Abstract
Staphylococcus lugdunensis is recognized as one of the major pathogenic species within the genus Staphylococcus, even though it belongs to the coagulase-negative group. A multilocus sequence typing (MLST) scheme was developed to study the genetic relationships and population structure of 87 S. lugdunensis isolates from various clinical and geographic sources by DNA sequence analysis of seven housekeeping genes (aroE, dat, ddl, gmk, ldh, recA, and yqiL). The number of alleles ranged from four (gmk and ldh) to nine (yqiL). Allelic profiles allowed the definition of 20 different sequence types (STs) and five clonal complexes. The 20 STs lacked correlation with geographic source. Isolates recovered from hematogenic infections (blood or osteoarticular isolates) or from skin and soft tissue infections did not cluster in separate lineages. Penicillin-resistant isolates clustered mainly in one clonal complex, unlike glycopeptide-tolerant isolates, which did not constitute a distinct subpopulation within S. lugdunensis. Phylogenies from the sequences of the seven individual housekeeping genes were congruent, indicating a predominantly mutational evolution of these genes. Quantitative analysis of the linkages between alleles from the seven loci revealed a significant linkage disequilibrium, thus confirming a clonal population structure for S. lugdunensis. This first MLST scheme for S. lugdunensis provides a new tool for investigating the macroepidemiology and phylogeny of this unusually virulent coagulase-negative Staphylococcus.
INTRODUCTION
Since its first description in 1988, Staphylococcus lugdunensis (15) has rapidly been recognized as one of the major pathogenic species within the genus Staphylococcus, despite belonging to the coagulase-negative group. S. lugdunensis is recovered from the normal skin flora (1), and numerous infections have been related to inguinal-area carriage (37). Cutaneous infections account for more than 50% of S. lugdunensis infections (38), but tissue infections with various abscess localizations are reported, with tissue damage or poor clinical outcome (13). Bacteremia is frequently associated with endocarditis (36), which develops more frequently on native valve than on prosthetic material (28) and has a clinical course resembling Staphylococcus aureus infection (36). Hematogenic infections, such as prosthetic joint infections or osteomyelitis, are also considered as aggressive as with S. aureus (30). The pathogenic potential of S. lugdunensis, which is thus closer to that of S. aureus than those of other coagulase-negative staphylococci, may be related to virulence factors such as a fibrinogen-binding protein (25), a von Willebrand factor-binding protein (26), or synergistic hemolysins (7). In addition, the genome of S. lugdunensis N920143 contains an isd locus (19), which encodes proteins involved in iron acquisition in S. lugdunensis (18) or in cutaneous colonization in S. aureus (6).
Unlike S. aureus or numerous coagulase-negative staphylococci, S. lugdunensis remains largely susceptible to antistaphylococcal antibiotics. Penicillinase production is observed for less than 50% of isolates (14), and methicillin resistance is still rare (30, 38). However, a particular feature of S. lugdunensis is vancomycin and/or teicoplanin tolerance (4, 14). We found, by analyzing seven coagulase-negative staphylococcal species, that this glycopeptide tolerance phenomenon was restricted to S. lugdunensis. Indeed, all the S. lugdunensis isolates investigated displayed strict glycopeptide tolerance or at least decreased and slower susceptibility to glycopeptide bactericidal activity (4).
Phylogenetic analyses within pathogenic species provide precious knowledge about their genetic population structure and their relation to patterns of virulence and/or antimicrobial susceptibility. Multilocus sequence typing (MLST), which characterizes bacterial multilocus genotypes by using intragenic sequences of a set of housekeeping genes, was initially proposed for population genetics analysis of Neisseria meningitidis (12). It allowed the characterization of recombinant population structures for N. meningitidis or Streptococcus pneumoniae (10, 12) and, conversely, clonal population structure for S. aureus (8) or Clostridium difficile (21), whose mutational evolution generates deeper recognizable phylogenetic lineages. MLST has proved essential for analyzing the evolution of methicillin-resistant S. aureus clones and their filiation from ancestral methicillin-susceptible clones (9). MLST also offers the possibility to open shared sequence databases on the World Wide Web that provide an extensive and continuously updated view about the long-term epidemiology and evolution of a given species (22).
Although MLST analyses have been promoted for S. aureus (8) and Staphylococcus epidermidis (24), there is still a need for an MLST scheme devoted to S. lugdunensis, whose phylogenetic structure remains unknown. The aim of the present work was to develop an MLST scheme for S. lugdunensis and to analyze the mode of evolution of this pathogenic Staphylococcus species in relation to antimicrobial susceptibility.
MATERIALS AND METHODS
Bacterial isolates.
A total of 87 S. lugdunensis isolates were studied: S. lugdunensis ATCC 49576, S. lugdunensis ATCC 43809, S. lugdunensis ATCC 700328, and 84 human clinical isolates (skin or soft tissue isolates, osteoarticular isolates, blood isolates, and material device isolates) collected from 1991 to 2011 from 8 different geographic sources in France, Belgium, and Slovenia. Isolates were identified as S. lugdunensis by Gram stain, colony morphology, biochemical profile from the Phoenix automated microbiology system (Becton Dickinson), and detection of pyrrolidonyl-arylamidase (Oxoid biochemical identification system [O.B.I.S.]; Oxoid). For some isolates, the species identification was confirmed by real-time PCR amplification of an internal fragment of the fbl gene (5) using fbl forward (5′-GTAAATAGCGAGGCACAAGC-3′) and fbl reverse (5′-GGTAAATCGTATCTGCCGCT-3′) primers. β-Lactamine susceptibility was determined by chromogenic detection of penicillinase production (Cefinase; bioMérieux) and by the agar disk diffusion method according to the recommendations of the Comité de l'Antibiogramme de la Société Française de Microbiologie (2) for oxacillin and moxalactam (detection of methicillin resistance). The bactericidal activities of vancomycin and teicoplanin were determined previously for 13 strains (4).
PFGE.
Pulsed-field gel electrophoresis (PFGE) typing of SmaI (New England BioLabs)-digested DNA was performed as previously described (23). Briefly, genomic DNA incorporated in agarose plugs was digested at 25°C overnight, and large restriction fragments were separated in a 1% agarose gel at 14°C for 16 h by using the Gene Path system (Bio-Rad). The patterns were digitized with Molecular Analyst Fingerprinting software (Bio-Rad), and PFGE patterns were interpreted as recommended by Tenover et al. (33).
MLST.
Seven housekeeping loci were selected for the characterization of S. lugdunensis isolates by MLST (Table 1): aroE (shikimate dehydrogenase), dat (d-amino acid aminotransferase), ddl (d-alanine:d-alanine ligase), gmk (guanylate kinase), ldh (l-lactate dehydrogenase), recA (recombinase), and yqiL (acetyl-coenzyme A acetyltransferase). The choice of these housekeeping genes was based on their use in MLST schemes of S. aureus (8), S. epidermidis (34), Listeria monocytogenes (29), or C. difficile (16, 21) and on the availability of sequence data from S. lugdunensis HKU09-01 (35). The seven loci were present in single copies and physically scattered on the S. lugdunensis HKU09-01 genome.
Table 1.
Genetic polymorphism of the seven housekeeping genes analyzed by MLST
| Gene | PCR and sequencing primers (5′→3′) | Size (bp) of analyzed fragments | No. of alleles | No. of polymorphic sites | % of polymorphic sites | No. of nucleotide differences between alleles | dN/dSa |
|---|---|---|---|---|---|---|---|
| aroE | Forward, ATCGGAGATCCGATTTCACATTC; reverse, GGCGTTGTATTAATTATAATATC | 460 | 6 | 5 | 1.1 | 1–3 | 0.0628 |
| dat | Forward, TCGTGGTTATGTTTTTGGTGACGGT; reverse, CTATGAGAAGTAAAGCCAGGAAT | 412 | 8 | 7 | 1.7 | 1–4 | 0.0836 |
| ddl | Forward, AGTGCGGAGCACGACGTTTCA; reverse, ACACTTGATCCCAAATTCGCCGGT | 420 | 7 | 6 | 1.4 | 1–4 | 0.0000 |
| gmk | Forward, ATAGTTCTTTCCGGACCATC; reverse, TCATTGACTACAACGTAATCATA | 431 | 4 | 5 | 1.2 | 1–5 | 0.0000 |
| ldh | Forward, ACTTGCAGGTGCCACGTCGA; reverse, GCTACGCATTTGCAATGGTAACGCA | 414 | 4 | 5 | 1.2 | 1–4 | 0.0000 |
| recA | Forward, GCACGGCCACCAGGTGTTGT; reverse, AGGCCGTCGCGTATCTAGTGT | 463 | 5 | 4 | 0.9 | 1–3 | 0.0000 |
| yqiL | Forward, GTGCTAAACGCACACCAATTGGA; reverse, CTTCAGCATCGATTAGAGGCAC | 450 | 9 | 8 | 1.8 | 1–5 | 0.2412 |
dN/dS, ratio of nonsynonymous to synonymous substitution.
Each DNA sample for PCR amplification was extracted from a single bacterial colony from a tryptic soy agar culture using InstaGene DNA (Bio-Rad) according to the manufacturer's recommendations. PCRs were performed on a GeneAmp PCR system 9700 thermal cycler (Applied Biosystems) in a final volume of 25 μl containing 0.50 μM each primer, 12.5 μl of Reddymix (Thermo Fisher Scientific), and 5 μl of extracted DNA. The PCR mixtures were heated for 4 min at 95°C, and then a touch-down procedure was performed, consisting of 30 s at 95°C, annealing for 30 s at temperatures decreasing from 60°C to 50°C during the first 11 cycles (with 1°C decremental steps in cycles 1 to 11), and ending with an extension step at 72°C for 30 s. A total of 50 cycles were performed.
PCR products were then purified with a Nucleospin extract II kit (Macherey-Nagel) and sequenced with the same primers as for PCR by using the DTCS sequencing kit (Beckman) on a GenomeLab GeXP analyzer (Beckman Coulter). Different sequences of a given locus were given allele numbers, and each unique combination of alleles (multilocus allelic profile) was assigned a sequence type (ST). Single-point polymorphisms were assessed by sequencing both DNA strands from two separate PCR experiments.
Computer analysis of MLST data.
Clustering of the 87 isolates (and sequence data from S. lugdunensis HKU09-01) was performed using BioEdit Sequence Alignment Editor (http://www.mbio.ncsu.edu/BioEdit/bioedit.html) for alignment of the nucleotide sequences, and gene trees were constructed from sequence data using the neighbor-joining method and bootstrapping algorithms contained in MEGA 4.0 software (32). The average numbers of nucleotide differences between alleles and the ratios of nonsynonymous to synonymous substitutions (dN/dS) were calculated to test the degree of selection operating on a locus using the START program (http://www.mlst.net).
The index of association (Ia) between alleles (31) was used to test for linkage disequilibrium between alleles of the seven loci analyzed (http://www.mlst.net). The observed variance in the distribution of allelic mismatches in all pairwise comparisons of the allelic profiles was compared to that expected in a freely recombining population (linkage equilibrium). The significance of the difference in the observed and expected variances was evaluated by computing the maximum variance in the distribution of allelic mismatches obtained using 100 randomizations of the data set.
The BURST program (http://www.mlst.net) was used to define clonal complexes (CCs; groups in which every isolate shares at least five identical alleles with at least one other isolate) and to characterize ancestral genotypes and their corresponding single-locus variants (SLVs, isolates that differ at only one of the seven loci) within these clonal complexes.
RESULTS
Allelic variation in S. lugdunensis.
Data reporting the allelic variation of the seven housekeeping genes are summarized in Table 1. The number of individual alleles for each of the seven housekeeping genes ranged from 4 for gmk and ldh to 9 for yqiL. The number of polymorphic sites on a given locus varied from 4 (for recA) to 8 (for yqiL), and the maximum number of nucleotide differences between alleles of a given locus ranged from 3 for aroE and recA to 5 for yqiL and gmk. The variations in the sequences extended over the whole stretch of each of the seven genes investigated (http://www.pasteur.fr/mlst). Most polymorphisms resulted in synonymous substitutions, with the ratios of nonsynonymous to synonymous substitutions (dN/dS) varying from 0 (for ddl, gmk, ldh, and recA) to 0.2412 (for yqiL). These low ratios indicate a lack or a very limited contribution of environmental selection to the sequence variation in the seven housekeeping genes analyzed, which are thus assumed to be suitable for a population genetic study.
MLST analysis of S. lugdunensis isolates.
MLST analysis of the 87 S. lugdunensis isolates generated a total of 20 different STs (Table 2). For each ST shared by at least two isolates, PFGE analysis displayed identical or closely related profiles, further arguing for probable clonal relationships between these isolates. An MLST database specific for this species and containing allelic and ST data has been made available on the website of the Pasteur Institute of Paris (http://www.pasteur.fr/mlst).
Table 2.
Characteristics of the 20 allelic profiles (STs) and clonal complexes
| STa | Allelic profile |
Clonal complex | No. of isolates | Geographic origin(s)b | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| aroE | dat | ddl | gmk | ldh | recA | yqiL | ||||
| 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | CC1 | 11 | A, B, C, D, F |
| 2 | 3 | 3 | 2 | 2 | 1 | 2 | 3 | CC2c | 15 | A, B, D, E, G |
| 3 | 4 | 3 | 4 | 2 | 3 | 4 | 6 | CC3c | 18 | A, B, C, D, E, F |
| 4 | 6 | 4 | 3 | 1 | 1 | 3 | 3 | CC4 | 3 | A, C |
| 5 | 5 | 6 | 5 | 3 | 4 | 4 | 7 | CC5 | 4 | A, B, C |
| 6 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | CC1c | 8 | A, B |
| 7 | 1 | 1 | 1 | 1 | 1 | 1 | 9 | CC1 | 1 | D |
| 8 | 2 | 3 | 2 | 2 | 1 | 2 | 3 | CC2 | 1 | A |
| 9 | 1 | 4 | 3 | 1 | 1 | 3 | 4 | CC3 | 1 | A |
| 10 | 3 | 5 | 2 | 2 | 2 | 3 | 5 | 8 | A, B, C, F | |
| 11 | 1 | 1 | 1 | 1 | 1 | 6 | 1 | CC1 | 1 | —d |
| 12 | 1 | 1 | 7 | 1 | 1 | 1 | 2 | CC1 | 4 | A, C |
| 13 | 3 | 3 | 6 | 4 | 1 | 5 | 3 | 3 | A, G | |
| 14 | 3 | 3 | 2 | 2 | 1 | 2 | 5 | CC2 | 1 | B |
| 15 | 1 | 2 | 1 | 1 | 1 | 1 | 2 | CC1 | 4 | A, D, E |
| 16 | 5 | 3 | 4 | 2 | 3 | 1 | 6 | CC4 | 1 | A |
| 17 | 6 | 4 | 6 | 1 | 1 | 3 | 3 | CC3 | 1 | D |
| 18 | 5 | 6 | 5 | 3 | 4 | 4 | 8 | CC5 | 1 | D |
| 19 | 3 | 7 | 2 | 2 | 1 | 2 | 3 | CC2 | 1 | C |
| 20 | 4 | 8 | 4 | 2 | 3 | 4 | 6 | CC4 | 1 | C |
ST, sequence type.
Geographic origins are as follows: A, Rouen, France; B, Nantes, France; C, Nancy, France; D, Bordeaux, France; E, Montpellier, France; F, Versailles, France; G, Louvain, Belgium; H, Maribor, Slovenia.
Ancestral genotype within the clonal complex.
S. lugdunensis HKU09-01, unknown geographic source (35).
The results of clustering from concatenated sequence data are shown in Fig. 1. Half of the STs were represented by a single isolate. Among STs shared by several isolates, the most frequently encountered were ST3 (18 isolates), ST2 (15 isolates), and ST1 (11 isolates). Five clonal complexes (CCs) could be characterized by using the method and the criteria described by Feil et al. (11) (Table 2). The ancestral genotypes and their single-locus variants (probable derived genotypes) could be identified for CC1, CC2, and CC3 (Fig. 2). Of note, the sl96 strain, corresponding to the first published complete genome of S. lugdunensis, belongs to CC1 but harbors a unique ST (ST11).
Fig 1.
Dendrogram showing genetic relationships of the 87 S. lugdunensis isolates (and sequence data from S. lugdunensis HKU09-01) based on the composite sequence of the seven housekeeping genes (aroE, dat, ddl, gmk, ldh, recA, and yqiL). Clonal complexes (CC) are represented with brackets. Rooting of the dendrogram was established using homologous sequence data from Staphylococcus haemolyticus JCSC1435. Origin: A, Rouen, France; B, Nantes, France; C, Nancy, France; D, Bordeaux, France; E, Montpellier, France; F, Versailles, France; G, Louvain, Belgium; and H, Maribor, Slovenia. Clinical source: OA, osteoarticular; SST, skin and soft tissue; M, material device; B, blood. Penicillin: R, resistant; S, susceptible. *, ref1 (reference sequence 1), S. lugdunensis ATCC 700328; ref2, S. lugdunensis ATCC 43809; ref3, S. lugdunensis ATCC 49576; **, sl96 is S. lugdunensis HKU09-01.
Fig 2.
Clonal complexes with ancestral genotypes identified. (A) Clonal complex 1, including ST6 (ancestral genotype), ST1, ST7, ST12, and ST15 (descended from single-locus variant genotypes), and ST11 (descended from double-locus variant genotype). (B) Clonal complex 2, including ST2 (ancestral genotype) and ST8, ST14, and ST19 (descended from single-locus variant genotypes). (C) CC3 including ST3 (ancestral genotype) and ST16 and ST20 (descended from single-locus variant genotypes).
Dendrograms based on sequence data of each housekeeping gene.
Dendrograms from the sequences of the seven separate housekeeping genes were found to be congruent overall, indicating a predominantly mutational evolution of these genes. No recombinational event could be detected by comparing monolocus trees (data not shown).
Estimation of the relative contributions of recombination and mutation to genomic evolution of S. lugdunensis.
Since the congruence of dendrograms based on allelic variation of each housekeeping gene suggested a low frequency of recombination, a quantitative analysis of the linkage between alleles from the seven loci was performed by calculating the index of association (Ia) (31). When all the isolates were included in the analysis, a significant linkage disequilibrium was detected (Ia of 2.91). At the level of STs (one isolate from each ST, to avoid bias due to a possible epidemic population structure), Ia was calculated at 1.88, confirming the significant linkage disequilibrium between alleles and, thus, a clonal structure of the population studied.
Clustering of S. lugdunensis isolates.
No correlation was found between genotype and geographic origin; for example, ST3, the ancestral genotype of CC3, was shared by isolates from 6 geographic origins. Similarly, ST1 and ST2 were each shared by isolates from 5 different geographic origins. Isolates recovered from hematogenic infections (blood or osteoarticular isolates) or from skin and soft tissue infections did not cluster in separate lineages.
Twenty-seven S. lugdunensis isolates (31% of isolates) were found to be resistant to penicillin G by penicillinase production; no isolate exhibited methicillin resistance. Three STs belonging to CC1 (ST6, the ancestral genotype, and ST12 and ST15) contained 13 of the 27 penicillin-resistant isolates and contained only 4 penicillin-susceptible isolates, indicating that penicillin-resistant isolates are associated with this phylogenetic lineage. Conversely, ST1 and ST7, which were also inferred to derive from the ancestral genotype ST6 in CC1, contain only penicillin-susceptible isolates, indicating the possible loss of the penicillinase-encoding plasmid. Alternatively, they may represent ancestral genotypes predating the clonal expansion of ST6 after the acquisition of resistance.
The six isolates that we previously characterized as exhibiting glycopeptide (vancomycin and/or teicoplanin) tolerance (4) belonged to five different STs (ST6, ST15, ST8, ST9, and ST10) and to three clonal complexes (CC1, CC2, and CC4) and, thus, did not define a specific lineage. In addition, two STs (ST6 and ST10) included both nontolerant isolates and glycopeptide-tolerant isolates, and ST5 included a nontolerant isolate together with a vancomycin-tolerant isolate. Overall, these data suggest that glycopeptide-tolerant isolates do not constitute a distinct subpopulation within S. lugdunensis, implying multiple independent evolution of the genetic elements involved in this phenotype by isolates from different genetic backgrounds.
DISCUSSION
The aim of the present study was to design an MLST scheme, based on the allelic polymorphism of seven housekeeping genes, which should be suitable for population genetics and intraspecific phylogeny analysis of S. lugdunensis. Only macrorestriction PFGE (37) had been used previously for molecular typing of this organism, but this approach would not, henceforward, constitute the reference method for these purposes.
We analyzed 87 S. lugdunensis isolates from various clinical infections and geographic sources. The allelic polymorphism (number of distinct STs among the isolates and number of polymorphic sites per locus) appears lower than that of S. aureus or S. epidermidis, which themselves display a moderate genetic variability, with few well-conserved phylogenetic lineages (17, 24). The low apparent rate of recombination results in a clonal population structure for S. lugdunensis, as illustrated by the index of association between alleles of the different loci, which reveals linkage disequilibrium (31), the congruence of dendrograms of individual housekeeping genes, and the characterization of clonal complexes within the population studied. Thus, if homologous recombination does exist, it rarely contributes to the evolution of S. lugdunensis. Sequence data analysis revealed that only synonymous substitutions were detected in genes ddl, gmk, ldh, and recA, suggesting that most nonsilent mutations are eliminated through purifying selection.
PFGE typing allowed us to check for the lack of an epidemiological link between isolates sharing the same ST. Since PFGE was unable to further resolve these MLST clusters, this method did not demonstrate a clear improvement in the discrimination of isolates compared to MLST; thus, MLST should be proposed as an efficient alternative approach for molecular typing of S. lugdunensis, with the additional advantage of providing unambiguous and portable sequence data suited for large-scale epidemiology.
Although S. lugdunensis is recognized as one of the major pathogenic species within the genus Staphylococcus, little is known about the virulence determinants implicated in invasive infections. In the present study, isolates from skin and soft tissue infections or from hematogenic infections (blood or osteoarticular isolates) were found to be randomly distributed in the main lineages depicted from the MLST dendrogram. It should be informative to further analyze allelic polymorphism of genes encoding fibrinogen-binding protein (25), von Willebrand factor-binding protein (26), or synergistic hemolysins (7), which have been proposed as virulence determinants of S. lugdunensis, and to investigate how this variation is related to MLST data. This could contribute to the description of putative hypervirulent lineages within the species.
S. lugdunensis remains largely susceptible to antibiotics and, surprisingly, displays a low frequency of methicillin resistance, unlike other coagulase-negative staphylococci or S. aureus. The present collection of clinical isolates is concordant with these data, with 31% of isolates producing penicillinase and a lack of methicillin-resistant isolates. Half of the penicillinase-producing isolates belong to a single clonal complex (CC1), reflecting vertical transmission within this lineage. Of note, ST1 and ST7, which are single-locus variants of the ST6 ancestral genotype of CC1, contain penicillin-susceptible isolates, suggesting a probable loss of the penicillinase-encoding plasmid or transposon (19, 20). Besides this clonal complex, penicillinase-producing isolates are widely distributed, either as a result of horizontal transmission or multiple independent acquisitions. Concerning methicillin resistance, which is still uncommon in S. lugdunensis, collecting MLST data from methicillin-resistant isolates could allow the study of their filiation from ancestral methicillin-susceptible clones, as was successfully deduced from MLST data for S. aureus (9, 27).
Vancomycin and/or teicoplanin tolerance (lack of bactericidal activity of these presumed bactericidal antibiotics) appears as a particular feature of S. lugdunensis (4, 14). We previously investigated a total of 13 isolates for glycopeptide tolerance and characterized six isolates tolerant to vancomycin and/or teicoplanin (4). These six tolerant isolates are distributed in different MLST lineages in the present study, and some STs (ST6, ST10, and ST5) include both nontolerant and glycopeptide-tolerant isolates. Thus, although glycopeptide tolerance was not investigated in the whole population analyzed by MLST, it may be assumed that this phenomenon is not restricted to a distinct subpopulation within S. lugdunensis. Further studies are currently in progress to investigate the implication of the major peptidoglycan hydrolase AtlL (3) in this impaired bactericidal activity of vancomycin and/or teicoplanin.
This work provides the first phylogenetic analysis of S. lugdunensis and gives strong arguments for a clonal population structure and mutational evolution of this pathogen. MLST combines the advantages of (i) a sequence-based typing method, which makes the data unambiguous and readily comparable between different laboratories, and (ii) a phylogenetic approach to genetic diversity, since it is based on sequence polymorphism of housekeeping genes apart from selective pressure. The S. lugdunensis MLST database, which is hosted at the website of the Institut Pasteur Paris (http://www.pasteur.fr/mlst), should be enriched from sequence data from worldwide and clinically diverse isolates, to follow the global epidemiology and evolution within the species. In addition, MLST data could be used as typing markers, possibly in combination with virulence gene data, to increase the discriminatory power and to investigate the short-term epidemiology of S. lugdunensis, which remains until now poorly investigated.
ACKNOWLEDGMENTS
We thank M. Delmée, F. Doucet-Populaire, V. Dubois, G. Grise, H. Marchandin, A. Morel, F. Mory, A. Reynaud, and M. Rupnik for supplying strains.
Footnotes
Published ahead of print 11 July 2012
REFERENCES
- 1. Bieber L, Kahlmeter G. 2010. Staphylococcus lugdunensis in several niches of the normal skin flora. Clin. Microbiol. Infect. 16:385–388 [DOI] [PubMed] [Google Scholar]
- 2. Bonnet R, et al. 2011. Comité de l'Antibiogramme de la Société Française de Microbiologie. Recommandations 2011. Société Française de Microbiologie, Paris, France [Google Scholar]
- 3. Bourgeois I, et al. 2009. Characterization of AtlL, a bifunctional autolysin of Staphylococcus lugdunensis with N-acetylglucosaminidase and N-acetylmuramoyl-l-alanine amidase activities. FEMS Microbiol. Lett. 290:105–113 [DOI] [PubMed] [Google Scholar]
- 4. Bourgeois I, Pestel-Caron M, Lemeland JF, Pons JL, Caron F. 2007. Tolerance to the glycopeptides vancomycin and teicoplanin in coagulase-negative staphylococci. Antimicrob. Agents Chemother. 51:740–743 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Chatzigeorgiou KS, Siafakas N, Petinaki E, Zerva L. 2010. fbl gene as a species-specific target for Staphylococcus lugdunensis identification. J. Clin. Lab. Anal. 24:119–122 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Clarke SR, et al. 2007. The Staphylococcus aureus surface protein IsdA mediates resistance to innate defenses of human skin. Cell Host Microbe 1:199–212 [DOI] [PubMed] [Google Scholar]
- 7. Donvito B, et al. 1997. Synergistic hemolytic activity of Staphylococcus lugdunensis is mediated by three peptides encoded by a non-agr genetic locus. Infect. Immun. 65:95–100 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. 2000. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 38:1008–1015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Enright MC, et al. 2002. The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proc. Natl. Acad. Sci. U. S. A. 99:7687–7692 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Enright MC, Spratt BG. 1998. A multilocus sequence typing scheme for Streptococcus pneumoniae: identification of clones associated with serious invasive disease. Microbiology 144 (Pt 11):3049–3060 [DOI] [PubMed] [Google Scholar]
- 11. Feil EJ, Li BC, Aanensen DM, Hanage WP, Spratt BG. 2004. eBURST: inferring patterns of evolutionary descent among clusters of related bacterial genotypes from multilocus sequence typing data. J. Bacteriol. 186:1518–1530 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Feil EJ, Maiden MC, Achtman M, Spratt BG. 1999. The relative contributions of recombination and mutation to the divergence of clones of Neisseria meningitidis. Mol. Biol. Evol. 16:1496–1502 [DOI] [PubMed] [Google Scholar]
- 13. Frank KL, Del Pozo JL, Patel R. 2008. From clinical microbiology to infection pathogenesis: how daring to be different works for Staphylococcus lugdunensis. Clin. Microbiol. Rev. 21:111–133 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Frank KL, Reichert EJ, Piper KE, Patel R. 2007. In vitro effects of antimicrobial agents on planktonic and biofilm forms of Staphylococcus lugdunensis clinical isolates. Antimicrob. Agents Chemother. 51:888–895 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Freney J, et al. 1988. Staphylococcus lugdunensis sp. nov. and Staphylococcus schleiferi sp. nov. Two species from human clinical specimens. Int. J. Sys. Bacteriol. 38:168–172 [Google Scholar]
- 16. Griffiths D, et al. 2010. Multilocus sequence typing of Clostridium difficile. J. Clin. Microbiol. 48:770–778 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Grundmann H, et al. 2002. Determining the genetic structure of the natural population of Staphylococcus aureus: a comparison of multilocus sequence typing with pulsed-field gel electrophoresis, randomly amplified polymorphic DNA analysis, and phage typing. J. Clin. Microbiol. 40:4544–4546 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Haley KP, Janson EM, Heilbronner S, Foster TJ, Skaar EP. 2011. Staphylococcus lugdunensis IsdG liberates iron from host heme. J. Bacteriol. 193:4749–4757 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Heilbronner S, et al. 2011. Genome sequence of Staphylococcus lugdunensis N920143 allows identification of putative colonization and virulence factors. FEMS Microbiol. Lett. 322:60–67 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Kotsakis SD, Tzouvelekis LS, Zerva L, Liakopoulos A, Petinaki E. 2012. Staphylococcus lugdunensis strain with a modified PBP1A/1B expressing resistance to beta-lactams. Eur. J. Clin. Microbiol. Infect. Dis. 31:169–172 [DOI] [PubMed] [Google Scholar]
- 21. Lemee L, Dhalluin A, Pestel-Caron M, Lemeland JF, Pons JL. 2004. Multilocus sequence typing analysis of human and animal Clostridium difficile isolates of various toxigenic types. J. Clin. Microbiol. 42:2609–2617 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Lemee L, Pons JL. 2010. Multilocus sequence typing for Clostridium difficile. Methods Mol. Biol. 646:77–90 [DOI] [PubMed] [Google Scholar]
- 23. Maslow JN, Slutsky AM, Arbeit RD. 1993. Application of pulsed-field gel electrophoresis to molecular epidemiology, p 563–572 In Persing DH, Smith TF, Tenover FC, White TJ. (ed), Diagnostic molecular microbiology: principles and applications. American Society for Microbiology, Washington, DC [Google Scholar]
- 24. Miragaia M, Thomas JC, Couto I, Enright MC, de Lencastre H. 2007. Inferring a population structure for Staphylococcus epidermidis from multilocus sequence typing data. J. Bacteriol. 189:2540–2552 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Nilsson M, Bjerketorp J, Guss B, Frykberg L. 2004. A fibrinogen-binding protein of Staphylococcus lugdunensis. FEMS Microbiol. Lett. 241:87–93 [DOI] [PubMed] [Google Scholar]
- 26. Nilsson M, et al. 2004. A von Willebrand factor-binding protein from Staphylococcus lugdunensis. FEMS Microbiol. Lett. 234:155–161 [DOI] [PubMed] [Google Scholar]
- 27. Oliveira DC, Tomasz A, de Lencastre H. 2002. Secrets of success of a human pathogen: molecular evolution of pandemic clones of meticillin-resistant Staphylococcus aureus. Lancet Infect. Dis. 2:180–189 [DOI] [PubMed] [Google Scholar]
- 28. Patel R, et al. 2000. Frequency of isolation of Staphylococcus lugdunensis among staphylococcal isolates causing endocarditis: a 20-year experience. J. Clin. Microbiol. 38:4262–4263 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Ragon M, et al. 2008. A new perspective on Listeria monocytogenes evolution. PLoS Pathog. 4:e1000146 doi:10.1371/journal.ppat.1000146 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Shah NB, et al. 2010. Laboratory and clinical characteristics of Staphylococcus lugdunensis prosthetic joint infections. J. Clin. Microbiol. 48:1600–1603 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Smith JM, Smith NH, O'Rourke M, Spratt BG. 1993. How clonal are bacteria? Proc. Natl. Acad. Sci. U. S. A. 90:4384–4388 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24:1596–1599 [DOI] [PubMed] [Google Scholar]
- 33. Tenover FC, et al. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233–2239 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Thomas JC, et al. 2007. Improved multilocus sequence typing scheme for Staphylococcus epidermidis. J. Clin. Microbiol. 45:616–619 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Tse H, et al. 2010. Complete genome sequence of Staphylococcus lugdunensis strain HKU09-01. J. Bacteriol. 192:1471–1472 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Vandenesch F, Etienne J, Reverdy ME, Eykyn SJ. 1993. Endocarditis due to Staphylococcus lugdunensis: report of 11 cases and review. Clin. Infect. Dis. 17:871–876 [DOI] [PubMed] [Google Scholar]
- 37. van der Mee-Marquet N, et al. 2003. Staphylococcus lugdunensis infections: high frequency of inguinal area carriage. J. Clin. Microbiol. 41:1404–1409 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Wu AB, et al. 2011. Clinical and microbiological characteristics of community-acquired Staphylococcus lugdunensis infections in Southern Taiwan. J. Clin. Microbiol. 49:3015–3018 [DOI] [PMC free article] [PubMed] [Google Scholar]