Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2012 Jul 24;109(32):13058–13063. doi: 10.1073/pnas.1207868109

Unconventional initiator tRNAs sustain Escherichia coli

Laasya Samhita a, Sunil Shetty a, Umesh Varshney a,b,1
PMCID: PMC3420168  PMID: 22829667

Abstract

Of all tRNAs, initiator tRNA is unique in its ability to start protein synthesis by directly binding the ribosomal P-site. This ability is believed to derive from the almost universal presence of three consecutive G-C base (3G-C) pairs in the anticodon stem of initiator tRNA. Consistent with the hypothesis, a plasmid-borne initiator tRNA with one, two, or all 3G-C pairs mutated displays negligible initiation activity when tested in a WT Escherichia coli cell. Given this, the occurrence of unconventional initiator tRNAs lacking the 3G-C pairs, as in some species of Mycoplasma and Rhizobium, is puzzling. We resolve the puzzle by showing that the poor activity of unconventional initiator tRNAs in E. coli is because of competition from a large pool of the endogenous WT initiator tRNA (possessing the 3G-C pairs). We show that E. coli can be sustained on an initiator tRNA lacking the first and third G-C pairs; thereby reducing the 3G-C rule to a mere middle G-C requirement. Two general inferences following from our findings, that the activity of a mutant gene product may depend on its abundance in the cell relative to that of the WT, and that promiscuous initiation with elongator tRNAs has the potential to enhance phenotypic diversity without affecting genomic integrity, have been discussed.

Keywords: fidelity of initiation, ribosome, phenotypic plasticity


tRNAs play a central role in protein synthesis. All tRNAs share the same clover leaf-like structure but belong to two distinct categories: initiator tRNA (of which there is a single representative) and elongator tRNAs (of which there are many representatives). As the name indicates, initiator tRNA acts at the first step of protein synthesis, initiation. It is distinct from elongator tRNAs both in the details of its sequence and in its ability to bind the P-site of the ribosome directly. In contrast, elongator tRNAs first bind the A-site of the ribosome and then get translocated to the P-site. Two special features that have evolved to promote initiator tRNA binding to the P-site in eubacteria are (i) formylation of the methionine amino acid that it carries and (ii) the occurrence of three consecutive G-C base (3G-C) pairs in its anticodon stem at positions 29–41, 30–40, and 31–39 (Fig. 1). Although formylation is not found in archaea and eukaryotes, the 3G-C pairs remain universal; they are conserved across all domains of life. They have been shown to be essential for the P-site targeting of initiator tRNA (1, 2). More recently, it was shown by mutational analysis that the first two G-C base pairs (positions 29–41 and 30–40) of the initiator tRNA are contacted by G1338 and A1339 of 16S rRNA (3), thereby establishing a direct contact to facilitate P-site binding in the 30S subunit of the ribosome (4, 5).

Fig. 1.

Fig. 1.

Generation of the 3G-C mutants. Mutations were generated in the 3G-C pairs in the anticodon stem of initiator tRNA using pmetY as a template. Sequence comparisons (of the relevant regions) in the box show exceptions to the 3G-C rule in Rhizobium leguminosarum and some species of Mycoplasma, in comparison to the E. coli initiator tRNA sequence. The regions corresponding to the 3G-C base pairs are colored gray. M. synoviae, Mycoplasma synoviae; M. mobile, Mycoplasma mobile; M. pulmonis, Mycoplasma pulmonis; M. pneumoniae, Mycoplasma pneumoniae.

In Escherichia coli, initiator tRNAs are encoded by four genes. Of these, metZ, metW, and metV are present at 63.5′ and the fourth gene, metY, is present at 71.5′ (6). In E. coli B strains, all four genes encode identical tRNAfMet1, whereas in E. coli K strains, the metY gene encodes tRNAfMet2. tRNAfMet1 carries an A at position 46, whereas tRNAfMet2 has N7-methyl G at this position with no apparent functional differences (7). Either of these two loci can be dispensed with in E. coli (8, 9), but strains lacking all four initiator tRNA genes are not viable. Further, mutations in the 3G-C pairs abolish the activity of mutant tRNAs in initiation in vitro and in vivo (1, 10). This has led to the belief that the intact 3G-C pairs of initiator tRNA are an essential feature of living systems. The only known exceptions are in some species of Mycoplasma and Rhizobium, where the single initiator tRNA gene produces tRNAs having the first and/or last G-C pair represented by A-U and G-U, respectively (11). Understanding how initiation occurs in these species has therefore been a major puzzle in the field of translation. Studies on these aspects have remained challenging because of the lack of an appropriate model for genetic analyses.

Recently, using an in vivo assay system, we reported that a plasmid-borne mutant initiator tRNA lacking the 3G-C pairs (3G-C mutant) showed negligible initiation activity in E. coli. However, we observed a considerable increase in its initiation activity when the abundance of the chromosomally encoded WT initiator tRNA was reduced by knocking out three (metZ, metW, and metV) of the four initiator tRNA genes in the E. coli genome (12). This observation raised the intriguing possibility that the unique partitioning of work among the initiator and elongator tRNAs may be maintained as much by their relative intracellular abundance as by their distinct structural features. Further, it motivated the hypothesis that a mutant initiator tRNA molecule may sustain the growth of the cell in the absence of any canonical initiator tRNA. The aim of the present study is to test this hypothesis. Is it possible to break down the specialization of initiator tRNA and sustain an E. coli cell on initiator tRNAs previously judged to be inadequate because they lacked the hallmark 3G-C pairs?

Results

Generation of Mutations in the Anticodon Stem of tRNAfMet.

To investigate if E. coli can sustain life with an initiator tRNA lacking the characteristic 3G-C pairs in its anticodon stem, we carried out site-directed mutagenesis of the plasmid-borne metY gene encoding tRNAfMet2 (Fig. 1). The mutagenesis targeted one, two, or all 3G-C pairs to generate A29-U41, C30-G40, G31-U39, A29-U41/G31-U39, C30-G40/A31-U39, and U29-A41/C30-G40/A31-U39 (abbreviated as A-U, C-G, G-U, A-U/G-U, C-G/A-U, and 3G-C, respectively) mutant tRNAs.

Sustenance of E. coli in the Absence of Chromosomally Encoded Initiator tRNA.

To test the ability of the above mutant initiator tRNAs to support the growth of E. coli, we deleted all four chromosomally encoded initiator tRNA genes and replaced them with various mutant tRNA genes on a plasmid. The strategy involved transduction-mediated sequential deletion of the metY and metZWV loci in E. coli KL16 using P1 phage raised on the ΔmetY::cm (also indicated as ΔmetY) and ΔmetZWV::kan (also indicated as ΔmetZWV) strains. The genomic metY locus was knocked out before introduction of the different plasmid-borne mutant tRNAs (derived from metY) into the strain to avoid complications arising from any event of possible recombination between the chromosomal and plasmid-borne genes. Despite the fact that the substitution of the 3G-C pairs with other pairs in the anticodon stem of the initiator tRNA does not affect their aminoacylation and formylation (10), true KOs for both of the loci were obtained only in strains supported by the A-U, G-U, and A-U/G-U mutants (Fig. 2 A and B).

Fig. 2.

Fig. 2.

(A) Schematic of the gene KOs and the expected sizes of the PCR amplicons. (B) PCR analysis shows the KOs of metY in the strain KL16 (i) followed by the KO of metZWV in strains supported by the A-U, G-U, and A-U/G-U mutants (ii–iv). Amplicons of ∼1.1 kb and ∼1.5 kb show the KOs for metY (ΔmetY or ΔmetY::cm) and metZWV (ΔmetZWV or ΔmetZWV::kan), respectively. Amplicons corresponding to the WT and KOs are indicated. Intense bands in the marker (M) lane correspond to the sizes of 0.5 kb and 1.0 kb. Size increments up to 1.0 kb are 0.1 kb; thereafter, the sizes are 1.2, 1.5, 1.8, and 3.0 kb, respectively. (C) Analysis of tRNAfMet1 and tRNAfMet2 from the parent strain and from strains at each stage of KO generation. Total tRNA preparations were separated on a 15% polyacrylamide gel, transferred onto a Nytran membrane, and analyzed by Northern blotting using a probe specific to initiator tRNA. Subsequently, the same blot was hybridized to tRNATyr probe for loading control. The positions of tRNA species are as indicated. The blots were quantified using a BioImageAnalyzer (FLA5000; Fuji). Cellular abundances (Rel. Ratios) of the initiator tRNAs in the strains were calculated relative to tRNAfMet (tRNAfMet1 and tRNAfMet2) after normalization of the total of the pixel values corresponding to the tRNAfMet bands by dividing them by the corresponding pixel values of the tRNATyr bands. Rel. Ratios, relative ratios. Note: As the probe used for Northern analysis (see Materials and Methods) carries a mismatch at position 29 of the A-U and A-U/G-U mutant tRNAs, the relative ratios indicated for these tRNAs are an under-estimate.

To verify that the cell is indeed sustaining life on the mutant tRNAs, we subjected total tRNA preparations from the WT, single KO, and final KO strains to Northern blot analyses. The two species of initiator tRNA, tRNAfMet1(encoded by metZWV) and tRNAfMet2 (encoded by metY), can be separated by native gel electrophoresis (13). As is seen from Fig. 2C, the WT strain (with intact metZWV and metY loci) shows two bands corresponding to tRNAfMet1 and tRNAfMet2. Because the mutant tRNAs were derived from the metY gene, we were able to monitor the disappearance of the original tRNAfMet2 band in the ΔmetY strain, and then the appearance of a band corresponding to the mutant tRNA on introduction of the plasmid bearing the gene for the mutant tRNA, without affecting the tRNAfMet1 band. It may be mentioned that the G-U and A-U/G-U mutant tRNAs migrate differently from the A-U mutant and, in fact, migrate slower than even the tRNAfMet1. Deletion of the metZWV locus (ΔmetZWV) finally leaves the cell with only the tRNA from the plasmid, confirming that the only source of initiator tRNA the KO strain has is the plasmid-borne mutant tRNA. In addition, probing of the same blot for tRNATyr (Fig. 2C, Upper) allowed relative quantification of initiator tRNAs (Fig. 2C, Lower). The analysis showed that the relative cellular level of the A-U/G-U mutant is three- to fourfold lower than that of the A-U or G-U mutant (compare lane 8 with lanes 4 and 6).

To verify further that the strains are dependent for their survival on these tRNAs, we repeated the KO experiment with mutant tRNA genes subcloned into the plasmid pAM34, whose replication is dependent on the addition of isopropyl-β-d-thiogalactopyranoside (IPTG). We found that the transductants were all dependent on IPTG for their growth, indicating that the cell is indeed sustained on these mutant tRNAs (Fig. 3). Interestingly, these are also the same three natural variants found in mycoplasmas, indicating that these specific mutations allow the 3G-C rule to be bypassed when the amount of competing chromosomally encoded tRNAfMet is decreased. It should also be said that because the C-G mutation at positions 30–40 (by itself or in combination) fails to support E. coli growth, the presence of the middle G-C pair is most crucial for the function of the initiator tRNA.

Fig. 3.

Fig. 3.

Sustenance of E. coli in the absence of any chromosomally encoded initiator tRNA. Growth of E. coli KL16ΔmetY (sector 1) and E. coli KL16ΔmetYΔmetZWV (sectors 2–6) carrying plasmid-borne copies of the mutant tRNA genes [(pAM(A-U), pAM(G-U), or pAM(A-U/G-U)] after incubation for 12 h at 37 °C. Isolated transductants were streaked on LB-agar plates containing ampicillin (Amp) and kanamycin (Kan), with or without IPTG.

Rescue of the Cold-Sensitive Phenotype of a Strain Deficient in Initiator tRNA.

It is known that strains deleted for metZWV locus (or having severe deficiency of tRNAfMet) exhibit cold sensitivity (8, 12). This observation provides a useful qualitative screen for assessing the extent of activity of a tRNAfMet mutant. Thus, as an additional assay of their functionality and a means to test if the other mutants also possessed some degree of functionality, we introduced each of our mutant tRNA plasmids into E. coli KL16 ΔmetZWV and monitored the resulting transformants for growth at 22 °C. Again, of all the mutants tested, the same three mutants (A-U, G-U, and A-U/G-U) rescued the cold-sensitive phenotype of the ΔmetZWV strain (Fig. 4). None of the other mutants (C-G, C-G/A-U, and 3G-C) showed even a partial rescue of the cold-sensitive phenotype at 22 °C. However, at the permissive temperature of 37 °C, all transformants showed growth as expected (Fig. 4).

Fig. 4.

Fig. 4.

Rescue of the cold-sensitive phenotype of a strain deficient in initiator tRNA. Growth of E. coli KL16ΔmetZWV carrying various mutant tRNAs on plasmid (as indicated) after incubation for 12 h at 22 °C or 37 °C. Single colonies were picked from a plate of transformants and streaked on LB-agar plates containing ampicillin.

Growth Analysis of the Strains.

In E. coli KL16ΔmetYΔmetZWV strains supported solely by the plasmid-borne mutant tRNAs [pmetY(A-U), pmetY(G-U), and pmetY(A-U/G-U)], the growth of the strains in LB (Fig. 5) was marginally to moderately compromised with respect to the positive control supported on the native initiator tRNA (pmetY), suggesting that the mutant tRNAs sustained efficient initiation of protein synthesis, at least in a rich medium.

Fig. 5.

Fig. 5.

Growth analysis of the strains. Growth of E. coli strains was sustained on plasmid-borne mutant tRNAs (A-U, G-U, or A-U/G-U) as indicated. Overnight cultures grown in LB-Amp were diluted 100-fold in ampicillin (Amp) containing LB, and their growth was monitored using a Bioscreen C growth reader.

Rate of Initiation of Protein Synthesis in E. coli Sustained on the A-U, G-U, and A-U/G-U Mutant tRNAs.

To assess the initiation efficiency of the mutant tRNAs, we carried out β-galactosidase time course assays with growing cells in early log phase. The rate of enzyme induction serves as an indicator of the rates of protein synthesis by the mutant tRNAs. When broken down into initiation (represented by the slope of the rise in β-galactosidase activity) and elongation (represented by the lag corresponding to translation of the first full-length protein before the rise in β-galactosidase activity) components (14), an in vivo assessment of the protein synthesis rates shows that the A-U/G-U mutant has a significantly lower rate of initiation, whereas the A-U and G-U mutants show only a moderate compromise compared with the WT tRNA (Fig. 6), which is in agreement with the growth rate assessments. The lower rate of initiation by the A-U/G-U mutant could be attributed, in part, to its lower level in the cell (Fig. 2C, Lower; compare lane 8 with lanes 4 and 6). Expectedly, the elongation rates estimated from the lag time (indicated by an arrow in Fig. 2C, Lower) are nearly the same in all the strains (∼12 amino acids per second).

Fig. 6.

Fig. 6.

Rate of initiation of protein synthesis in E. coli sustained on the A-U, G-U, and A-U/G-U mutants. E. coli KL16ΔmetYΔmetZWV sustained on A-U [pmetY(A-U)], G-U [pmetY(G-U)], and A-U/G-U [pmetY(A-U/G-U)] mutant tRNAs (i, ii, and iii, respectively), along with a control sustained on WT tRNA (pmetY), were grown overnight in LB-ampicillin (Amp) and subcultured in Amp containing M9 minimal medium with 2% (vol/vol) glycerol. β-Galactosidase activity was calculated by measuring the OD420. The square root of the absorbance value (defined as “Miller units”) was plotted against time (Materials and Methods). Data for the control strain sustained on pmetY were reproduced in each panel for comparison. Arrows indicate the points at which an increase in OD420 was first detected.

Direct Assay of the in Vivo Initiation Activity of the Mutant tRNAs.

We have previously established a chloramphenicol acetyltransferase (CAT) reporter assay for assessing in vivo activity of the initiator tRNA mutants (15). The assay exploits initiation from a UAG initiation codon of the CATam1 reporter mRNA with a tRNA mutant possessing a complementary CUA anticodon (U35A36 mutation). To assess the initiation activity of the tRNA mutants, we changed their anticodons from CAU to CUA and introduced them into E. coli strains having four, three, two, or one copy of the genomic tRNAfMet genes. In these assays (Fig. 7), in the strain lacking three of four tRNAfMet genes (∆metZWV), although the A-U, and G-U mutants showed nearly as good activity as the positive control (tRNAfMet with CUA anticodon), the A-U/G-U mutant showed about half of the activity. These activities are consistent with the growth of the strains sustaining on these tRNAs. Interestingly, as the number of genomic copies of the tRNAfMet genes increases to four, initiation activities of the A-U, G-U, and A-U/G-U mutants decrease. In fact, as observed in our earlier studies (11), the activity of the A-U/G-U mutant in WT E. coli strain harboring all four tRNAfMet genes, is negligible. These observations are further supported by plate assays (Fig. S1).

Fig. 7.

Fig. 7.

Direct assay of the in vivo initiation activity of the mutant tRNAs. Biochemical assays to determine initiation rates of mutant initiator tRNAs in the strains harboring different numbers of the WT initiator tRNA genes were performed. Three independent colonies were grown to midlog phase and used to make cell-free extracts. Means with SEs have been plotted. As indicated, bars 1–4, 5–8, 9–12, and 13–16 correspond to E. coli KL16, ΔmetY, ΔmetZW, and ΔmetZWV strains, respectively, carrying pCATam1metYCUA(A-U) (bars 1, 5, 9, and 13), pCATam1metYCUA(G-U) (bars 2, 6, 10, and 14), pCATam1metYCUA(A-U/G-U) (bars 3, 7, 11, and 15), or the positive control pCATam1metYCUA (bars 4, 8, 12, and 16). Cell-free extracts of E. coli KL16 harboring pCATam1metYCUA produced ∼4,700 pmol of acetylchloramphenicol (Ac-Cm) per microgram of total protein used (100%). This serves as the positive control, and all other values are plotted relative to this.

Discussion

We have shown that the three consecutive G-C base pairs in initiator tRNA are not indispensable for E. coli survival. We generated various mutations in the anticodon stem to change the 3G-C pairs to other base pair combinations and found that some of the changes do, in fact, sustain E. coli in the absence of WT initiator tRNA.

Two hallmarks of eubacterial initiator tRNA are formylation of the amino acid it carries and the presence of the 3G-C pairs in the anticodon stem. Although both features are required for initiator tRNA function, the 3G-C pairs appear to be the more important of the two. Formylation does not take place in archaea and eukaryotes, whereas the 3G-C pairs are found across all life forms. Even within eubacteria, formylation is not essential, although its deficiency results in a growth compromise (16). In Pseudomonas, efficient initiation occurs with unformylated tRNA with only a moderate growth defect (17). To date, however, the feature of the 3G-C pairs was believed to be indispensable for initiation from both in vitro and in vivo experiments (1, 10). Earlier studies in yeast showed that although overproduction of initiator tRNA could sustain a strain lacking all five elongator tRNAMet genes, a strain lacking all its chromosomal copies of the initiator tRNAMet genes could neither be sustained by overproduction of the elongator tRNAMet nor by overproduction of initiator tRNAMet lacking the 3G-C pairs (18). The only known exceptions to the presence of the 3G-C pairs are some species of Mycoplasma (which has the smallest bacterial genomes and is most often parasitic) (11) and Rhizobium (which lives in symbiotic association).

A living cell has only one species of initiator tRNA (which reads AUG or a related start codon in mRNA) and several species of elongators (which read all the other codons, including internal AUG codons). Precisely where the divergence occurred has not been resolved by tRNA phylogenies, but it seems reasonable to assume that the specialized methionine carrying initiator was “frozen” later in time. The initiator tRNA population in E. coli is estimated to contribute ∼3% to the total cellular pool of tRNA. A decrease in the amount of WT initiator tRNA permits initiation to take place with mutant initiator tRNAs that are normally rejected at the P-site. In fact, as Fig. 7 shows, the initiation activity of the mutants increases with a decrease in the cellular pools of the WT initiator tRNA.

The initiator tRNA participates in translation via the formation of an initiation complex on the 30S ribosomal subunit, together with the initiation factors and mRNA. Current models of 30S initiation complex formation, based largely on in vitro data, are divided between a random and sequential binding order of mRNA and initiator tRNA (19–22). In the latter model, the debate is about which binds first, mRNA or initiator tRNA. Our in vivo observation (Fig. 7) of continuous increase in the activity of the mutant initiator tRNA as the WT complement is decreased is more simplistically interpreted by the hypothesis that initiator tRNA is prebound to the ribosome following competition of varying degrees from other tRNAs. Increased binding of the mutant initiator tRNA (expected from decreased chromosomally encoded WT initiator tRNA) would, in turn, facilitate increased mRNA selection by cognate codon anticodon pairing, and therefore more translation of the CAT reporter in our assays. On the other hand, if the mRNA was prebound, it would facilitate selection of only the initiator tRNAs capable of decoding UAG initiation codon at the P-site. Because the abundance of mutant initiator tRNAs capable of decoding UAG is relatively unchanged in our assays, the increase in initiation activity we see (i.e., on deletion of chromosomally encoded AUG reading initiator tRNAs) would be hard to explain. Our interpretation that the initiator tRNA binds first to the 30S subunit is also consistent with earlier in vivo observations in which initiation with UAG, GUC, and AUC codons in the same CAT reporter was studied (23).

The first two G-C pairs (at positions 29–41 and 30–40) of the three present in the anticodon stem were suggested to be important for selection of the initiator tRNA in the P-site by A-minor interactions (3). However, subsequent structural studies showed that A1339 makes a suboptimal interaction, with the distance between the N1 of A1339 and the 2′-OH of G (at position 29) being too long for a hydrogen bond. This observation also suggests a more important role for the middle G-C (at positions 30–40) in selection of the initiator tRNA in the P-site (4). Our present observations and the earlier observation (3) are thus fully consistent with such an interpretation and demonstrate the critical nature of the middle G-C. Why then should most organisms evolve with initiator tRNAs having 3G-C pairs? As suggested, even though the interaction of A1339 with the first G-C is not clearly seen, it could be that during initiation, conformational changes could allow this interaction to occur, supporting its role at a later stage in initiation. Whereas the role of the third G-C (at positions 31–39) has remained unclear (3), we note that in the native gel, although the A-U mutant migrates at the same position as the WT initiator, both the G-U and the A-U/G-U mutants migrate slower (Fig. 2), strongly suggesting a conformational change in these mutants. Thus, the third G-C is likely to maintain structural integrity by locking the anticodon loop. Such a function is likely to limit the nonproductive conformations the loop may adopt, making it more efficient for the ribosome to sample the correct one(s). It may be mentioned that the proposed function of the third G-C pair in maintaining structural integrity of the anticodon loop does not negate an earlier proposal that the ribosomal residues (1338/1339) may contact it at a later stage in initiation (3). Thus, an initiator tRNA with 3G-C pairs may offer a fitness advantage to the cell over those lacking one or more of the G-C pairs.

Nevertheless, minimization of the highly conserved feature of the 3G-C pairs to a mere single G-C pair (at positions 30–40) has essentially reduced it to a feature that is no longer unique to the initiator tRNA. In fact, several elongator tRNAs even possess the first two G-C pairs (e.g., tRNAPhe, tRNACys). How then do cells possessing an initiator tRNA with a single G-C pair ensure fidelity of P-site binding? As evidenced (12), there is competition for P-site binding by different tRNAs. At least in eubacteria, cellular abundance of the initiator tRNA may be a critical criterion to ensure fidelity of its binding to the P-site. A recent report of an enterotoxin, VapC, in Shigella and Salmonella serovars, is of particular relevance because VapC specifically targets initiator tRNA, resulting in its low abundance in the cell with respect to the elongator tRNAs (24). This leads to the interesting hypothesis that promiscuous initiation by elongator tRNAs (12) may be a potential strategy that cells use occasionally to achieve phenotypic diversity during stressful conditions that result in relative depletion of the initiator tRNA (8, 24, 25). Such a strategy would have the added advantage of enhancing phenotypic plasticity without disturbing the integrity of the genome as, for instance, a mutational event would do.

Our present observations also emphasize the importance of intracellular competition in estimating the functionality of mutant molecules. As demonstrated, initiation activities of mutant tRNAs can differ tremendously in a WT cell vs. a cell whose stock of WT initiator tRNA is depleted. More broadly, it suggests the need for caution in dismissing mutants as “nonfunctional,” and a reexamination of some cases is perhaps warranted, taking into account competition from the WT molecule.

Materials and Methods

Strains and Plasmids.

The strains and plasmids used have been listed in Table S1. E. coli KL16 (26) or its derivatives were used for most experiments. Bacteria were grown in LB or LB-agar plates containing 1.8% (wt/vol) bactoagar (Difco). Unless indicated otherwise, media were supplemented with ampicillin (Amp, 100 μg/mL), chloramphenicol (30 μg/mL), kanamycin (25 μg/mL), or IPTG (1 mM) as required.

Site-Directed Mutagenesis.

The plasmid pmetY, carrying the metY gene encoding tRNAfMet2, was used as a template for mutagenesis by inverse PCR utilizing a complementary set of DNA oligomers with the desired mutations. Details of the PCR conditions and DNA oligomers used are provided in SI Materials and Methods.

Generation of ΔmetY::cm and ΔmetZWV::kan Strains.

Methodologies to knock out metY and metZWV in E. coli DY330 (27) and mobilization of KO alleles are described in SI Materials and Methods.

Subcloning of metY Mutants into pAM34 Vector.

The mutant tRNA genes were mobilized from pmetY into pAM34 carrying an IPTG-inducible origin of replication (28) using EcoRI and PstI, which release metY as a 500-bp size fragment.

Isolation of tRNAs and Northern Blot Analysis.

Total tRNA preparations from various strains were fractionated on native 15% polyacrylamide gels, electroblotted onto Nytran membrane and analyzed by Northern blotting (13) using 32P end-labeled DNA oligomers, 5′ GAGCCCGACGAGCTACCAGGCTGCTCCACC 3′ or 5′ GCAGATTTACAGTCTGCTCCCTTTGGCCGCTCGGGAACCCCAC 3′, specific to tRNAfMet and tRNATyr, respectively.

Growth Curves.

Growth curves were carried out using at least three replicates of each culture. Overnight cultures were diluted 100-fold in LB with antibiotics as indicated. Aliquots (200 μL) of the diluted culture were taken in honeycomb plates and shaken in an automated Bioscreen C growth reader (Oy Growth) maintained at 37 °C. The OD600 was measured at 1-h intervals, and data were plotted showing the mean values with SEs.

Determination of Initiation Rates from β-Galactosidase Induction Time Course Assay.

To assess relative initiation rates in the strains carrying mutant initiator tRNAs, a modified version of the original β-galactosidase assay (14, 29–31) was used. Details of the method are provided in SI Materials and Methods.

Preparation of Cell-Free Extracts and CAT Assays.

E. coli cells grown in 2 mL of LB containing Amp to midlog phase and processed to prepare cell-free extracts by gentle lysis were used for CAT assays (32). Details are given in SI Materials and Methods.

Supplementary Material

Supporting Information

Acknowledgments

We thank our laboratory colleagues for their suggestions on the manuscript. This work was supported by grants from the Department of Science and Technology and the Department of Biotechnology, New Delhi. S.S. is supported by a Shyama Prasad Mukherjee fellowship of the Council of Scientific and Industrial Research, New Delhi.

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1207868109/-/DCSupplemental.

References

  • 1.Seong BL, RajBhandary UL. Escherichia coli formylmethionine tRNA: Mutations in GGGCCC sequence conserved in anticodon stem of initiator tRNAs affect initiation of protein synthesis and conformation of anticodon loop. Proc Natl Acad Sci USA. 1987;84:334–338. doi: 10.1073/pnas.84.2.334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Varshney U, Lee CP, RajBhandary UL. From elongator tRNA to initiator tRNA. Proc Natl Acad Sci USA. 1993;90:2305–2309. doi: 10.1073/pnas.90.6.2305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lancaster L, Noller HF. Involvement of 16S rRNA nucleotides G1338 and A1339 in discrimination of initiator tRNA. Mol Cell. 2005;20:623–632. doi: 10.1016/j.molcel.2005.10.006. [DOI] [PubMed] [Google Scholar]
  • 4.Selmer M, et al. Structure of the 70S ribosome complexed with mRNA and tRNA. Science. 2006;313:1935–1942. doi: 10.1126/science.1131127. [DOI] [PubMed] [Google Scholar]
  • 5.Yusupov MM, et al. Crystal structure of the ribosome at 5.5 A resolution. Science. 2001;292:883–896. doi: 10.1126/science.1060089. [DOI] [PubMed] [Google Scholar]
  • 6.Kenri T, Imamoto F, Kano Y. Three tandemly repeated structural genes encoding tRNA(f1Met) in the metZ operon of Escherichia coli K-12. Gene. 1994;138:261–262. doi: 10.1016/0378-1119(94)90821-4. [DOI] [PubMed] [Google Scholar]
  • 7.Mandal N, RajBhandary UL. Escherichia coli B lacks one of the two initiator tRNA species present in E. coli K-12. J Bacteriol. 1992;174:7827–7830. doi: 10.1128/jb.174.23.7827-7830.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kenri T, Kohno K, Goshima N, Imamoto F, Kano Y. Construction and characterization of an Escherichia coli mutant with a deletion of the metZ gene encoding tRNA (f1Met) Gene. 1991;103:31–36. doi: 10.1016/0378-1119(91)90387-q. [DOI] [PubMed] [Google Scholar]
  • 9.Kenri T, Imamoto F, Kano Y. Construction and characterization of an Escherichia coli mutant deficient in the metY gene encoding tRNA(f2Met): Either tRNA(f1Met) or tRNA(f2Met) is required for cell growth. Gene. 1992;114:109–114. doi: 10.1016/0378-1119(92)90715-2. [DOI] [PubMed] [Google Scholar]
  • 10.Mandal N, Mangroo D, Dalluge JJ, McCloskey JA, Rajbhandary UL. Role of the three consecutive G:C base pairs conserved in the anticodon stem of initiator tRNAs in initiation of protein synthesis in Escherichia coli. RNA. 1996;2:473–482. [PMC free article] [PubMed] [Google Scholar]
  • 11.Das G, et al. Role of 16S ribosomal RNA methylations in translation initiation in Escherichia coli. EMBO J. 2008;27:840–851. doi: 10.1038/emboj.2008.20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kapoor S, Das G, Varshney U. Crucial contribution of the multiple copies of the initiator tRNA genes in the fidelity of tRNA(fMet) selection on the ribosomal P-site in Escherichia coli. Nucleic Acids Res. 2011;39:202–212. doi: 10.1093/nar/gkq760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lee CP, Seong BL, RajBhandary UL. Structural and sequence elements important for recognition of Escherichia coli formylmethionine tRNA by methionyl-tRNA transformylase are clustered in the acceptor stem. J Biol Chem. 1991;266:18012–18017. [PubMed] [Google Scholar]
  • 14.Dalbow DG, Young R. Synthesis time of beta-galactosidase in Escherichia coli B/r as a function of growth rate. Biochem J. 1975;150:13–20. doi: 10.1042/bj1500013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Varshney U, RajBhandary UL. Initiation of protein synthesis from a termination codon. Proc Natl Acad Sci USA. 1990;87:1586–1590. doi: 10.1073/pnas.87.4.1586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Guillon JM, Mechulam Y, Schmitter JM, Blanquet S, Fayat G. Disruption of the gene for Met-tRNA(fMet) formyltransferase severely impairs growth of Escherichia coli. J Bacteriol. 1992;174:4294–4301. doi: 10.1128/jb.174.13.4294-4301.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Newton DT, Creuzenet C, Mangroo D. Formylation is not essential for initiation of protein synthesis in all eubacteria. J Biol Chem. 1999;274:22143–22146. doi: 10.1074/jbc.274.32.22143. [DOI] [PubMed] [Google Scholar]
  • 18.Aström SU, von Pawel-Rammingen U, Byström AS. The yeast initiator tRNAMet can act as an elongator tRNA(Met) in vivo. J Mol Biol. 1993;233:43–58. doi: 10.1006/jmbi.1993.1483. [DOI] [PubMed] [Google Scholar]
  • 19.Hartz D, McPheeters DS, Green L, Gold L. Detection of Escherichia coli ribosome binding at translation initiation sites in the absence of tRNA. J Mol Biol. 1991;218:99–105. doi: 10.1016/0022-2836(91)90876-8. [DOI] [PubMed] [Google Scholar]
  • 20.Gold L. Posttranscriptional regulatory mechanisms in Escherichia coli. Annu Rev Biochem. 1988;57:199–233. doi: 10.1146/annurev.bi.57.070188.001215. [DOI] [PubMed] [Google Scholar]
  • 21.Van Duin J, Overbeek GP, Backendorf C. Functional recognition of phage RNA by 30-S ribosomal subunits in the absence of initiator tRNA. Eur J Biochem. 1980;110:593–597. doi: 10.1111/j.1432-1033.1980.tb04903.x. [DOI] [PubMed] [Google Scholar]
  • 22.Gualerzi CO, Pon CL. Initiation of mRNA translation in prokaryotes. Biochemistry. 1990;29:5881–5889. doi: 10.1021/bi00477a001. [DOI] [PubMed] [Google Scholar]
  • 23.Wu XQ, Iyengar P, RajBhandary UL. Ribosome-initiator tRNA complex as an intermediate in translation initiation in Escherichia coli revealed by use of mutant initiator tRNAs and specialized ribosomes. EMBO J. 1996;15:4734–4739. [PMC free article] [PubMed] [Google Scholar]
  • 24.Winther KS, Gerdes K. Enteric virulence associated protein VapC inhibits translation by cleavage of initiator tRNA. Proc Natl Acad Sci USA. 2011;108:7403–7407. doi: 10.1073/pnas.1019587108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Krin E, Laurent-Winter C, Bertin PN, Danchin A, Kolb A. Transcription regulation coupling of the divergent argG and metY promoters in Escherichia coli K-12. J Bacteriol. 2003;185:3139–3146. doi: 10.1128/JB.185.10.3139-3146.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Low B. Formation of merodiploids in matings with a class of Rec- recipient strains of Escherichia coli K12. Proc Natl Acad Sci USA. 1968;60:160–167. doi: 10.1073/pnas.60.1.160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA. 2000;97:6640–6645. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Gil D, Bouché JP. ColE1-type vectors with fully repressible replication. Gene. 1991;105:17–22. doi: 10.1016/0378-1119(91)90508-9. [DOI] [PubMed] [Google Scholar]
  • 29.Dalbow DG, Bremer H. Metabolic regulation of beta-galactosidase synthesis in Escherichia coli. A test for constitutive ribosome synthesis. Biochem J. 1975;150:1–8. doi: 10.1042/bj1500001b. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Tobin C, Mandava CS, Ehrenberg M, Andersson DI, Sanyal S. Ribosomes lacking protein S20 are defective in mRNA binding and subunit association. J Mol Biol. 2010;397:767–776. doi: 10.1016/j.jmb.2010.02.004. [DOI] [PubMed] [Google Scholar]
  • 31.Miller JH. In Experiments in Molecular Genetics. Cold Spring Harbor. NY: Cold Spring Harbor Lab Press; 1972. [Google Scholar]
  • 32.Varshney U, Lee CP, Seong BL, RajBhandary UL. Mutants of initiator tRNA that function both as initiators and elongators. J Biol Chem. 1991;266:18018–18024. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES