Pregabalin Suppresses Spinal Neuronal Hyperexcitability and Visceral Hypersensitivity in the Absence of Peripheral Pathophysiology

Abstract

Background

Opioid induced hyperalgesia is recognised in the laboratory and the clinic, generating central hyperexcitability in the absence of peripheral pathology. We investigated pregabalin, indicated for neuropathic pain, and ondansetron, a drug that disrupts descending serotonergic processing in the central nervous system, on spinal neuronal hyperexcitability and visceral hypersensitivity in a rat model of opioid induced hyperalgesia.

Methods

Sprague-Dawley rats (180-200 g) were implanted with morphine (90μg · μl⁻¹ · hr⁻¹) or saline (0.9% w/v) filled osmotic mini-pumps. On days 7-10 in isoflurane anaesthetized animals we evaluated the effects of (a) systemic pregabalin on spinal neuronal and visceromotor responses and (b) spinal ondansetron on dorsal horn neuronal responses. The messenger RNA levels of α₂δ-1, 5HT3A and mu-opioid receptor in the dorsal root ganglia of all animals were analysed.

Results

In morphine-treated animals the evoked spinal neuronal responses were enhanced to a sub-set of thermal and mechanical stimuli. This activity was attenuated by pregabalin (by at least 71%) and ondansetron (37%), and the visceromotor response to a sub-set of colorectal distension pressures was attenuated by pregabalin (52.8%) (n = 8 for all measures, P < 0.05). Messenger RNA levels were unchanged.

Conclusions

The inhibitory action of pregabalin in opioid induced hyperalgesia animals is not neuropathy-dependent nor reliant on up-regulation of the α₂δ-1 subunit of voltage gated calcium channels, mechanisms proposed essential for pregabalin’s efficacy in neuropathy. In opioid induced hyperalgesia, which extends to colonic distension, a serotonergic facilitatory system may be upregulated creating an environment that’s permissive for pregabalin-mediated analgesia without peripheral pathology.

Introduction

The mode of action of drugs used in the clinic may allow their effectiveness to extend to more than one type of pain. Many pains involve disordered function of peripheral processes but these may not be necessary for central actions of drugs.

Opiate analgesics remain the primary source of pain relief in conditions ranging from acute pain and postoperative pain to chronic pain. Unfortunately, chronic opioid consumption can generate opioid induced hyperalgesia (OIH). OIH is characterised by a lowered pain threshold, and is recognised in both the clinic and the laboratory.^1-4 Mechanisms proposed to be essential for the development of OIH include neuroadaptive alterations in the pain modulatory circuitry^5-7 and enhanced descending facilitation to the spinal cord from higher central nervous system centres, which may lead to spinal cord hyperexcitability that supports the development and maintenance of OIH.⁸ However, evidence for nociceptive sensitivity to visceral stimuli in OIH animal models is lacking.

Pregabalin attenuates enhanced neuronal responses to peripheral somatic inputs following nerve injury but also shows analgesic efficacy in acute colorectal distension (CRD) models of visceral pain.^9-11 The analgesic actions of pregabalin in neuropathy are proposed to be state-dependent and rely on up-regulation of the α₂δ-1 subunit of voltage gated calcium channels to which it binds to disrupt channel trafficking.^12,13 Pregabalin antinociception is also thought to involve interactions with a spinal-bulbo-spinal loop that comprises projection neurones in the superficial dorsal horn and brainstem descending 5-HT3 receptor-mediated facilitations.¹⁴ Gabapentinoids may activate noradrenergic neurons in the brain stem via a glutamate-dependent mechanism, producing antihypersensitivity after nerve injury,¹⁵ and have previously been shown to prevent behavioural OIH.¹⁶

In a rat model of OIH we confirmed the presence of spinal neuronal hyperexcitability in the absence of peripheral pathology and investigated whether visceral hypersensitivity was present. We examined the efficacy of systemic pregabalin on reducing these hypersensitivities and clarified whether any inhibitory actions observed were attributable to up-regulation of α₂δ-1 subunits. We also investigated whether spinal ondansetron, a selective 5HT3 receptor antagonist, attenuated dorsal horn neuronal hypersensitivity in a similar fashion to that which occurs in a spinal nerve injury model of neuropathy, and subsequently whether it interacted with the analgesic actions of pregabalin.

Materials and Methods

Animal experiments, approved by the United Kingdom Home Office, were performed according to guidelines set by personal and project licenses complying with the United Kingdom Animals (Scientific Procedures) Act 1986 and University College London biological services ethical review committee.

Sustained morphine administration

Male Sprague-Dawley rats (180-200 g) were implanted subcutaneously with saline (0.9 %, 0.5 μl/hr) or morphine (90μg · μl⁻¹ · hr⁻¹) filled osmotic mini-pumps (Alzet Minipump, Cupertino, California) under isofluorane anesthesia (1.5% v/v) delivered in a gaseous mix of nitrous oxide (66%) and oxygen (33%). The investigators were blinded to saline- versus morphine-treated animals.

Behavioural tests

Behavioural responses were recorded on days 5 – 8. Plantar hind paw sensitivity to mechanical punctate stimulation was assessed through measurement of hind paw withdrawal frequency to a trial of 10 applications (5 s each) of calibrated von Frey filaments (increasing bending force vF 1, 6 and 8 g). Cold sensitivity was assessed as hind paw withdrawal frequency to five applications of acetone.

Electrophysiology

In vivo electrophysiology experiments were conducted on days 7-10 in anesthetised rats as previously described.¹⁷ Briefly, animals were anesthetised and maintained for the experiment with isofluorane (1.5% v/v) delivered in a gaseous mix of nitrous oxide (66%) and oxygen (33%). A laminectomy exposed L4-5 segments of the spinal cord. Extracellular recordings were made from deep dorsal horn wide dynamic range (WDR) spinal neurons (lamina V-VI) using parylene coated tungsten electrodes (A-M systems, Carlsborg, WA).

Electrical activation of WDR neurons was delivered via stimulating needles inserted into the peripheral receptive field. A train of 16 transcutaneous electrical stimuli was applied at 3 times the threshold current for C-fibre activation of the spinal neuron. A post-stimulus histogram was constructed and responses evoked by Aβ- (0-20 ms), Aδ- (20-90 ms) and C-fibres (90-350 ms), or post-discharge (350-800 ms), were separated and quantified on the basis of latency. Input, a measure of presynaptic activity and wind-up, a measure of spinal post-synaptic hyperexcitabilty was quantified.¹⁷ Natural stimulation of the WDR neurons was delivered via mechanical punctate (vF 2, 8, 26, and 60 g) and thermal (40, 45, and 48 °C, applied with a constant water jet) stimulation (spike counts captured over 10 s) of the peripheral receptive field.

Data was captured and analysed by a Cambridge Electronic Design 1401 interface coupled to a Pentium computer with Spike 2 software (post-stimulus time histogram and rate functions) (Cambridge, United Kingdom). Following three consecutive stable baseline responses to natural stimuli (values were averaged to give the predrug control values), pharmacological assessment was carried out (one neuron per animal only).

Drug administration

Ondansetron (100 μg) (Zofran TM Glaxo-Wellcome, Harlow, Hertfordshire, United Kingdom) was administered via topical spinal application to investigate the role of spinal 5HT3 receptors. Pregabalin (10 mg/kg and 30 mg/kg, dissolved in 0.9% saline solution) (Pfizer, Sandwich, United Kingdom) was administered via subcutaneous injection for systemic exposure, as used clinically. All drug effects were monitored at 20, 40, and 60 min and are expressed as the mean maximal evoked neuronal response for each dose, unless stated otherwise. Drug effects were not dependent on the control baseline level of activity.

CRD model of visceral pain

Experiments were conducted on days 7-10 in anesthetised rats. Tracheotomies were performed as previously described.¹⁷ Animals were anesthetised with isofluorane (1.5% v/v) delivered in a gaseous mix of nitrous oxide (66%) and oxygen (33%) prior to intraanal insertion (1 cm) of a 7 cm latex balloon tied with silk thread to a cannula perforated throughout a 5 cm tip. An enamel-coated copper electrode was sewn into the right external oblique muscle.

Isofluorane was maintained at 1% v/v during recording. CRD (10 mmHg up to 80 mmHg) was produced by inflating the balloon through a pressure amplifier for 30 s with 3 minutes between each distension and 15 min between each series. Captured signals from muscle activity were amplified, filtered and displayed on an oscilloscope, and signals were further integrated to produce electromyography values via Spike4 software (Cambridge Electronic Design). The mean electromyographic values evoked during CRD over 30 s (the visceromotor responses, VMR’s), were used for further analysis. Following pregabalin administration (30 mg/kg), drug effect was analysed at 20 and 60 min.

Quantitative Polymerase Chain Reaction (PCR)

We analysed the α₂δ-1, 5HT3A and MOR1 messenger RNA (mRNA) levels in dorsal root ganglia (DRG) for the primary afferents innervating the peripheral receptive field (L4-5) of the WDR neurons. On post-operative days 7-10, DRG from morphine- and saline-treated animals were harvested, pooled as two separate groups, and stored (−80 °C). Quantitative PCR (Q-PCR) was performed as described previously.¹⁸ Briefly, RNA was extracted from pulverized DRG and isolated using RNeasy columns (Qiagen, Crawley, West Sussex, United Kingdom), with on-column DNase step. Reverse transcription was carried out on 1 μg RNA using the iScript kit with random primers (BioRad, Hercules, CA). Q-PCR was performed with an iCycler (BioRad) using the iQ SYBR supermix (BioRad). For each set of primers and for every experiment a standard curve was generated using a serial dilution of reverse-transcribed RNA from the combined samples. The following Q-PCR primers were used: rat GAPDH: 5′-ATGACTCTACCCACGGCAAG-3′ (forward), 5′–CATACTCTGCACCAGCATCTC-3′ (reverse); rat α₂δ-1 : 5′–AGTCTATGTGCCATCAATTAC–3′ (forward), 5 ′-AGTCATCCTCTTCCATTTCAAC-3′ (reverse) ; rat 5HT3A : 5′-AGCCTTGACATCTATAACTTCC-3′ (forward), 5′-TCCGACCTCACTTCTTCTG-3′ (reverse); rat MOR: 5′-GCCCTCTACTCTATCGTGTGTGTA-3′ (forward), 5′-GTTCCCATCAGGTAGTTGACACTC-3′ (reverse).

Statistics

Analyses were performed using GraphPad Prism version 4 for Apple Macintosh OS 10.4 (GraphPad software, La Jolla, CA). All data are presented as mean ± standard error of the mean (SEM) unless stated otherwise. Behavioural data were analysed using the nonparametric Mann-Whitney test, comparing number of withdrawal responses between saline- and morphine-treated animals. Statistical analysis of electrophysiological data was as follows: Control responses, expressed as number of action potentials, were established for all evoking stimuli prior to pharmacological manipulation for each neuron/animal. Differences between naïve, saline and morphine groups with respect to predrug electrically-evoked baseline responses were analysed using a one-way ANOVA followed by Bonferroni post-hoc test if a significant difference was observed. A two-way ANOVA followed by Bonferroni post-hoc test was used to compare the baseline natural evoked neuronal responses in animal groups. Here, the nature of the stimulus in terms of force or temperature, were factors. A one-way ANOVA, followed by Dunnett’s post-hoc multiple comparisons test for significant values, was used to evaluate the effect of pregabalin and ondansetron on electrically evoked responses in animal groups. A two-way ANOVA, followed by Bonferroni post-hoc test, was used to evaluate the effect of pregabalin and ondansetron on the evoked responses, again using action potential counts, to natural stimuli in the animal groups. In these latter studies within each factor, time (of the drug effect) was a level.

Statistical analysis of Q-PCR data was as follows: For each set of primers and for every experiment a standard curve was generated using a serial dilution of reverse-transcribed RNA from the combined samples. Data were normalised for expression of glyceraldehyde-3-phosphatedehydrogenase mRNA level. Data from the saline- and morphine-treated animals were then normalised to the mean of the saline group for the corresponding 3 measures (mRNA level = 100%) and given as the mean ± SEM. Statistical significance of Q-PCR results from both animal groups was determined by Student’s nonpaired t-test.

Statistical analysis of VMR data was as follows: Electromyography values were integrated with subtracted baselines and postdrug data was normalised for each animal to the mean control electromyography values. Normalised electromyography data was evaluated with both the Kolmogorov-Smirnov (with Dallal-Wilkinson-Lilliefor P value) and the D’Agostino and Pearson omnibus normality tests to confirm that data was normally distributed. A two-way ANOVA with repeated measures and Bonferroni posttests was used to determine statistical significance throughout the range of CRD pressures between the recording time points for the pregabalin time course in animal groups.

All data sets were complete with no lost data.

For all analyses, statistical significance was set at P < 0.05 in the text, and *P < 0.05, **P < 0.01, ***P < 0.001 in the figures.

Results

Behavioural hypersensitivity and spinal neuronal hyperexcitability is evident in morphine-treated animals

Saline- (n = 16) and morphine-treated (n = 20) animals were tested for signs of behavioural hypersensitivity on days 5 – 8. The hind paw withdrawal frequencies per animal, per stimulus (vF 1, 6, and 8 g), per day were pooled. A significant increase in hind paw withdrawal frequency was observed in morphine-treated animals (fig. 1A). The median withdrawal frequency significantly increased from 10 to 40 (interquartile range increase from 10 to 40) with vF 6 g in morphine-treated animals. Application of acetone produced little or no evoked hind paw withdrawal response in either group (data not shown).

Fig. 1.

Altered behavioural activity and response profile of dorsal horn wide dynamic range spinal neurons following sustained morphine exposure in rats. Results are presented as mean ± standard error of the mean. Following 5 – 8 days of chronic morphine- (n = 20) or saline- (n = 16) treatment, hind paw withdrawal frequencies to von Frey (vF, g) filaments of increasing force were recorded (A). Following 7 – 10 days, the evoked neuronal responses to electrical (B), mechanical (C) and thermal (D) stimuli were recorded in naïve (n = 27), saline- (n = 12) and morphine-treated (n = 17) animals. Sustained morphine exposure increased the excitability of spinal neurons to peripherally applied natural stimuli. Based on latency measurements neuronal responses were subdivided into Aβ-, Aδ- and C-fibres, or post-discharge. See methods for further details. Significant differences from saline group baseline responses: * P < 0.05, ** P < 0.01, ***P < 0.001.

Subsequently, naïve (n = 27), morphine- (n = 17) and saline-treated (n = 12) animals were used for spinal neuronal electrophysiology. The mean baseline evoked neuronal response to electrical and natural stimulation was not significantly different between the two control groups (P > 0.05), thus all results are discussed as a statistical comparison of evoked responses between saline- and morphine-treated animals. Morphine-treated animals showed a significant increase in C-fibre activity, evoked neuronal response to brush, response to innocuous and noxious mechanical stimuli and response to noxious temperatures (figs. 1B, C and D). Modest increases in responses to the lower mechanical forces and temperatures were observed but responses to the higher intensities of both modalities were in the order of 2- to 3-fold higher.

Pregabalin reduces spinal neuronal hyperexcitability in morphine-treated animals

Systemic pregabalin (10 mg/kg) was administered and the evoked response was recorded at 20, 40, and 60 min in saline- and morphine-treated animals (both groups n = 8). After this time, systemic pregabalin (30 mg/kg) was administered and the experimental assay was repeated.

Pregabalin (30 mg/kg) significantly reduced Aβ-, Aδ- and C-fibre evoked activity, post-discharge, input and sensitivities to brush stimulation in morphine- but not saline-treated animals (fig. 2A). Pregabalin (10 mg/kg) significantly reduced the evoked neuronal response in morphine- but not saline-treated animals to noxious mechanical and thermal stimuli. Pregabalin (30 mg/kg) produced marginally greater inhibitory effects than the lower dose (figs. 2B, C, D, and E).

Fig. 2.

The effect of systemic pregabalin (10 mg/kg and 30 mg/kg) on the mean baseline response values of dorsal horn wide dynamic range spinal neurons in saline- and morphine-treated animals (both groups n = 8). Results are presented as mean ± standard error of the mean. On post-operative days 7 - 10 the evoked neuronal response to electrical (A), mechanical (B and C) and thermal (D and E) stimuli were recorded before and after drug treatment in both animal groups. In morphine- but not saline-treated animals, high dose pregabalin (30 mg/kg) reduced a subset of electrically evoked responses while low dose pregabalin (10 mg/kg) reduced the evoked response of spinal neurons to peripherally applied noxious natural stimuli. Based on latency measurements neuronal responses were subdivided into Aβ-, Aδ- and C-fibres, or post-discharge. See methods for further details. Significant differences from morphine baseline responses: * P < 0.05, ** P < 0.01.

Comparing the data on mechanical responses (figs. 2B and C) it is noteworthy that pregabalin normalised the OIH enhanced neuronal responses over the whole range. Similar effects of pregabalin were seen for responses to thermal stimuli.

The mRNA level of α₂δ-1, 5HT3A and MOR1 in L4-5 DRG is unchanged in morphine-treated animals

We measured and compared the level of mRNA for α₂δ-1, 5HT3A and MOR1 in morphine- and saline-treated animal DRG (L4-5 pooled, both groups n = 8). No significant changes were observed in the mRNA level for any of the proteins analysed in morphine- compared to saline-treated animals (fig. 3). Thus pregabalin was effective after OIH yet its binding site and the level of MOR1 mRNA, were unaltered.

Fig. 3.

Quantification of α₂δ-1, 5HT3A and mu opioid receptor 1 messenger RNA levels in morphine- and saline-treated animal dorsal root ganglia (both groups n = 8) on postoperative days 7-10 normalised to the mean of the saline group for the corresponding 3 measures (messenger RNA level = 100%). Results are presented as the mean percentage of control value ± standard error of the mean. There was no significant difference between groups (P > 0.05).

Ondansetron reduces spinal neuronal hyperexcitability in morphine-treated animals

Spinal ondansetron (100 μg) was administered and the evoked response was recorded at 20, 40, and 60 min in morphine-treated animals (n = 8). After this time systemic pregabalin (10 mg/kg), which previously reduced spinal neuronal hyperexcitability in morphine-treated animals only, was administered and the experimental assay was repeated.

Similarly to pregabalin in morphine-treated animals, ondansetron (100 μg) significantly reduced C-fibre evoked activity, postdischarge, wind up and sensitivities to brush stimulation (fig. 4A) and significantly reduced the evoked neuronal response to noxious mechanical and thermal stimuli (figs. 4B and C). However now, when pregabalin (10 mg/kg) was given in the presence of ondansetron, the α-2δ ligand produced no further reduction in evoked response.

Fig. 4.

The effect of spinal ondansetron (100 μg) and subsequent systemic administration of pregabalin (10 mg/kg) on the mean baseline response profiles of dorsal horn wide dynamic range spinal neurons in morphine-treated animals (n = 8). Results are presented as mean ± standard error of the mean. On post-operative days 7 - 10 the evoked neuronal response to electrical (A), mechanical (B) and thermal (C) stimuli were recorded before and after drug treatment. Ondansetron reduced a subset of electrically evoked responses and the evoked response of spinal neurons to peripherally applied noxious natural stimuli. Pregabalin (10 mg/kg) did not further reduce the evoked neuronal response to electrical or natural stimuli. Based on latency measurements neuronal responses were subdivided into Aβ-, Aδ- and C-fibres, or post-discharge. See methods for further details. Significant differences from morphine baseline responses: * P < 0.05, *** P < 0.001.

Visceral hyperalgesia is evident in morphine-treated animals and pregabalin reduces visceral pain responses

When compared with saline-treated animals (n = 8), morphine-treated animals (n = 9) developed visceral hyperalgesia (an increased sensitivity to noxious visceral stimulation) illustrated by a two-fold increase in the evoked VMR’s to noxious CRD pressures (fig. 5).

Fig. 5.

Altered visceromotor responses (VMR’s) at noxious colorectal distension (CRD) pressures in morphine-treated animals. Results are presented as mean ± standard error of the mean. On postoperative days 7 - 10, the evoked VMRs to a range of innocuous and noxious CRD pressures were recorded in saline- (n = 8) and morphine-treated (n = 9) animals. Sustained morphine exposure increased the evoked VMRs to noxious CRD pressures. Significant differences from saline group baseline responses: * P < 0.05, ** P < 0.01, ***P < 0.001.

Pregabalin (30 mg/kg) administration reduced evoked VMR’s by noxious CRD pressures in saline- and morphine-treated animals (figs. 6A and B). After 20 min, pregabalin normalised the elevated response in morphine-treated animals to that of the VMR in saline-treated animals. The VMR’s were not significantly further changed after 60 min (fig. 6C).

Fig. 6.

The effect of systemic administration of pregabalin (30 mg/kg) on the visceromotor responses (VMR’s) of saline- (n = 8) and morphine-treated (n = 9) animals. Results are presented as mean ± standard error of the mean. On postoperative days 7 - 10, the evoked response to innocuous and noxious colorectal distension (CRD) pressures were recorded before and after drug treatment. Pregabalin (30 mg/kg) reduced the VMR to noxious CRD pressures in saline- (A) and morphine-treated (B) animals. After 20 min, pregabalin normalised the elevated response in morphine-treated animals to that of the VMR in saline-treated animals. The VMR’s were not significantly increased or decreased 60 min after pregabalin treatment (C). Significant differences from baseline responses: *^/^ P < 0.05, **^/^^ P < 0.01, ***^{/^^^} P < 0.001. * denotes significant difference from control following 20 min pregabalin treatment. ^ denotes significant difference from control following 60 min pregabalin treatment.

There was a wide variation of VMR’s recorded (figs. 5 and 6), proposed to be due to different batches of animals being used for each set of experiments. All electrophysiological experimental data for each individual neuron or animal was compared to its own control, obviating any variation between groups.

Discussion

In this study OIH in rats produces behavioral and spinal neuronal somatic hypersensitivity in the absence of peripheral pathology. We show that visceral hyperexcitability is also induced and provide evidence that systemic pregabalin normalises both hypersensitivities. Spinal ondansetron, a 5HT3 receptor antagonist, reduces spinal neuronal hypersensitivity and thereafter attenuates the antinociceptive actions of pregabalin. We propose that following chronic morphine exposure, a compensatory descending serotonergic pathway from the brainstem increases activity, and that this pathway contributes to a sensitised state in the spinal cord that is permissive for the actions of pregabalin.

Animal models of OIH can be used to model central changes in the presence of a normal periphery. This can be used to further understand and possibly identify new underlying mechanisms of pain development and maintenance that occur within central pain modulatory circuits following extended opioid treatment. The development and maintenance of OIH is dependent in part on neuroadaptive alterations in the pain modulatory circuitry including increased neurokinin-1 (NK-1) receptor mediated transmission, spinal dynorphin expression and hyperactivity of descending facilitatory pathways from higher brain centres.^5-7,19,20

Morphine exerts its analgesic effects on binding to opioid receptors, and the mu-opioid receptor (MOR) system plays a pivotal role in OIH development.²¹ Peripheral neuropathy alters the expression levels of MORs in the DRG of neuropathic animals. Following peripheral nerve injury, an increase in the proportion of sensory neurons expressing MOR has been observed.²² Conversely, the number of cells expressing MOR in the DRG of nerve-injured animals was reported drastically reduced.²³ Crucially we did not induce any peripheral damage in our morphine-treated animals and, despite the persistent exposure to morphine, found no change in MOR1 mRNA expression in the DRG. PCR cannot detect nonexpression related mechanisms of regulation. Decreased modulation of antinociceptive pathways by morphine (as essentially observed in an animal model of OIH) may be due to progressive desensitisation of the MORs following constant ligand exposure.²⁴ It is worth remembering also that other receptor subtypes are reported to play a crucial role in morphine-induced antinoceiception.²⁵ At the level of the spinal cord, opioid receptor agonists produce analgesia by presynaptic attenuation of primary afferent input and postsynaptic inhibition of dorsal horn neurons.^26,27 But questions relating to where and how opioids initiate plasticity in the central nervous system that leads to OIH remain unanswered. The role of N-Methyl-D-aspartic acid receptor-dependent neuronal events at spinal levels following OIH ²⁸ should be further investigated.

Previously, following spinal infusion of opioid agonist and chronic opioid exposure, the characteristics most commonly associated with neuropathy including spinal cord hypersensitivity, thermal hyperalgesia, increased spinal dynorphin content and opioid tolerance were observed in rats in the absence of peripheral pathology.^8,29 Our current study supports and extends these and previous findings that report hypersensitivities to somatic innocuous and noxious thermal and mechanical stimuli following chronic opioid treatment.^20,21,30,31 Firstly we showed that the altered physiology of deep dorsal horn WDR neurons in morphine animals, whereby both increased neuronal activity and behavioural hypersensitivity is evident, is attenuated by pregabalin.

We then demonstrated that nociceptive sensitisation extends to visceral stimuli in morphine animals; specifically, to colonic distension at noxious pressures. We observed sensitised basal VMR’s to noxious CRD pressures, resulting in dramatically increased magnitude and threshold for visceral pain responses in the CRD model. Pregabalin attenuated graded VMR’s to CRD in both morphine- and saline-treated animals. The analgesic efficacy of pregabalin in naïve animals given acute CRD stimuli has been reported previously,¹⁰ an observation that is repeated here with similar nociceptive-specific inhibitory effects on evoked VMR’s in morphine-treated animals. This is reminiscent of the inhibitory action of pregabalin in neuropathy where spinal neuronal and behavioural hypersensitivities are greatly reduced without abolishing the physiological baseline response.^32,33

Pregabalin is a starting option in the treatment of many neuropathic pain conditions where the enhanced response of the spinal cord and brain, referred to as central sensitization, develops following sufficient peripheral afferent barrage into the central nervous system, or by changes in the net balance of descending facilitations and inhibitions from higher centres onto the spinal cord.³⁴ As we cannot attribute the antinociceptive actions of pregabalin in morphine-treated rats to a state-dependent pathology, we assessed if up-regulation of the α₂δ-1 accessory subunit of the voltage gated calcium channel to which pregabalin binds was present in these animals. Interestingly, we observed no increase in the α₂δ-1 subunit mRNA expression in the DRG receiving afferents from the peripheral receptive field. Consistent with our findings, previous studies have reported analgesic efficacy of the gabapentinoids both in the absence of α₂δ-1 subunit up-regulation ^35,36 and in short-term somatic and visceral inflammatory models where α₂δ-1 subunit up-regulation has insufficient time to occur.^37,38 Since the poly-modal hypersensitivities of spinal neurons in morphine-treated animals, and the noxious CRD-evoked VMR’s in saline- and morphine-treated animals, was attenuated by pregabalin in the absence of both up-regulation of the α₂δ-1 subunit and peripheral pathology, we conclude that the underlying mechanism determining the analgesic efficacy of pregabalin in morphine-treated animals is not directly comparable to that in chronic pain models. The analgesic actions of pregabalin in our animal model of OIH are most likely related to modulation of function of, but not to the up-regulation of, voltage gated calcium channel subunits (as is observed in neuropathy).

The analgesic efficacy of pregabalin in animal models of chronic pain is experimentally correlated with the injury dependent interaction of the descending serotonergic system with spinal 5HT3 receptors. Previous studies have shown that in the absence of peripheral nerve injury, stimulating dorsal horn 5HT3 receptors in normal animals can induce the state-dependent inhibitory actions of the gabapentinoids.³² We support the premise that enhanced functionality at 5HT3 receptors may be a contributory underlying mechanism in OIH.¹⁹ We showed that selective 5HT3 receptor antagonist ondansetron attenuated the neuronal hyperexcitability in morphine-treated animals, mirroring findings in previous studies where ondansetron inhibited patterns of increased neuronal activity and behavioural patterns of nociception that were, for example, induced by peripheral formalin injection.^39,40 Critically, in our morphine-treated animals, when 5HT facilitation was blocked by ondansetron subsequent doses of pregabalin now failed to further reduce the spinal neuronal response. This lends support to the hypothesis that descending serotonergic circuits also play a key role at spinal levels in regulating the therapeutic actions of pregabalin. We found no increase in 5HT3A mRNA expression in the DRG receiving afferents from the peripheral receptive field in morphine-treated animals, suggesting that spinal neuronal hypersensitivity could be attributed to greater physiological activity in the descending serotonergic pathways rather than receptor changes. Given the recipricocity between the monamines, 5HT and noradrenaline, it is noteworthy that the actions of α₂δ ligands have also been shown to involve supraspinal and spinal noradrenergic mechanisms.¹⁵

Thus there is strong evidence that a spino-bulbo-spinal loop involving 5HT3 receptor mediated descending facilitation, which produces central excitability and exists in pain states like neuropathy,⁴¹ also exists in OIH.¹⁹ The hyperexcitability of somatic and visceral responses in morphine animals may reflect the net result of spinal excitability that is enhanced by a positive feedback loop between spinal pronociceptive signalling and alterations in descending modulatory activity, including serotonergic projections from the brainstem.

Summarising, we show that pregabalin is active independently of any pathology state-dependency in a visceral and spinal electrophysiology animal model of OIH, where there is no peripheral pathological trigger. Pregabalin’s efficacy may result from proposed central plastic changes in our two experimental models and in the formalin test.⁴⁰ This may relate to a common factor in visceral hypersensitivity and spinal cord neuronal hyperexcitability, namely normalising OIH induced central excitability. Indeed in humans, using acute capsaicin chemical nociception, Iannetti et al⁴² used fMRI techniques to show that gabapentinoids have a state-dependent action for modulation of brainstem activation only in the presence of central sensitisation. It is therefore possible that a threshold level of central excitability is a pre-requisite and sufficient for pregabalin to exert analgesic actions when the periphery is undamaged.

Common mechanisms can therefore contribute to a variety of experimental pain responses and also their therapy. Spinal NK-1 R expressing neurones are at the origin of spino-bulbo-spinal loops that engage the brainstem and 5HT3 receptors. Thus ablation of these neurons and also blocking this serotonergic drive reduces responses to formalin, neuropathy and the manifestation of OIH, as well as the anti-hyperalgesic actions of pregabalin.^14,19,32,41

OIH deserves attention because morphine remains the gold standard analgesic, but its long-term use in the clinic can be limited by any ensuing paradoxical heightened pain sensations.^43-45 In the presence of a normal periphery, understanding the central changes that must occur in order for hyperalgesia to manifest following chronic opioid treatment is paramount to optimising the use of morphine. This would allow combination therapies to be offered to patients receiving long-term morphine treatment. We provide evidence that pregabalin reduces neuronal hyperexcitability and visceral hypersensitivity following chronic morphine exposure in rats. Theoretically, pregabalin could be seen as a viable combination-therapy option in the treatment of patients with OIH since it reduced morphine induced hyperexcitability of both somatic and visceral responses. Interestingly, gabapentin and morphine display supraadditive neuronal inhibitory effects and analgesia both after acute administration in animals and more chronically in human studies of neuropathy.^46,47 Thus, in OIH, the common direction of effect of these drugs diverges so that the α₂δ-1 receptor ligand can still reduce and normalise the enhanced responses produced by the opioid. Finally, the mechanisms that underlie OIH, namely a plethora of linked central changes, may shed light on events that could relate to idiopathic diffuse pain states, that include both somatic and visceral hypersensitivity since responses to both modalities became hypersensitized in morphine-treated animals. Encouragingly, α₂δ-1 receptor ligands are offered as an emerging therapy in the treatment of diffuse pain states such as irritable bowel syndrome and fibromyalgia, which possibly represent additional cases of central sensitisation.^{48, 49}

MS #201009024 – Final Boxed Summary Statement

What we already know about this topic

• Chronic opioid therapy results in hypersensitivity in animals to peripheral stimuli, and this phenomenon depends on activation of serotonin receptors of the 5HT3 subtype

• Whether opioid induced hypersensitivity extends to visceral stimuli is not known

What this article tells us that is new

• In anesthetized rats, 1 week exposure to morphine infusion resulted in hypersensitivity to colonic distention and enhanced spinal cord neuronal response to peripheral stimulation

• These enhanced responses were blocked by the neuropathic pain analgesic, pregabalin and by the 5HT3 antagonist, ondansetron