Functional analyses of coronary artery disease associated variation on chromosome 9p21 in vascular smooth muscle cells

Abstract

Variation on chromosome 9p21 is associated with risk of coronary artery disease (CAD). This genomic region contains the CDKN2A and CDKN2B genes which encode the cell cycle regulators p16^INK4a, p14^ARF and p15^INK4b and the ANRIL gene which encodes a non-coding RNA. Vascular smooth muscle cell (VSMC) proliferation plays an important role in the pathogenesis of atherosclerosis which causes CAD. We ascertained whether 9p21 genotype had an influence on CDKN2A/CDKN2B/ANRIL expression levels in VSMCs, VSMC proliferation and VSMC content in atherosclerotic plaques. Immunohistochemical examination showed that VSMCs in atherosclerotic lesions expressed p16^INK4a, p14^ARF and p15^INK4b. Analyses of primary cultures of VSMCs showed that the 9p21 risk genotype was associated with reduced expression of p16^INK4a, p15^INK4b and ANRIL (P = 1.2 × 10⁻⁵, 1.4 × 10⁻² and 3.1 × 10⁻⁹) and with increased VSMC proliferation (P = 1.6 × 10⁻²). Immunohistochemical analyses of atherosclerotic plaques revealed an association of the risk genotype with reduced p15^INK4b levels in VSMCs (P = 3.7 × 10⁻²) and higher VSMC content (P = 5.6 × 10⁻⁴) in plaques. The results of this study indicate that the 9p21 variation has an impact on CDKN2A and CDKN2B expression in VSMCs and influences VMSC proliferation, which likely represents an important mechanism for the association between this genetic locus and susceptibility to CAD.

INTRODUCTION

Genome-wide association studies have revealed a strong association between DNA sequence variation on chromosome 9p21 and the risk of coronary artery disease (CAD) (1–4). This has been confirmed in many independent studies (5–8). Additionally, this genetic locus has been shown to be associated with abdominal aortic aneurysm (9), intracranial aneurysm (9–11), carotid atherosclerosis (12), ischaemic stroke (13) and peripheral vascular disease (14). On the other hand, there is no association between this locus and classic CAD-related intermediate traits such as hyperlipidaemia and hypertension (5,6,12,15). The mechanism by which variation at this locus influences the risk of CAD is currently unclear.

The 9p21 locus contains multiple CAD-associated single-nucleotide polymorphisms (SNPs) in strong linkage disequilibrium, spanning a genomic region of over 50 kb (1–5). This genomic interval does not contain any protein-coding sequences; however, near this interval reside the cyclin-dependent kinase 2A (CDKN2A) and 2B (CDKN2B) genes (1–5) which encode the cell proliferation regulators p16^INK4a (by exons 1α, 2 and 3 of the CDKN2A gene), p14^ARF (by exons 1β and 2 of the CDKN2A gene) and p15^INK4b (by the CDKN2B gene) (16). In addition, this genomic interval contains a gene for a non-coding RNA known as ANRIL (antisense non-coding RNA in the INK4 locus) (1–5) which may have a role in the regulation of CDKN2A and CDKN2B expression (17,18).

Recently, it has been demonstrated that targeted deletion of the orthologous interval in mice resulted in a significant reduction in cardiac expression of CDKN2A and CDKN2B (19), indicating that this genomic interval harbours regulatory elements that modulate the expression of these genes. In addition, the study showed that primary cultures of vascular smooth muscle cells (VSMCs) from mice with the deletion of the orthologous interval exhibited excessive proliferation, presumably due to altered CDKN2A and CDKN2B expression (19). Since VSMCs play important roles in atherosclerosis (20), these findings point to a possible mechanism for the association of the 9p21 locus with susceptibility to CAD in humans, such that the CAD-associated variant at this locus might modulate CDKN2A and CDKN2B expression in VSMCs, thereby affecting VSMC proliferation and consequently the development and progression of atherosclerosis.

In the present study, we investigated whether there was a relationship between the 9p21 locus SNP rs1333049 which had been repeatedly associated with risk of CAD (1,6,7), and expression levels of CDKN2A, CDKN2B and ANRIL in primary cultures of VSMCs, and if the SNP was also associated with p16^INK4a and p15^INK4b expression levels in VSMCs in atherosclerotic plaques and with VSMC content in the plaques.

RESULTS

VSMCs in atherosclerotic lesions express p16^INK4a, p14^ARF and p15^INK4b

We performed immunohistochemical examinations to investigate p16^INK4a, p14^ARF and p15^INK4b expression in VSMCs in atherosclerotic plaques. Double immunostaining of the VSMC marker smooth muscle α-actin (SMA) together with p16^INK4a, p14^ARF or p15^INK4b showed that VSMCs in the atherosclerotic lesions expressed p16^INK4a, p14^ARF and p15^INK4b (Fig. 1A–F). Similarly, we found that VSMCs in abdominal aortic aneurysmal lesions also expressed p16^INK4a, p14^ARF and p15^INK4b (Supplementary Material, Fig. S1).

Figure 1.

Smooth muscle cells in atherosclerotic lesions express p16^INK4a, p14^ARF and p15^INK4b. Sections of formaldehyde-fixed paraffin-embedded tissue blocks of atherosclerotic plaques were subjected to double immunostaining of SMA together with p16^INK4a (A and D), p14^ARF (C and E) or p15^INK4b (E and F). In (A–C), Fast red staining indicates expression of the VSMC marker SMA, and dark brown colour (DAB) indicates expression of p16^INK4a (A), p14^ARF (B) or p15^INK4b (C). Arrows indicate cell co-expressing SMA with p16^INK4a (A), p14^ARF (B) or p15^INK4b (C). No nuclear counterstaining was used in (A–C). In (D–F), brown staining with DAB indicates expression of the VSMC marker SMA, blue colour (haematoxylin) indicates nuclei and Fast red staining indicates expression of p16^INK4a (D), p14^ARF (E) or p15^INK4b (F). Arrows indicate expression of p16^INK4a (D), p14^ARF (E) or p15^INK4b (F), in the nuclei of smooth muscle cells. The haematoxylin nuclear counterstain has partially obscured Fast red nuclear staining of p16^INK4a, p14^ARF and p15^INK4b, in (D–F). ×200 magnification.

Relationship between 9p21 variation and expression levels of p16^INK4a and p15^INK4b in cultured VSMCs

We isolated arterial VSMCs from umbilical cords (n = 69) and studied primary cultures of these VSMCs to ascertain a relationship between SNP rs1333049 and expression levels of CDKN2A and CDKN2B. We observed an association between the SNP and mRNA levels of both p16^INK4a and p15^INK4b, with cells of the C/C genotype having lowest levels (P = 1.2 × 10⁻⁵ for p16^INK4a, Fig. 2A; and P = 1.4 × 10⁻² for p15^INK4b, Fig. 2C). On the other hand, p14^ARF expression levels did not show an association with the SNP rs1333049 genotype (P = 7.3 × 10⁻¹; Fig. 2B).

Figure 2.

Relationship of 9p21 variation with p16^INK4a and p15^INK4b expression levels in cultured VSMCs. Primary cultures of VSMCs from different individuals (n = 69) were genotyped for SNP rs1333049 and subjected to quantitative reverse transcriptase–polymerase chain reaction and western blot analyses. (A–C) Relative fold differences in p16^INK4a, p14^ARF and p15^INK4b mRNA levels in VSMCs of the G/C or G/G genotype for SNP rs1333049 compared with mRNA levels of the corresponding genes in VSMCs of the C/C genotype. (D) Representative images acquired from western blot analyses of p16^INK4a and p15^INK4b and the gel load reference protein β-actin. (E and F) Relative fold differences in p16^INK4a and p15^INK4b protein levels in VSMCs of the G/C or G/G genotype compared with levels of the corresponding proteins in VSMCs of the C/C genotype. Data shown in (A–C, E and F) are mean ± standard deviation of mean.

Having found that SNP rs1333049 was associated with p16^INK4a and p15^INK4b mRNA levels in VSMCs, we examined whether there were differences in the protein levels of p16^INK4a and p15^INK4b according to genotypes. We found that the levels of p15^INK4b protein were lower in cells of the C/C genotype (P = 2.7 × 10⁻²; Fig. 2D and F) and there was a similar trend for p16^INK4a (P = 8.9 × 10⁻²; Fig. 2D and E).

Relationships of ANRIL with 9p21 variation, p16^INK4a, p14^ARF and p15^INK4b in cultured VSMCs

Previous studies in blood cells showed an association between variation at the 9p21 locus and expression levels of the non-coding RNA ANRIL (17,21–23). There is evidence indicating that ANRIL plays a role in the transcriptional regulation of CDKN2A and CDKN2B (18,24), and studies in blood cells and vascular tissues have shown that CDKN2A and CDKN2B expression levels are correlated with ANRIL levels (17,22,23,25). Therefore, we investigated whether there was an association between the SNP rs1333049 genotype and ANRIL expression in VSMCs and ascertained relationships of ANRIL with p16^INK4a, p14^ARF and p15^INK4b in these cells. We detected an association between the SNP and ANRIL expression, with cells of the C/C genotype having lowest levels (P = 3.1 × 10⁻⁹; Fig. 3A). In addition, we observed correlations between ANRIL and p16^INK4a, p14^ARF and p15^INK4b expression levels (r = 0.744, 0.348 and 0.352, respectively; Fig. 3B–D).

Figure 3.

Relationships of ANRIL with 9p21 variation, p16^INK4a, p14^ARFand p15^INK4b in cultured VSMCs. Primary cultures of VSMCs from different individuals (n = 69) were genotyped for SNP rs1333049 and subjected to quantitative reverse transcriptase–polymerase chain reaction analysis of ANRIL, p16^INK4a, p14^ARF and p15^INK4b. (A) Relative fold differences in the ANRIL level in VSMCs of the G/G or G/C genotype for SNP rs1333049 compared with the ANRIL level in VSMCs of the C/C genotype. Data shown are mean ± standard deviation of mean. (B–D) Pair-wise correlation of ANRIL with p16^INK4a, p14^ARF and p15^INK4b, respectively.

Association between 9p21 variation and VSMC proliferation in culture

Since p16^INK4a and p15^INK4b are negative regulators of cell cycle and proliferation (16,26,27), we investigated whether the levels of the cell proliferation marker PCNA (proliferating cell nuclear antigen) were associated with p16^INK4a and p15^INK4b levels and with the SNP rs1333049 genotype, in VSMCs. We observed an inverse relationship of PCNA with p16^INK4a (r = −0.355; Fig. 4A) and a similar trend with p15^INK4b (r = −0.235; Fig. 4B). Importantly, we found that PCNA levels were significantly associated with the SNP rs1333049 genotype, being highest in VSMCs of the C/C genotype (P = 2.3 × 10⁻²; Fig. 4C).

Figure 4.

Relationships of p16^INK4a, p15^INK4b and 9p21 variation with the cell proliferation marker PCNA in cultured VSMCs. Primary cultures of VSMCs from different individuals (n = 69) were genotyped for SNP rs1333049 and subjected to quantitative reverse transcriptase–polymerase chain reaction analysis of PCNA, p16^INK4a and p15^INK4b. (A and B) Correlation of PCNA with p16^INK4a and p15^INK4b, respectively. (C) Relative fold differences in the PCNA mRNA level in VSMCs of the G/C or G/G genotype for SNP rs1333049 compared with the PCNA level in VSMCs of the C/C genotype. Data shown are mean ± standard deviation of mean.

Further to the above analyses, we examined whether the 9p21 variant was associated with VSMC proliferation. We performed proliferation assays in another collection of VSMCs from umbilical cords (n = 73). This experiment showed an association between SNP rs1333049 and VSMC proliferation, with cells of the C/C genotype having highest values (P = 1.6 × 10⁻²; Fig. 5).

Figure 5.

Association between 9p21 variation and VSMC proliferation in culture. Primary cultures of VSMCs from different individuals (n = 73) were genotyped for SNP rs1333049 and subjected to cell proliferation assay by the BrdU labelling and detection method. The amount of BrdU incorporated into cellular DNA was detected using the enzyme-linked immunosorbent assay with the use of a 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit (Roche). Presented in the graph are relative fold differences in absorbance of samples from VSMCs of the G/C or G/G genotype for SNP rs1333049 compared with the absorbance of samples from VSMCs of the C/C genotype. Data shown are mean ± standard deviation of mean.

Relationship between 9p21 variation and expression levels of p16^INK4a and p15^INK4b in VSMCs in atherosclerotic plaques

Further to the above experiments, we investigated whether the 9p21 variation was associated with levels of p16^INK4a and p15^INK4b in VSMCs in atherosclerotic plaques. We performed double immunostaining of SMA together with either p16^INK4a or p15^INK4b, in coronary atherosclerotic plaques from different individuals (n = 41), and determined the percentage of p16^INK4a stain area in VSMC stain area and the percentage of p15^INK4b stain area in VSMC stain area, in each plaque. The analysis showed that the percentages of p15^INK4b stain areas were lower in individuals carrying the C allele of SNP rs1333049 (P = 3.7 × 10⁻²; Fig. 6B) and there was a similar trend for p16^INK4a (P = 6.5 × 10⁻²; Fig. 6A).

Figure 6.

Relationship of 9p21 variation with p16^INK4a and p15^INK4b protein levels in atherosclerotic plaques. Atherosclerotic coronary arteries from different individuals (n = 41) were genotyped for SNP rs1333049 and subjected to double immunostaining of SMA together with p16^INK4a or p15^INK4b. Immunostaining images were analysed using Image-Pro software. Shown in the graphs are percentages of p16^INK4a stain area in VSMC stain area (A) and percentage of p15^INK4b stain area in VSMC stain area (B) in plaques of the C/C, C/G and G/G genotypes for SNP rs1333049. Data shown are mean ± standard deviation of mean.

Association between 9p21 variation and VSMC content in atherosclerotic plaques

Further to the above analysis, we investigated whether there was a relationship of the 9p21 variation with the abundance of proliferating VSMCs and with VSMC content in atherosclerotic plaques. We performed double immunostaining of SMA and the cell proliferation marker Ki67 in coronary atherosclerotic plaques from different individuals (n = 52). We found an association between SNP rs1333049 and VSMC content, with atherosclerotic plaques of the C/C genotype having the highest VSMC content (P = 5.6 × 10⁻⁴; Fig. 7). Additionally, we observed that plaques of the C/C genotype had a non-significant trend towards higher percentages of Ki67-positive SMCs (Supplementary Material, Fig. S2).

Figure 7.

Association of 9p21 variation with smooth muscle cell content in atherosclerotic plaques. Atherosclerotic coronary arteries from different individuals (n = 52) were genotyped for SNP rs1333049 and subjected to immunostaining of SMA. Immunostaining images were analysed using Image-Pro software. (A) A representative image of immunostaining, purple colour indicates SMA stains, ×40 magnification. (B) Percentages of SMA stain area over total plaque area in plaques of the C/C, C/G and G/G genotypes for SNP rs1333049. Data shown are mean ± standard deviation of mean.

DISCUSSION

Following the finding from genome-wide association studies and many replication studies that variation at the 9p21 locus is a major genetic determinant for CAD (1–8), there have been considerable efforts aimed at elucidating the underlying mechanisms. Further to findings from previous studies by other groups (17–19,21–23,25,28), our present study has provided several lines of new information. Our study shows that in primary cultures of VSMCs, there is an association of 9p21 genotype with CDKN2A, CDKN2B and ANRIL expression levels and with the rate of proliferation. Furthermore, our study reveals a relationship of 9p21 genotype with p15^INK4b levels in VSMCs in atherosclerotic plaques and with VSMC content in the plaques. These findings provide new insight into the mechanism underlying the association between variation at the 9p21 locus and risk of CAD.

p16^INK4a and p15^INK4b encoded by CDKN2A and CDKN2B, respectively, are known to play important roles in regulating the cell cycle in many cell types (16). They inhibit cell proliferation by suppressing dissociation of the transcription factor E2F from retinoblastoma protein and consequently suppressing E2F-mediated expression of cell proliferation genes (16). Findings from animal models indicate that these cell cycle regulators repress VSMC proliferation in the blood vessel wall (29–31), although it is still unclear whether they exert similar effects in the human vasculature.

Previous studies in human peripheral blood T-lymphocytes (21), peripheral blood mononuclear cells (22) and whole peripheral blood cells (17,22,23) showed a relationship of CAD-associated SNPs at the 9p21 locus with expression levels of CDKN2A, CDKN2B and/or ANRIL. In another study of peripheral blood mononuclear cells, however, CDKN2A and ANRIL were undetectable and CDKN2B expression level was found not to be associated with the CAD-related SNPs at the 9p21 locus but associated with a number of other SNPs in this genomic region (32). Our study differed from these previously studies, in that we examined VSMCs rather than blood cells. We found that in VSMCs, CDKN2A, CDKN2B and ANRIL expression levels were associated with a genotype for SNP rs1333049. Specifically, we found that p16^INK4a, p15^INK4b and ANRIL expression levels were lowest in VSMCs from homozygotes of the C allele which has been shown to be associated with increased risk of CAD in many studies (1,6,7). In contrast, p14^ARF expression levels did not show an association with this SNP. This is not surprising since, although the risk genotype which reduces p16^INK4a and p15^INK4b expression may also reduce p14^ARF expression, decreased p16^INK4a expression will increase the activity of the transcription factor E2F which in turn can up-regulate p14^ARF expression (27) and therefore offset the decrease in the p14^ARF expression level.

There is evidence indicating that ANRIL plays a role in the transcriptional regulation of CDKN2A and CDKN2B, probably via its interaction with chromatin-associated factors that modulate chromatin methylation (18,24). Several different transcript variants of ANRIL have been reported (17,18,22,25). Previous studies have shown that expression levels of the long transcript of ANRIL were decreased and the short variants increased, in individuals homozygous for the 9p21 high-risk allele compared with those carrying two copies of the low-risk allele (17,21). In the present study, we examined the long transcript of ANRIL and, in agreement with the previous studies (17,21), found that its expression levels in VSMCs were lowest in homozygotes of the SNP rs1333049 C allele. Furthermore, similar to previous studies (17,22,23,25), we observed a correlation between the ANRIL long transcript and p16^INK4a and p15^INK4b expression levels. These findings are consistent with the hypothesis which has been proposed recently (17) that the 9p21 risk allele reduces expression of the ANRIL long transcript but increases expression of the short transcripts and that the short transcripts down-regulate CDKN2A and CDKN2B expression.

Importantly, further to the finding that the SNP rs1333049 genotype was associated with p16^INK4a, p15^INK4b and ANRIL expression levels in VSMCs, we have discovered that it was also associated with the expression level of the cell proliferation marker PCNA and with the rate of VSMC proliferation, both being highest in VSMCs of the C/C genotype, indicating that the CAD risk allele (C allele) increases VSMC proliferation. Although this finding in cultured cells may not necessarily reflect the situation in vascular tissues in vivo, our study in coronary atherosclerotic plaques from different individuals shows that the risk allele (C allele) is associated with lower p15^INK4b expression in VSMCs and higher VSMC content in plaques. Thus, it is likely that the association between the 9p21 risk allele and increased risk of CAD is partly due to increased VSMC proliferation, since VSMC proliferation plays an important role in the pathogenesis of atherosclerosis (20).

VSMCs and extracellular matrix proteins secreted by VSMCs constitute the main bulk of many atherosclerotic plaques (33,34). Accumulation of VSMCs and matrix proteins is a major factor for plaque growth (20). However, plaques that contain a thick fibrous cap consisting largely of VSMCs and matrix proteins are less likely to rupture to cause thrombosis and acute ischaemic events such as myocardial infarction (35). Genetic epidemiological studies have shown that the 9p21 risk allele is associated with atherosclerotic lesion development/progression and susceptibility to CAD (1,3,5–8,12), but does not confer an increased risk of myocardial infarction in patients with coronary atherosclerosis (6,36). The finding of our study that the 9p21 variation is associated with VSMC proliferation is in concordance with these genetic epidemiological findings.

In addition to CAD, other vascular diseases that have been shown to be associated with the 9p21 locus include abdominal aortic aneurysm (9), intracranial aneurysm (9–11), carotid atherosclerosis (12), ischaemic stroke (13) and peripheral vascular disease (14). It is interesting that the 9p21 locus is associated with both atherosclerosis and aneurysms. In this study, in addition to confirming that VSMCs in the atherosclerotic lesions express p16^INK4a, p14^ARF and p15^INK4b as recently reported (28), we found that VSMCs in abdominal aortic aneurysmal lesions also express these cell cycle regulators. This information may be useful for future studies aimed to investigate the mechanism underlying the association of the 9p21 locus with aneurysms.

In summary, our study shows that the 9p21 variant is associated with CDKN2A, CDKN2B and ANRIL expression levels in VSMC primary cultures and p15^INK4b levels in VSMCs in atherosclerotic plaques, and with VSMC proliferation as well as VSMC content in plaques. These findings provide new insight into the mechanism underlying the well-established association between the 9p21 locus and risk of CAD.

MATERIALS AND METHODS

Immunohistochemical analysis

Sections of formaldehyde-fixed paraffin-embedded blocks of atherosclerotic arteries or aneurysmal arteries were subjected to double immunostaining for the VSMC marker SMA together with either p16^INK4a, p14^ARF or p15^INK4b. In brief, the sections were deparaffined with xylene and rehydrated with ethanol, and then incubated with 0.01 M sodium citrate to retrieve antigens, followed by incubation with an avidin and biotin blocking solution (Avidin Biotin Blocking systems, VectorLab), then a peroxidase blocking solution (3% H₂O₂), and subsequently 10% goat serum (Dako). Thereafter, the sections were incubated with a primary antibody, which was either a rabbit anti-human p16^INK4a polyclonal antibody (Proteintech, 10883-1-AP), or a rabbit anti-human p14^ARF polyclonal antibody (Abcam, ab3642), or a rabbit anti-human p15^INK4b polyclonal antibody (Abcam, ab53034). The sections were then incubated with a biotin-conjugated goat anti-rabbit secondary antibody (Dako, E0432), followed by an incubation with avidin-conjugated horseradish peroxidase and then with 3,3′-diaminodbenzidine (DAB). The sections were then incubated with a mouse anti-human SMA antibody conjugated with alkaline phosphatase (Sigma, A5691) and then with Fast Red (Sigma). In a second immunostaining procedure, the sections were prepared and incubated with the antibodies for p16^INK4a, p14^ARF and p15^INK4b as above, then with an anti-rabbit antibody conjugated with alkaline phosphatase (Sigma, A3687) and then with Fast Red. The sections were then incubated with a mouse anti-human SMA antibody (Sigma, A5228), followed by incubation with a biotin-conjugated goat anti-mouse secondary antibody (Sigma, B7264). The sections were then incubated with avidin-conjugated horseradish peroxidase and then with DAB. Subsequently, the sections were counterstained with haematoxylin.

Sections of formaldehyde-fixed paraffin-embedded blocks of atherosclerotic arteries were also subjected to double immunostaining for the VSMC marker SMA together with the cell proliferation marker Ki67. The sections were deparaffinized and re-hydrated in xylene and ethanol, respectively, and then transferred into 0.1 M citrate buffer for antigen retrieval, followed by incubation with 10% goat serum. The sections were then incubated overnight with primary antibodies which were a mouse anti-human SMA antibody (Dako, M-0635) and a rabbit anti-human Ki67 (Abcam, ab66155). After washing in phosphate-buffered saline, the sections were incubated with a biotinylated swine anti-rabbit Ig secondary antibody (Dako, E-0431) for 30 min and then with an anti-mouse Ig alkaline phosphatase-conjugated secondary antibody (Sigma, A-3562) for 30 min. After washing, the sections were incubated with avidin-conjugated horseradish peroxidase for 30 min and then with DAB for 5 min. This was followed by incubation with nitro-blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate (NBT/BCIP). A methyl green counterstaining was then used before dehydrating and mounting the slides.

Slides were examined using an OLYMPUS BX61 microscope and images taken using a BX-PMTVC camera. Image analysis was done using ImagePro Software (Media Cybernetics) and blind to genotyping data. The study was approved by a National Research Ethics Service committee. The study fully complied with Good Clinical Practice guidelines and Tissue Act regulations.

Isolation, culture and immunocytochemical analyses of primary VSMCs

Arteries in umbilical cords were dissected out and the adventitia removed. They were then cut open, divided into small segments and placed onto gelatin-coated tissue culture flasks with the arterial media surface facing the tissue culture surface of the flasks. The flasks were incubated at 37°C for ∼1.5 h to facilitate attachment of the arterial segments to the gelatin-coated tissue culture surface of the flasks. The arterial segments were then cultured in Dulbecco's modified Eagle's medium supplemented with 20% fetal bovine serum, 2% l-glutamine and penicillin/streptomycin at 37°C with 5% CO₂ and 95% humidity. Once reaching ∼90% confluence, the VSMCs were harvested by trypsinization. The cells were then cultured in Smooth Muscle Cell Growth Medium (PromoCell) containing fetal calf serum (5%), epidermal growth factor (0.5 ng/ml), basic fibroblast growth factor (2 ng/ml) and insulin (5 μg/ml). Immunocytochemical analyses and real-time reverse transcriptase polymerase chain reactions described below were carried out using cells at passage 2.

Immunocytochemical analyses were carried out for the VSMC marker SMA, the endothelial cell marker von Willebrand factor and the fibroblast marker discoidin domain receptor-2. In brief, cells were fixed with an acetone and methanol mixture, and then incubated with or without a mouse anti-human SMA monoclonal antibody (Sigma, A5228), or a mouse anti-human von Willebrand factor monoclonal antibody (DAKO, M0616), or a goat anti-human discoidin domain receptor-2 (DDR2) polyclonal antibody (Santa Cruz Biotechnology, sc-7555). The cells were then washed and incubated with either a goat anti-mouse antibody conjugated with FITC (Sigma, F4018) or a rabbit anti-goat conjugated with FITC (Abcam, ab6737). Subsequently, the cell nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI). The cells were visualized using a fluorescence microscope with a digital imaging system. The immunocytochemical analyses showed that the cells expressed the VSMC marker SMA but neither the endothelial cell marker von Willebrand factor nor the fibroblast marker discoidin domain receptor-2 (Supplementary Material, Fig. S3).

Determination of genotypes

Genomic DNA was extracted from cultured VSMCs or sections of formaldehyde-fixed paraffin-embedded blocks of atherosclerotic arteries using the Wizard SV Genomic DNA Purification System (Promega). Genotypes for 9p21 SNP rs1333049 were determined by TaqMan SNP genotyping assay (from Applied Biosystems, C_1754666_10).

Real-time reverse transcriptase–polymerase chain reaction

Expression levels of p16^INK4a, p14^ARF, p15^INK4b, ANRIL and PCNA in primary VSMC cultures were quantified by reverse transcriptase–polymerase chain reaction. Total RNA samples were prepared from primary cultures of VSMCs, with the use of the SV Total RNA Isolation System (Promega). RNA was reverse transcribed into cDNA using random primers (Promega) and M-MLV reverse transcriptase (Promega). The resultant cDNA was subjected to real-time polymerase chain reactions for p16^INK4a, p14^ARF, p15^INK4b, ANRIL, PCNA and β-actin, respectively. The probes used were p16^INK4a (forward primer GAGCAGCATGGAGCCTTC, reverse primer CGTAACTATTCGGTGCGTTG and FAM-labelled probe CTGGCTGG, LightCycler), p14^ARF (forward primer CTACTGAGGAGCCAGCGTCT, reverse primer CTGCCCATCATCATGACCT and FAM-labelled probe CAGCAGCC, LightCycler), p15^INK4b (Applied Biosystems, Hs00793225_m1), ANRIL (forward primer ATTTGGGAATGAGGAGCACAGT, reverse primer TGCCATGTGAGAGAAGCCAAT and FAM-labelled probe TAAGTCACTGGTCTGAGTTC, Applied Biosystems), PCNA (Applied Biosystems, Hs00427214_g1) and β-actin (Applied Biosystems, Hs03023943_g1). Delta C_t values for p16^INK4a, p14^ARF, p15^INK4b, ANRIL and PCNA, respectively, were calculated in relation to the reference gene β-actin.

Cell proliferation assay

VSMCs were seeded in duplicate in 96 well-plates (5000 cells per well) and cultured overnight. In the following day, medium was changed and cells were cultured for further 12 h in fresh medium in the presence of 10 μM 5-bromo-2′-deoxyuridine (BrdU), followed by BrdU detection assay with the use of 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, 11444611001).

Statistical analyses

Variables not in normal distribution were normalized by logarithmic transformation. Analyses of variance (ANOVA) tests were performed to ascertain differences between genotypes in p16^INK4a, p14^ARF, p15^INK4b, ANRIL and PCNA expression levels, cell proliferation, percentage of p16^INK4a stain area over SMA stain area in atherosclerotic plaques, percentage of p15^INK4b stain area over SMA stain area in plaques, number of Ki67-positive VSMCs over SMA stain area in plaques and percentage of SMA stain area over total plaque area in plaques. Pair-wise correlations between variables were tested by Pearson's correlation analyses.

SUPPLEMENTARY MATERIAL

Supplementary Material is available at HMG online.

Conflict of Interest statement. None declared.

FUNDING

We thank support from the British Heart Foundation (FS/07/021 and FS/11/28/28758). Q.X. is the recipient of a British Heart Foundation Intermediate Basic Science Research Fellowship (FS/09/044/28007). This work forms part of the research themes contributing to the translational research portfolio of Barts and the London Cardiovascular Biomedical Research Unit which is supported and funded by the National Institute of Health Research.