22, 28, 35). FkbA to FkbC, constituting a typical type I PKS system, have functional domains that are organized colinearly with their activities in the biosynthetic assembly process: each module normally consists of ketoacylsynthase (KS), acyltransferase (AT), and acyl carrier protein (ACP) for chain elongation and optionally contains dehydratase (DH), enoylreductase (ER), and ketoreductase (KR) for reductively processing β-keto (oxidation state of beta-C in the growing polyketide chain) functionality. These PKSs are responsible for the construction of the main backbone of FK506 by catalyzing 10 two-carbon extensions from a chorismate-derived starter unit (2). An unnatural amino acid residue, l-pipecolate, terminates the resulting polyketide intermediate with an amide bond (7), whose formation is catalyzed by the NRPS FkbP, which subsequently closes the 23-member macrocyclic core via intramolecular lactonization (8). Besides malonyl-coenzyme A (M-CoA) and methylmalonyl (MM)-CoA, which often serve as common substrates of typical type I PKSs for elongation, the PKSs in FK506 biosynthesis feature the incorporation of two unusual extender units derived from methoxymalonyl (MOM)-ACP and allylmalonyl (AM)-CoA into the polyketide skeleton to produce two methoxy groups at C-13 and C-15 and one allyl side chain at C-21, respectively (Fig. 1A).

Fig 1.

Chemical structures of FK506 and FK520, the FK506 biosynthetic gene cluster in S. tsukubaensis, and the biosynthetic pathways of MOM-ACP and AM-CoA. (A) Structures of FK506 and its analogue, FK520. The polyketide skeletons consist of two methoxy groups at C-13 and C-15, while the allyl side chain at C-21 of FK506 is replaced by an ethyl group in FK520. The FK506 macrocyclic scaffolds derived from MOM-ACP and AM-CoA are shown in red and blue, respectively. (B) Schematic representation of the FK506 biosynthetic gene cluster in S. tsukubaensis. Genes involved in the biosyntheses of MOM-ACP and AM-CoA are shown in red and blue, respectively. (C) Biosynthetic pathways of MOM-ACP and AM-CoA, catalyzed by FkbG-K and TcsA-D, respectively. DHCHC, which stands for (4R,5R)-4,5-dihydroxycyclohex-1-enecarboxylic acid, is the chorismate-derived starter unit.

The entire biosynthetic gene cluster of FK506 has recently been characterized from several FK506-producing streptomycete strains (20), which shows that the formation of the unusual building blocks MOM-ACP and AM-CoA requires two sets of independent, pathway-specific genes (Fig. 1B and C). The first five contiguous genes, fkbGHIJK, with an organization identical to that of the FK520 biosynthetic gene cluster, were proposed to encode MOM-ACP generation, a process that starts with the utilization of 1,3-biphosphoglycerate (1,3-BPG) as the substrate. FkbH, which has both AT and phosphatase activities, is responsible for loading glyceroyl onto FkbJ, a discrete ACP protein, to produce glyceroyl-ACP for sequential elaborate modifications by two dehydrogenases, FkbK and FkbI, and an O-methyltransferase, FkbG, to furnish the MOM-ACP unit (4, 14). In contrast, the second set of four contiguous genes, tcsABCD, identified from the FK506 biosynthetic gene cluster are unique, and more recently, their deduced products have been confirmed to form a noncanonical discrete PKS system to catalyze AM-CoA formation in coordination with the fatty acid synthase (FAS) pathway. Functioning as a priming KS, the propionyl-acylated TcsB catalyzes the condensation of the propyl moiety with malonate loaded on TcsA, an AT-ACP bidomain protein, to form an ACP-tethered β-keto-pentanoate, which may then be converted into trans-2-pentenyl-ACP by involving the KR and DH activities of FAS of the host. Further modifications of the pentenyl group, including reductive carboxylation by TcsC in a manner similar to that of crotonyl-CoA carboxylase/reductase (CCR) (17), as well as dehydrogenation by the FAD-dependent enzyme TcsD, form the ACP-tethered allylmalonate, which is likely released as AM-CoA, an unprecedented extender unit for the FK506 assembly PKS system to build the side chain as allyl (10, 20).

Recent progress in understanding the biosyntheses of MOM-ACP and AM-CoA opens the door to improve FK506 production by intracellular enrichment of the precursor supply. To achieve this, genetic manipulations have frequently been used, including phage integrase-mediated recombination. The integrase recognizes the bacterial attB site, where a conservative and reciprocal exchange (involving a cleavage and subsequent recombination process) takes place with the phage attP site of the introduced DNA to form the hybrid sequences attL and attR (6). In this study, we exploited the sequence information regarding the phage attachment sites in the FK506 producer Streptomyces tsukubaensis ZJU01, showing that two distinct site-specific recombinations, based on the ΦC31 and VWB integration systems, respectively, are operable and have no apparent effect on FK506 production. Based on this, we report the introduction of additional copies of the pathway-specific genes into S. tsukubaensis at the selected attB loci on the chromosome, aiming at improvement of FK506 production by genetic enhancement of the biosyntheses of the unusual building blocks MOM-ACP and AM-CoA.

MATERIALS AND METHODS

Bacterial strains, plasmids, and reagents.

The bacterial strains and plasmids used in this study are summarized in Table 1. The primer sequences are listed in Table 2. The biochemicals, chemicals, media, restriction enzymes, and other molecular biological reagents were purchased from standard commercial sources unless otherwise stated.

Table 1.

Bacterial strains and plasmids used and constructed in this study

Strains/plasmids	Characteristic(s)	Source/reference
E. coli
DH5α	Host for general cloning	Invitrogen
ET12567(pUZ8002)	Donor strain for conjugation between E. coli and Streptomyces	15
BW25113 (pIJ790)	Host for Red/ET-mediated PCR-targeted mutagenesis	11
S. tsukubaensis
ZJU01	Original FK506-producing strain	CGMCCa 51771
FL101	Derivative of ZJU01 containing pSET152 integrated by the ΦC31 integrase-mediated recombination	This study
FL102	Derivative of ZJU01 containing pSOK804 integrated by the VWB integrase-mediated recombination	This study
FL103	Derivative of ZJU01 containing pFL103 integrated by the ΦC31 integrase-mediated recombination with the genotype of PermE*-fkbGKJIH	This study
FL104	Derivative of ZJU01 containing pFL104 integrated by the ΦC31 integrase-mediated recombination with the genotype of PermE*-tcsABCD	This study
FL105	Derivative of FL101 containing pTA804 integrated by the VWB integrase-mediated recombination	This study
FL106	Derivative of FL103 containing pFL106 integrated by the VWB integrase-mediated recombination with the genotype of PermE*-tcsABCD	This study
FL107	Derivative of FL104 containing pFL107 integrated by the VWB integrase-mediated recombination with the genotype of PermE*-fkbGKJIH	This study
Plasmids
pMD18-T simple	E. coli subcloning vector	TaKaRa
pSET152	E. coli-Streptomyces shuttle vector containing the aac(3)IV gene and the ΦC31 attP site and integrase gene	3
pSOK804	E. coli-Streptomyces shuttle vector containing the aac(3)IV gene and the VWB attP site and integrase gene	29
pWHM79	pGEM3zf derivative carrying a 0.5-kb fragment containing the ermE* promoter	30
pTA804	pSOK804 derivative replacing the aac(3)IV gene with the bla and tsr genes	This study
pMD-G	pMD18-T derivative carrying fkbG without its terminator	This study
pMD-HIJK	pMD18-T derivative carrying fkbHIJK with its terminator	This study
pMOM	pMD18-T derivative carrying fkbG-fkbK-fkbJ-fkbI-fkbH	This study
pAM	pMD18-T derivative carrying tcsA-tcsB-tcsC-tcsD	This study
pFL103	pSET152 derivative for the PermE*-controlled expression of fkbG-fkbK-fkbJ-fkbI-fkbH	This study
pFL104	pSET152 derivative for the PermE*-controlled expression of tcsA-tcsB-tcsC-tcsD	This study
pFL106	pTA804 derivative for the PermE*-controlled expression of tcsA-tcsB-tcsC-tcsD	This study
pFL107	pTA804 derivative for the PermE*-controlled expression of fkbG-fkbK-fkbJ-fkbI-fkbH	This study

^aCGMCC, China General Microbiological Culture Collection.

Table 2.

Primers used for gene cloning, genotype verification, and RT-PCR amplification in this study

Name	Sequencea	Description
p151Redf	gtgcaatacgaatggcgaaaagccgagctcatcggtcagTTACCAATGCTTAATCAGTG	Cloning of the bla and tsr genes from pSET151 for Red/ET-mediated recombination
p151Redr	tcagccaatcgactggcgagcggcatcgcattcttcgcaTTATCGGTTGGCCGCGAGAT
pGf	TAAGCTTCGAGGCGCCGCTGGACCGTGTGG (HindIII)	Cloning of the fkbG gene without its terminator from ZJU01 genome
pGr	TTCTAGACGTTCACCGCTTCCGCAACAAGG (XbaI)
pHIJKf	TACTAGTGGCAGCGCCTTCGCCGACCACATC (SpeI)	Cloning of the fkbHIJK genes with their terminator from ZJU01 genome
pHIJKr	TTCTAGACAATGCGGGGCTGCGCGACGACG (XbaI)
pABCDf	TAAGCTTCCATCCCGATCATGCCCCTCCTG (HindIII)	Cloning of the tcsABCD genes with their terminator from ZJU01 genome
pABCDr	TTCTAGAAGGCCCTGACGCGGGACTGACC (XbaI)
ATTB1	CGGGATCCGACCC(G/C)TTCATCATGATGGAC	Degenerate primer pair from reference 5 to identify the ΦC31 attB sites
ATTB2	TGGAATTCAGGTT(G/C)ACCCA(C/G)AGCTG(G/C)AG
pL-C31f	CCCACAGCTGGAGGCCGTGG	Verification of the hybrid attL site from the ΦC31-based recombination
pL-C31r	CAGGGCGAGCAATTCCGAGA
pR-C31f	CAGAGCAGGATTCCCGTTGAG	Verification of the hybrid attR site from the ΦC31-based recombination
pR-C31r	CCCTTCATCATGATGGACCAG
pL-VWBf	GCCTTCGTAGCTCAGGGGATAGAG	Verification of the hybrid attL site from the VWB-based recombination
pL-VWBr	CGCCGCCGCCTTTTCCTCAATCG
p152f	GTAACGCCAGGGTTTTCCCAGTCACG	Verification of pSET152-based gene duplication at the ΦC31 attB site
p152r	TCCGGCTCGTATGTTGTGTGGAATTG
p804f	AGCAGGCGTTCCTCGGCGTCCTCGT	Verification of pTA804-based gene duplication at the VWB attB site
p804r	AGCTCACTCATTAGGCACCCCAGGC
pMOMf	CTCCCAGTACGGCCTGCCCACCTCC	Verification of gene duplication for the MOM-ACP biosynthetic pathway
pMOMr	TGCGCTCCCTGGACCTGAGAATGACG
pAMf	GAAGCGCTCCCGGGGCGCGGATATC	Verification of gene duplication for the AM-CoA biosynthetic pathway
pAMr	CAATGGGCTGCGGCTGCTGGAGATC
pRTGf	CTGGGCGGTCTGCGGGCGGAGTCG	RT-PCR amplification of a 102-bp fkbG fragment representing the fkbG mRNA level
pRTGr	GGTCAACCGCACCAGGAATTCCAG
pRTKf	GCGGACCTCATCGGCATCGACAAC	RT-PCR amplification of a 102-bp fkbK fragment representing the fkbHIJK mRNA level
pRTKr	CTTGGTGAGGAGCAGGTCGCAGGG
pRTAf	GGCGTCTTCGCCGGTCTGGGTGCC	RT-PCR amplification of a 106-bp tcsA fragment representing the tcsABCD mRNA level
pRTAr	GAAGCGGCCGGACCGGCTTCAGCC
pRTDf	GTGCCGGGGGACAACGCGCTGAAC	RT-PCR amplification of a 103-bp tcsD fragment representing the tcsABCD mRNA level
pRTDr	GGGCGACACCCAGAGCGGATGCGG
pRTPf	CAGATGCTGCACTCGCACGGTTCG	RT-PCR amplification of a 102-bp fkbP fragment as a control
pRTPr	GTTGAGGGCGGGGTGGTCGAGCGG

^aLowercase letters indicate the sequences for Red/ET-mediated recombination. Restriction enzyme sites are underlined.

DNA isolation, manipulation, and sequencing.

DNA isolation and manipulation in Escherichia coli and S. tsukubaensis were performed according to standard protocols (15). PCR amplifications were carried out on an Authorized Thermal TM Cycler (AG 22331; Eppendorf, Hamburg, Germany) using either Taq DNA polymerase or PrimeStar HS DNA polymerase (TaKaRa). Primer synthesis and DNA sequencing were performed at Shanghai GeneCore Biotechnology Inc.

Construction of pTA804 as a derivative of pSOK804.

According to the previously described methods (11, 12), pTA804 was constructed via Red/ET-mediated recombination by substituting bla (ampicillin resistance gene) and tsr (thiostrepton resistance gene) for aac(3)IV (apramycin resistance gene). A gene cassette containing bla and tsr was amplified from plasmid pSET151 (3) using the primer pair p151Redf/p151Redr, which was further introduced into E. coli BW25113(pIJ790) containing pSOK804 (29) by electroporation. The positive clones were selected through their ampicillin-resistant phenotype and were sequenced to confirm the fidelity of the λ Red-dependent recombination.

Construction for duplication of pathway-specific genes.

To duplicate the MOM-ACP pathway-specific genes fkbGHIJK, a 0.8-kb fragment containing fkbG without its native terminator and a 3.5-kb fragment containing fkbHIJK were amplified from the genomic DNA of ZJU01 by PCR amplification using the primer pairs pGf/pGr and pHIJKf/pHIJKr, respectively. Both PCR products were cloned into pMD18-T to yield pMD-G and pMD-HIJK. After sequencing to confirm fidelity, the 3.5-kb SpeI/XbaI fragment of pMD-HIJK was inserted into the XbaI site of pMD-G to generate pMOM, the genotype of which was validated by digestion analysis of restriction enzymes. The 4.3-kb HindIII/XbaI fragment of pMOM and a 0.5-kb EcoRI/HindIII fragment containing the constitutive ermE* promoter (PermE*) from pWHM79 (30) were then coligated into the EcoRI/XbaI site of pSET152 to generate pFL103.

To duplicate the AM-CoA pathway-specific genes tcsABCD, a 6.4-kb fragment containing tcsABCD was amplified by PCR amplification using the primer pair pABCDf/pABCDr with the genomic DNA of ZJU01 as the template. This fragment was cloned into pMD18-T to yield pAM. After sequencing to confirm fidelity, the 6.4-kb HindIII/XbaI fragment of pAM and a 0.5-kb EcoRI/HindIII fragment containing PermE* were coligated into the EcoRI/XbaI site of pSET152 to yield pFL104.

The pTA804 derivatives pFL106 and pFL107 were constructed similarly to pFL103 and pFL104 by inserting the corresponding DNA fragments into pTA804 instead of pSET152.

Generation of recombinant strains and confirmation of genotypes.

The pSET152 and pSOK804 derivatives were introduced into S. tsukubaensis ZJU01 by intergeneric conjugation from E. coli ET12567(pUZ8002), following the procedure described previously (15).

For pSET152-based recombination (as for FL101, FL103, and FL104), colonies with an apramycin-resistant phenotype were identified as exconjugants, the genotypes of which were further confirmed by PCR amplification-coupled sequencing using the primer pairs pL-C31f/pL-C31r and pR-C31f/pR-C31r. For pSOK804-based recombination (as for FL102), colonies resistant to apramycin were identified as exconjugants, the genotypes of which were verified by PCR-based amplification and sequencing by using the primer pair pL-VWBf/pL-VWBr. For pSET152- and pTA804-based recombination (as for FL105, FL106, and FL107), colonies resistant to both apramycin and thiostrepton were identified as exconjugants, the genotypes of which were then verified by PCR amplification and DNA sequencing by using the primer pairs pL-C31f/pL-C31r, pR-C31f/pR-C31r, and pL-VWBf/pL-VWBr.

To distinguish individual recombinant strains, different combinations of primers corresponding to the sequences of the conjugative vector (pSET152 or pTA804) and the duplicated gene cassette (fkbGHIJK or tcsABCD) were used in PCR-based amplification and sequencing to identify the specificity of each genotype (see Fig. 3A).

Fig 3.

Duplication of the MOM-ACP and AM-CoA pathway-specific genes via two actinophage (ΦC31 and VWB) integrase-mediated recombination systems for improving FK506 production. (A) Genotypes of the FK506 producer ZJU01 and its derivatives. The primer sets are labeled with their predicted fragment sizes. (B) Validation of the genotypes by PCR amplification. The primers used to amplify individual PCR products are illustrated in Fig. 2A. (C) FK506 time course titers in the fermentations of ZJU01 and the recombinant strains. The data are the average values of at least three series of three parallel tests, and the error bars represent the standard deviations.

FK506 production in S. tsukubaensis.

S. tsukubaensis ZJU01 and its derivatives were grown on agar plates (with the appropriate antibiotic[s] for recombinant strains) with alanine-starch agar (AS-1) medium consisting of 0.1% yeast extract, 0.02% l-alanine, 0.05% l-arginine, 0.5% soluble starch, 0.25% NaCl, 1.0% Na₂SO₄, and 2.0% agar at pH 7.5 and 30°C for sporulation. For fermentation, an agar piece of approximately 1 cm² was inoculated into a 250-ml flask containing 25 ml of the seed medium, consisting of 1.0% (vol/vol) glycerol, 4.0% soybean meal, 1.0% soluble starch, and 0.2% CaCO₃ at pH 7.0 ± 0.2, and was maintained at 28°C and 220 rpm for 24 to 28 h. Five milliliters of the seed culture was inoculated into a 500-ml flask containing 50 ml of the fresh fermentation medium [2.0% soluble starch, 1.0% glucose, 1.0% (vol/vol) soybean oil, 0.1% l-lysine, 0.17% (NH₄)₂SO₄, 0.05% K₂HPO₄, 0.05% NaCl, 0.05% MgSO₄ · H₂O, 0.5% CaCO₃, and trace elements as described previously (36), pH 7.0 ± 0.2]. The cultivations were maintained at 28°C and 220 rpm. For each strain, at least three independent isolates were subjected to parallel fermentation experiments in triplicate.

Chemical analysis of FK506 and FK520 production.

Culture samples (2 ml) were centrifuged for 10 min at 12,000 rpm. The supernatant was extracted twice with 2 ml of ethyl acetate, and the mycelium was extracted with 2 ml of acetone. The organic extracts were combined, evaporated to dryness under reduced pressure, and redissolved in 0.1 ml of acetonitrile.

High-performance liquid chromatography (HPLC) analysis was carried out on a Diamonsil C₁₈ (2) 5μ column (250 × 4.6 mm; catalog no. 99603; Dikma Technologies) on an Agilent 1100 HPLC system (Agilent Technologies, Palo Alto, CA). An isocratic program (60% acetonitrile and 40% H₂O) was carried out at a flow rate of 1 ml/min, and the temperature was maintained at 60°C. Liquid chromatography-mass spectrometry (LC-MS) analysis was carried out with the same isocratic program on an LC-MS 2010 A liquid chromatograph-mass spectrometer (Shimadzu, Japan), showing [M+Na]⁺ ions at m/z 826.5 and [M+NH₄]⁺ ions at m/z 821.5, in accordance with the FK506 molecular formula C₄₄H₆₉NO₁₂, and [M+Na]⁺ ions at m/z 814.5 and [M+NH₄]⁺ ions at m/z 809.5, in accordance with the FK520 molecular formula C₄₃H₆₉NO₁₂, respectively. The FK506 and FK520 titers were quantified using UV detection at 215 nm and were calculated with standard curves, representing the average values of at least three series of three parallel fermentation experiments.

Transcriptional analysis.

Each total-RNA sample was prepared from S. tsukubaensis mycelia after 36, 72, or 108 h of fermentation with TRIzol reagents (Invitrogen) according to the manufacturer's instructions. The DNase I-treated mRNA (5 ng) was reverse transcribed to the first-strand cDNA using the ReverTra Ace-α-kit (Toyobo). As an additional control for each primer set and RNA sample, the cDNA synthesis reaction was carried out in the absence of reverse transcriptase to verify that genomic DNA did not contaminate the RNA samples. After incubation with RNase H, the resultant cDNAs were used as templates for PCR to analyze the transcription levels of the MOM-ACP and/or AM-CoA biosynthetic genes. For each S. tsukubaensis strain, three independent isolates were subjected to RNA preparation for PCR amplification analysis in parallel.

The amplification of each sample was performed by using Taq DNA polymerase under the following conditions: for predenaturation, 2 min at 94°C, and for each cycle, 30 s at 94°C followed by 30 s at 65°C and 10 s at 72°C. A 102-bp fragment of fkbG and a 102-bp fragment of fkbK (representatives of MOM-ACP biosynthetic genes), as well as a 106-bp fragment of tcsA and a 103-bp fragment of tcsD (representatives of AM-CoA biosynthetic genes) were amplified using the primer pairs pRTGf/pRTGr, pRTKf/pRTKr, pRTAf/pRTAr, and pRTDf/pRTDr, respectively. A 102-bp fragment of the NRPS gene fkbP was amplified using the primer pair pRTPf/pRTPr and served as an internal control. The amplification of each gene was optimized by using the 72-hour sample from the original strain as the template, leading to determination of a common 30-cycle reaction that clearly shows the difference in mRNA abundance (data not shown).

RESULTS

Establishment of two actinophage (ΦC31 and VWB) integrase-mediated recombination systems in S. tsukubaensis.

Genetic studies on the diversity of the phage ΦC31 attB sites from different Streptomyces species revealed a conservative region within an open reading frame (ORF) coding for a putative chromosome condensation protein (5). With the degenerate primer pair ATTB1/ATTB2 (5), we successfully amplified a 294-bp DNA fragment by PCR from the genomic DNA of ZJU01, which has the 51-bp conservative sequence for ΦC31 attachment (Fig. 2A). Based on this, a ΦC31-derived integrative vector, pSET152, was introduced into ZJU01 by conjugation to generate the recombinant strain FL101, with a frequency of 2 × 10⁻⁶ exconjugants per recipient spore, by using the methylation-deficient E. coli ET12567(pUZ8002) as the donor. To verify the anticipated integration, we randomly selected five apramycin-resistant exconjugants for template preparation. PCR amplification-coupled DNA sequencing clearly indicated that all of the exconjugants exhibited identical genotypes of attL^ΦC31-linear pSET152-attR^ΦC31 at the integrating locus (Fig. 2A and 3). Thus, the ΦC31-based system is applicable to site-specific recombination in S. tsukubaensis.

Fig 2.

Identification and confirmation of the ΦC31 and VWB attB sites on the chromosome of S. tsukubaensis. (A) Nucleotide sequence alignment revealed a 51-bp conserved region within the attB^ΦC31 locus in various streptomycete species. PCR amplification-coupled DNA sequencing confirmed the existence of the attB^ΦC31 locus in S. tsukubaensis and the regions surrounding the hybrid attL^ΦC31 and attR^ΦC31 after the site-specific integration of pSET152. (B) Nucleotide sequence alignment revealed a 74-bp highly conserved region widespread in various streptomycete genomes. Sequence analysis of the PCR products revealed the region surrounding the hybrid attL^VWB after site-specific integration of pSOK804.

As demonstrated in S. venezuelae and S. ghanaensis, the attB site of actinophage VWB resides in a putative tRNA^Arg (AGG) gene (23, 33), which is different from that of ΦC31. To verify the availability of the attB^VWB site on the chromosome of ZJU01, we introduced a VWB-derived integrative vector, pSOK804, into ZJU01 by conjugation, yielding the recombinant strain FL102 at a frequency of 5 × 10⁻⁵ per recipient spore. By comparing the attB^VWB regions from S. venezuelae and S. ghanaensis, we identified a specific 74-bp highly similar sequence, which is widespread in various Streptomyces genomes (Fig. 2B). The 74-bp sequence was observed to appear in the conjunctive attL^VWB site after integration (33), which prompted us to select the conserved attL^VWB site, resulting from the hybridization of the 5′-terminal sequence of attB^VWB and the 3′-terminal sequence of attP^VWB of pSOK804, to validate the genotype of FL102. We performed PCR-based amplification and sequencing on five randomly selected pSOK804-based exconjugants. As expected, all five samples contained identical 74-bp sequences within the hybrid attL^VWB site, supporting the genotype of FL102 as attL^VWB-linear pSOK804-attR^VWB, which was produced by the site-specific integration of pSOK804 (Fig. 2B and 3). Therefore, S. tsukubaensis proved to be amenable to the VWB integrase-mediated recombination system.

Effect of site-specific recombination on FK506 production in S. tsukubaensis.

The identification of two distinct attB sites on the chromosome of ZJU01 provides us a choice of the utilization of two different site-specific recombination systems in the insertion of an artificial gene construct. To apply this approach, we evaluated the effects of the ΦC31- and VWB-based integrations on S. tsukubaensis. pSET152-based integration at the attB^ΦC31 locus did not affect the growth characteristics, and the resulting strain, FL101 (43.4 ± 4.1 mg/liter), produced FK506 in a quantity similar to that of the original strain, ZJU01 (46.9 ± 2.5 mg/liter). In a similar manner, FL102, which bears an insertion of pSOK804 at the attB^VWB locus, also showed no apparent difference in morphology and in FK506 production (40.7 ± 6.7 mg/liter) (Fig. 3C).

Duplication of the fkbGHIJK cassette encoding MOM-ACP formation via the ΦC31-based recombination system.

FkbG and FkbH to FkbK are convergently transcribed on the S. tsukubaensis chromosome (Fig. 1B). To simplify plasmid construction, fkbG without its native terminator was amplified and placed upstream of fkbHIJK, and the resultant fragment was inserted into pSET152 under the control of the constitutive ermE* promoter (PermE*) to give pFL103. pFL103 was introduced into ZJU01 by conjugation to yield the recombinant strain FL103, the genotype of which was verified by PCR amplification-coupled sequencing as attL^ΦC31-linear pFL103-attR^ΦC31 (Fig. 3A and B). The highest FK506 titer of FL103 was observed after 6 days of fermentation, similar to that of the wild-type strain ZJU01 (Fig. 3C). FL103 produced FK506 with a maximal titer of 61.3 ± 2.3 mg/liter under the specified culture conditions, showing an approximate 30% improvement in comparison with ZJU01 (46.9 ± 2.5 mg/liter). The data indicated that the duplication of the fkbGHIJK cassette has a positive effect on FK506 production.

Duplication of the tcsABCD cassette encoding AM-CoA formation via the ΦC31-based recombination system.

pFL104, a pSET152-derived plasmid containing the AM-CoA pathway-specific genes tcsABCD under the control of PermE*, was introduced into ZJU01 to yield the recombinant strain FL104, the genotype of which was confirmed as attL^ΦC31-linear pFL104-attR^ΦC31 (Fig. 3A and B). Similarly, FK506 production by FL104 reached the maximum after 6 days of fermentation (Fig. 3C), with a yield of 95.7 ± 4.6 mg/liter, approximately 100% above that of ZJU01. The duplication of the tcsABCD cassette significantly improved the FK506 fermentation yield, suggesting that AM-CoA formation in cells can be one of the main rate-limiting factors for FK506 biosynthesis in S. tsukubaensis.

Coduplication of the tcsABCD and fkbGHIJK cassettes via both the ΦC31- and VWB-based recombination systems.

Inspired by the success of FL103 (duplicating fkbGHIJK alone) and FL104 (duplicating tcsABCD alone) in FK506 production at an apparently improved level, we investigated whether the enhancement of both the MOM-ACP and AM-CoA pathways would result in a greater degree of production improvement. We thus developed a strategy in which both the ΦC31- and VWB-based systems could be utilized simultaneously. Since S. tsukubaensis is sensitive to apramycin and thiostrepton, we constructed a new VWB-based shuttle plasmid as a complement of pSET152. By replacing the original apramycin resistance gene on pSOK804 with the ampicillin and thiostrepton resistance genes, we generated a new conjugative vector, pTA804. We obtained FL105, a derivative of FL101, by inserting linear pTA804 at the attB^VWB locus by conjugation and thiostrepton resistance selection. This recombinant strain, with an expected genotype of attL^ΦC31-linear pSET152-attR^ΦC31-attL^VWB-linear pTA804-attR^VWB, shown in Fig. 3A, produced FK506 (40.1 ± 4.5 mg/liter) at a level similar to that of the original strain, ZJU01 (Fig. 3C). The finding supported the practicability of the strategy of using both the ΦC31- and VWB-based systems for recombination, given that pTA804 is compatible with pSET152 in S. tsukubaensis.

To increase the expression of both MOM-ACP- and AM-CoA-forming genes, we inserted the tcsABCD cassette into pTA804 to yield pFL106, which was introduced into FL103 by conjugation to generate the recombinant strain FL106 (containing the fkbGHIJK and tcsABCD cassettes together). The genotype of this strain was confirmed as attL^ΦC31-linear pFL103-attR^ΦC31-attL^VWB-linear pFL106-attR^VWB (Fig. 3A and B). After 6 days of fermentation, FK506 titers (105.9 ± 7.3 mg/liter) increased approximately 125% over that of ZJU01 (Fig. 3C). Alternatively, we constructed pFL107, a pTA804 derivative carrying the fkbGHIJK cassette. pFL107 was introduced into FL104 to produce a recombinant strain, FL107, whose genotype was then verified by PCR amplification and DNA sequencing as attL^ΦC31-linear pFL104-attR^ΦC31-attL^VWB-linear pFL107-attR^VWB (Fig. 3A and B). FL107 showed an ability to produce FK506 similar to that of FL106 (Fig. 3C), with a maximal FK506 yield (107.9 ± 2.8 mg/liter) in fermentation on day 6. These results indicated that FK506 production can be further improved by coenhancing the biosyntheses of MOM-ACP and AM-CoA without the positional effect by using the two integrase-based recombination systems in S. tsukubaensis.

Transcriptional assay of the fkbGHIJK and tcsABCD cassettes by RT-PCR amplification.

To correlate the overexpression of the MOM-ACP- and AM-CoA-coding genes with the duplication of the corresponding gene cassettes, we performed transcriptional analysis by semiquantitative reverse transcription (RT)-PCR amplification, with the transcription level of the NRPS gene fkbP as an internal control. Because the AM-CoA pathway-specific genes tcsABCD are organized in a contiguous form without a terminator, they can be transcribed into one polycistronic mRNA. We chose a 106-bp fragment within the first gene, tcsA, and a 103-bp fragment within the final gene, tcsD, to represent the transcription level of the AM-CoA biosynthetic genes. After reconstruction of the fkbGHIJK cassette, fkbG and fkbHIJK at the insertion locus were supposed to be transcribed into the same polycistronic mRNA. We chose here a 102-bp fragment within the first gene, fkbG, and a 102-bp fragment within the last gene, fkbK, to illustrate the transcription level of the MOM-ACP biosynthetic genes.

Indeed, RT-PCR analyses at the different time points in fermentation clearly indicated that the transcription levels of the genes coding for the MOM-ACP and AM-CoA biosynthetic pathways had apparently increased in FL103 and FL104, respectively (Fig. 4). This strongly supported the idea that the enhancement of pathway-specific gene transcription leads to the improvement in FK506 production. Compared to the original strain, ZJU01, the two recombinants, FL106 and FL107, with a higher yield of FK506 production, also exhibited the increased transcription levels of both the tcsABCD and fkbGHIJK cassettes in all parallel assays (Fig. 4).

Fig 4.

Semiquantitative RT-PCR analysis of the transcript levels of the fkbGHIJK and tcsABCD cassettes compared with that of fkbP. For each strain, the experiments were carried out on three independent isolates after 36, 72, and 108 h of fermentation. A 102-bp fkbG fragment and a 102-bp fkbK fragment were amplified to represent the fkbGHIJK transcript level, while a 106-bp tcsA fragment and a 103-bp tcsD fragment were amplified to represent the tcsABCD transcript level; a 102-bp fkbP fragment served as an internal control.

Effect on FK520 production of duplication of the MOM-ACP and AM-CoA cassettes.

S. tsukubaensis also has the ability to produce a minor product, FK520 (ascomycin), which differs from FK506 in structure only by the C-21 substitution of an ethyl group instead of an allyl group (Fig. 1A). This difference is dependent on the corresponding AT domain of the PKS system in substrate utilization, which selects ethylmalonyl (EM)-CoA as the extender unit for producing FK520 or AM-CoA for producing FK506 (20). To evaluate the relevance of FK520 with FK506 in production during the engineering process, the recombinant strains FL103, FL104, FL106, and FL107, as well as the original strain, ZJU01, were fermented and then subjected to HPLC quantification (Fig. 5). In FL103, the yield of FK520 (9.3 ± 0.6 mg/liter versus 7.4 ± 0.7 mg/liter for ZJU01) increased along with FK506, showing a ratio of FK520 to FK506 of 1:6.6 (a similar ratio of 1:6.3 was found in ZJU01). This is consistent with the prediction that the duplication of fkbGHIJK enhances the formation of MOM-ACP, the extender unit shared by the biosyntheses of FK520 and FK506. In FL104, the yield of FK520 (11.1 ± 0.9 mg/liter) increased; however, the growth rate was lower than that in FL103, giving a ratio of FK520 to FK506 of 1:8.6. Thus, the duplication of tcsABCD may mainly enhance the supply of AM-CoA, the extender unit used only in FK506 formation, providing a great potential to optimize its purity and production at the fermentation stage. In this case, the increase of FK520 production could be due to the promiscuity of the CCR protein TcsC in activity, which might accept crotonyl-CoA as the substrate to produce EM-CoA via reductive carboxylation for FK520 biosynthesis, as proposed previously (17). In line with the above, the yields of FK520 in FL106 (13.6 ± 1.0 mg/liter) and in FL107 (13.8 ± 0.7 mg/liter) also increased, showing a comprehensive effect of duplicating both fkbGHIJK and tcsABCD to give a similar ratio of FK520 to FK506 of 1:7.8.

Fig 5.

HPLC analysis of FK506 and FK520 from day 6 fermentation cultures of the S. tsukubaensis strains ZJU01, FL103, FL104, FL106, and FL107. AU, arbitrary units.

Further improvement of FK506 production by optimizing the glucose concentration.

In regard to FK506 production, the fermentation culture of S. tsukubaensis in this study contained soybean oil and l-lysine, which provide the precursors for FK506 biosynthesis through cellular metabolism, including M-CoA, MM-CoA, and l-pipecolic acid (7, 16, 32, 36). Glucose, one of the most commonly used carbon sources for fermentative production, also serves as a direct source to biosynthesize the precursors of various secondary metabolites. However, when the culture is grown in a high concentration of glucose (or other easily assimilated carbohydrates, such as xylose and sucrose), the production of these metabolites is usually repressed (1, 25). Although the mechanism has yet to be understood, it was proposed that this repression effect may be related to glucose transport and phosphorylation (25). An overview of glucose metabolism relevant to FK506 biosynthesis is illustrated in Fig. 6A.

Fig 6.

Glucose-dependent profile of FK506 production by the S. tsukubaensis strains ZJU01, FL103, FL104, FL106, and FL107. (A) Overview of glucose metabolism in relation to FK506 biosynthesis. The boxed areas represent the MOM-ACP and AM-CoA pathways. (B) FK506 titers of ZJU01 and its recombinant strains FL103, FL104, FL106, and FL107 on day 6 with respect to different glucose concentrations. The data are the average values calculated from three independent isolates of parallel tests in triplicate, and the error bars represent the standard deviations.

Because MOM-ACP biosynthesis utilizes 1,3-BPG, which is a direct product of glycolysis (Fig. 6A), as its substrate (Fig. 1C), we reasoned that the overexpression of MOM-ACP biosynthetic enzymes would accelerate the depletion of intracellular 1,3-BPG. This depletion could consequently increase the glycolytic flux and render the cells more resistant to high concentrations of glucose. To test this hypothesis, strains were fermented in cultures with glucose concentrations that varied from 0.5% to 2.0%. FK506 production by ZJU01 and FL104 (the strain overexpressing AM-CoA biosynthetic genes alone) exhibited similar trends in response to the increased glucose concentration, showing maximal titers at 1.0% glucose and a linear decrease afterward (Fig. 6B). Production in ZJU01 decreased to about 35% of the maximum level in the culture that contained 2.0% glucose. Interestingly, for the strains overexpressing MOM-ACP biosynthetic genes, either alone or together with the AM-CoA genes, the FK506 production profiles were quite different (Fig. 6B). FK506 production by FL103 (the strain overexpressing MOM-ACP genes alone) increased almost linearly before the glucose concentration reached 1.75% (80.9 ± 4.7 mg/liter), while FL106 (119.1 ± 5.4 mg/liter) and FL107 (116.2 ± 4.1 mg/liter) (the strains overexpressing both MOM-ACP and AM-CoA genes) showed maximum FK506 production at 1.5% glucose. Consequently, FK506 production by FL106 and FL107 increased approximately 10% when the glucose concentration of the culture changed from 1.0% to 1.5%.

DISCUSSION

As a common approach for improving polyketide production, the genetic enhancement of the precursor supply has proven to be effective and promising for optimizing the strains for natural product biosynthesis. The intracellular pools of M-CoA and MM-CoA, which are the most widespread extenders and usually have low concentrations in cells (24), are frequently enriched by engineering to improve the production of desired polyketides. For example, the overexpression of acetyl (Ac)-CoA carboxylase, which diverts Ac-CoA away from the tricarboxylic acid (TCA) cycle and directs it toward M-CoA, resulted in a significant increase in actinorhodin production (27). The overexpression of the MM-CoA mutase pathway led to a 50% increase in erythromycin production by Saccharopolyspora erythraea (26), as well as a 50% increase in FK506 production by S. clavuligerus CKD1119 (19). The overexpression of propionyl-CoA carboxylase combined with the supplementation of the culture with propionate caused an 80% increase in rapamycin production by S. hygroscopicus ATCC 29253 (13).

M-CoA and MM-CoA metabolism is known to provide universal substrates independently of the polyketide biosynthetic pathways in microorganisms; however, FK506 biosynthesis requires two unusual pathway-specific building blocks, MOM-ACP and AM-CoA, raising the question of whether their formation in cells can be a bottleneck to production improvement. Here, the overexpression of a minimal set of genes that are responsible for the biosynthesis of either MOM-ACP or AM-CoA enhances the production of FK506 in the recombinant strains. The data suggest that the intracellular formation of the unusual PKS extender units is likely to be the rate-limiting factor and can be rationally engineered to improve FK506 production. It is noteworthy that only one molecule of AM-CoA is incorporated into the FK506 scaffold, yet the production in FL104 upon duplicating the AM-CoA biosynthetic genes increased by approximately 100% over that in ZJU01. It is likely that for the original strain, AM-CoA biosynthesis has a lower turnover number than PKS and thus is unable to provide sufficient precursors for FK506 biosynthesis.

Current successes in generating high-producing strains via site-specific recombination mainly rely on the application of the actinophage ΦC31 system (13, 19, 26, 27, 34). However, with this system, our ability to evaluate the comprehensive effect of the genetic enhancement of both the MOM-ACP and AM-CoA supplies was limited. The characterization of new site-specific recombination systems provided us with an exciting possibility that diverse genetic tools could be used at the same time for the stable expression of recombinant constructs in candidate strains. Considering that most actinomycetes are sensitive to apramycin and thiostrepton, the newly constructed vector pTA804 (VWB based) carrying ampicillin and thiostrepton resistance genes may serve as a useful tool that complements the plasmid pSET152 (ΦC31 based) for genetic manipulation in actinomycetes. The strategy of utilizing two actinophage (ΦC31 and VWB)-based recombination systems provides a convenient platform for a rapid evaluation of the gene dose effect in S. tsukubaensis, which facilitates the simultaneous overexpression of the MOM-ACP and AM-CoA pathways. The two systems can operate independently and exhibit a comprehensive effect, as exemplified by those in FL106 and FL107, to enhance the transcriptional levels of fkbGHIJK and tcsABCD to further improve the production of FK506.

The strategy described here could also be applicable and useful for other secondary metabolites that contain pathway-specific building blocks, as exemplified by ansatomycin, midecamycin, tautomycin, and oxazolomycin, the biosyntheses of which share a route to build the methoxy group at the β-carbon of the growing polyketide chain via the incorporation of MOM-ACP as the extender unit by PKSs (4, 14). To put it into practice, we developed a method using two distinct site-specific recombination systems in the FK506 producer S. tsukubaensis. These studies broaden the repertoire of actinophage-based vectors and allow the engineering of Actinomyces in a multiple-site-specific recombination manner.