Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Aug 1.
Published in final edited form as: Gene Expr Patterns. 2012 May 7;12(7-8):228–235. doi: 10.1016/j.gep.2012.04.003

EXPRESSION OF SCLEROSTIN IN THE DEVELOPING ZEBRAFISH (DANIO) BRAIN AND SKELETON

Melissa S McNulty 1,2, Victoria M Bedell 3, Tammy M Greenwood 3, Theodore A Craig 1,2, Stephen C Ekker 3, Rajiv Kumar 1,2,3
PMCID: PMC3435489  NIHMSID: NIHMS381402  PMID: 22575304

Abstract

Sclerostin is a highly conserved, secreted, cystine-knot protein which regulates osteoblast function. Humans with mutations in the sclerostin gene (SOST), manifest increased axial and appendicular skeletal bone density with attendant complications. In adult bone, sclerostin is expressed in osteocytes and osteoblasts. Danio rerio sclerostin-like protein is closely related to sea bass sclerostin, and is related to chicken and mammalian sclerostins. Little is known about the expression of sclerostin in early developing skeletal or extra-skeletal tissues. We assessed sclerostin (sost) gene expression in developing zebrafish (Danio rerio) embryos with whole mount is situ hybridization methods. The earliest expression of sost RNA was noted during 12 hours post-fertilization (hpf). At 15 hpf, sost RNA was detected in the developing nervous system and in Kupffer’s vesicle. At 18, 20 and 22 hpf, expression in rhombic lip precursors was seen. By 24 hpf, expression in the upper and lower rhombic lip and developing spinal cord was noted. Expression in the rhombic lip and spinal cord persisted through 28 hpf and then diminished in intensity through 44 hpf. At 28 hpf, sost expression was noted in developing pharyngeal cartilage; expression in pharyngeal cartilage increased with time. By 48 hpf, sost RNA was clearly detected in the developing pharyngeal arch cartilage. Sost RNA was abundantly expressed in the pharyngeal arch cartilage, and in developing pectoral fins, 72, 96 and 120 hpf. Our study is the first detailed analysis of sost gene expression in early metazoan development.

Keywords: Sclerostin, sost, skeleton, cartilage, brain

1. Introduction

Sclerostin is a secreted glycoprotein that plays an important role in skeletal development and the regulation of osteoblastic activity (Balemans et al., 2001; Balemans and Van Hul, 2004; Brunkow et al., 2001; Galus and Wlodarski, 2004; Kusu et al., 2003; Sutherland et al., 2004; van Bezooijen et al., 2004; Winkler et al., 2003). A loss or reduction in expression of the protein, results in the bone dysplasias, sclerosteosis or van Buchem disease (Balemans et al., 2001; Balemans et al., 2002; Brunkow et al., 2001). These diseases are associated with osteoblastic hyperactivity, progressive skeletal overgrowth, defects in craniofacial development and, in sclerosteosis, syndactyly of the second and third digits (Balemans et al., 2001; Balemans et al., 2002; Beighton et al., 1976; Brunkow et al., 2001; Itin et al., 2001; Owen, 1976; Staehling-Hampton et al., 2002; Stein et al., 1983). Affected individuals have distinctive facial features such as asymmetric mandibular hypertrophy, frontal bossing, and midface hypoplasia. As a result of hyperosteosis of the skull, cranial nerve foramina are narrowed and impingement of a seventh and eighth cranial nerve occurs, resulting in facial palsy and deafness, respectively. In some individuals with sclerosteosis, intracranial volume is reduced resulting in lethal elevations of intracranial pressure.

Despite knowledge regarding the role of sclerostin in the pathogenesis of sclerosteosis and van Buchem disease, the role of the protein in development has not been carefully assessed. Such experiments could yield valuable information regarding the mechanism of action of sclerostin in the development of structures such as cartilage and bone. The expression of sost mRNA has been examined in mouse embryos by in situ hybridization (Kusu et al., 2003). The earliest expression of sost mRNA was observed on day E14; by day E15, expression on the surfaces of developing mandibular and maxillary bones was seen. In long bones, such as the tibia, sost mRNA was mainly detected in the perichondrium of the hypertrophic chondrocyte region and the periosteum of the diaphyseal region at day E16. In the tibia at day E18, sost mRNA was detected in the trabecular bone. Strong expression was found in the endothelium of the pharyngeal artery in E11 embryos. In addition, expression was seen in the liver of day E12 embryos, localized to islands of hematopoietic cells.

Bone formation occurs by intra-membranous and endochondral mechanisms which are influenced by a variety of growth factors (Kronenberg, 2003; Reddi, 1994). Since sclerostin influences the activity of the bone morphogenetic proteins (BMP) and wnt signaling pathways, it is likely to play a role in early cartilage development (Ellies et al., 2006; Kamiya et al., 2008; Kusu et al., 2003; Semenov et al., 2005; Semenov and He, 2006; van Bezooijen et al., 2005a; van Bezooijen et al., 2004; van Bezooijen et al., 2007; van Bezooijen et al., 2005b; Winkler et al., 2003; Winkler et al., 2005; Winkler et al., 2004; Yanagita, 2005). It might also be important in the development of other tissues, such as those in the nervous system, in which bone morphogenetic proteins are key players (Aybar et al., 2002; Bainter et al., 2001; Barembaum and Bronner-Fraser, 2005; Barth et al., 1999; Glavic et al., 2004; Golden et al., 1999; Londin et al., 2005; Muroyama et al., 2002; Neave et al., 1997; Tribulo et al., 2003). The developing zebrafish embryo is an ideal model in which to study cartilage and bone formation, because of its transparency, and because cartilage structures in the pharynx and jaw form early in development prior to the onset of ossification. The expression of genes in cartilage can be examined in the absence of osteogenesis which occurs at a later stage. We now show that sost RNA and sclerostin protein are detected in pharyngeal and mandibular cartilage of the developing zebrafish. In addition, sost RNA is detected early in the developing neural system suggesting a role for this protein in nervous system physiology.

2. Results

2.1 Sclerostin bioinformatics analysis

On searching the zebrafish genome (www.ensembl.org, Zv9, March 2012), one sost gene located on chromosome 12 is found. Two sost-domain containing protein 1a and 1b genes are found on chromosome 15 and 19. Danio sclerostin protein closely resembles sea bass sclerostin, chick sclerostin, and to a lesser extent, rat, mouse, hamster, dog, cow, monkey and primate (including human) sclerostins (Figure 1A). A phylogenetic analysis of proteins shows that that Danio sclerostin is most closely related to sea bass sclerostin, followed by avian sclerostin, and has more distant relationships to murine and other mammalian sclerostins (Figure 1B).

Figure 1.

Figure 1

Figure 1

A. Alignment of sclerostins from various species. The consensus sequence is shown on the last line of each block. B. Phylogeny of sclerostins.

2.2 Sclerostin mRNA (sost) is expressed early in zebrafish development

Expression analysis of sost in early zebrafish embryos was conducted using whole mount in situ hybridization with sense and anti-sense sost probes. Little to no sost transcript is observed in zebrafish embryos 4, 6, 8 and 10 hours post-fertilization (hpf)) (Figure 2, A, C, E and G, respectively). No signal is observed with the sense sost probe at these early time points (Figure 2, B, D, F and H, respectively). The earliest time at which sost mRNA is clearly seen is at 12 hpf (Figure 2, I and K, respectively). The signal appears diffuse and is distributed throughout the developing embryo, excepting the yolk. No signal is observed with the sense sost probe at this time (Figure 2, J and L). The in situ hybridization data for sost RNA expression is supported by reverse transcriptase polymerase chain reaction (RT-PCR) with sost RNA expression gradually augmenting between 12 – 96 hpf (Figure 2M, right panel labeled “cDNA”). Housekeeping 18S RNA is detected uniformly at all times. Appropriate controls in which reverse transcriptase was omitted from RT-PCR reaction mix showed no bands corresponding to sost or 18S (Figure 2M, left panel, labeled “no-RT controls”).

Figure 2.

Figure 2

Whole mount in situ hybridization of early stage zebrafish embryos (4–12 hpf) using anti-sense or sense Danio sost probe. Panel A. 4 hpf, anti-sense probe. Panel B. 4 hpf, sense probe. Panel C. 6 hpf, anti-sense probe. Panel D. 6 hpf, sense probe. Panel E. 8 hpf, anti-sense probe. Panel F. 8 hpf, sense probe. Panel G. 10 hpf, anti-sense probe. Panel H. 10 hpf, sense probe. Panel I. 12 hpf, anti-sense probe, lateral view Panel J. 12 hpf, sense probe, lateral view. Panel K. 12 hpf, anti-sense probe, dorsal view. Panel L. 12 hpf, sense probe, dorsal view. Panel M. Reverse transcriptase polymerase chain reaction assessment of sost expression and housekeeping gene, 18S. Scale bar = 100 μm.

During somitogenesis at 15 hpf, expression of sost mRNA is observed in Kupffer’s vesicle (arrow, KV, Figure 3B). As seen at earlier times, no signal is observed in 15 hpf embryos with the sense sost probe (Supplemental figure, panel A). At 18 and 20 hpf, sost mRNA is clearly seen in the early rhombic lip (Figure 3, D and F, arrow, early rhombic lip or ERL). No signal is observed with the sense sost probe (Supplemental figure, panels B, C). Analysis of sost mRNA expression at 22 and 24 hpf shows the presence of sost RNA in the dorsal anterior spinal cord (SC, arrow, Figure 3, G and I) and in the hindbrain (arrowheads, Figure 3I and J, labeled URL, upper rhombic lip, and LRL, lower rhombic lip). This pattern in the developing nervous system persists through 28 hpf (Figure 4A and B). Between 28 and 44 hpf sost mRNA begins to accumulate in the pharyngeal cartilage primordia (arrow PC, lateral view, Figure 4B), with no discernible signal when using the sost sense probe (Supplemental figure, panel F). In contrast, the intensity of sost hybridization in the nervous system after 28 hpf diminishes in intensity until it is no longer detectable at 44 hpf (Figure 4, E–J).

Figure 3.

Figure 3

Whole mount in situ hybridization of zebrafish embryos (15–24 hpf) using anti-sense Danio sost probe. Panel A. 15 hpf, dorsal view. Panel B. 15 hpf, lateral view. Panel C. 18 hpf, dorsal view. Panel D. 18 hpf, lateral view. Panel E. 20 hpf, dorsal view. Panel F. 20 hpf, lateral view. Panel G. 22 hpf, dorsal view. Panel H. 22 hpf, lateral view. Panel I. 24 hpf, dorsal view. Panel J. 24 hpf, lateral view. KV = Kupffer’s vesicle; ERL = early rhombic lip; SC = spinal cord; URL = upper rhombic lip; LRL = lower rhombic lip. Scale bar = 100 μm.

Figure 4.

Figure 4

Whole mount in situ hybridization of zebrafish embryos (28–44 hpf) using anti-sense Danio sost probe. Panel A. 28 hpf, dorsal view. Panel B. 28 hpf, lateral view. Panel C. 32 hpf, dorsal view. Panel D. 32 hpf, lateral view. Panel E. 36 hpf, dorsal view. Panel F. 36 hpf, lateral view. Panel G. 40 hpf, dorsal view. Panel H. 40 hpf, lateral view. Panel I. 44 hpf, dorsal view. Panel J. 44 hpf, lateral view. SC = spinal cord; URL = upper rhombic lip; LRL = lower rhombic lip; PC = pharyngeal cartilage. Scale bar = 100 μm.

At 2 and 3 days post-fertilization (dpf) sost mRNA expression becomes more apparent and clearly delineated in the developing pharyngeal cartilages (Figure 5, A–F, bracketed area, pharyngeal cartilage, PC). Sost RNA is also seen in the developing pectoral fin (Figure 5D–F, pectoral fin, PF). In Figure 6, panel A, we show higher power views of hybridization of the anti-sense sost probe to a 3 dpf zebrafish larva. Clear hybridization is seen in the certobranchial cartilage. These data clearly show intense expression of sclerostin RNA in cartilage, suggesting an important role for sclerostin in cartilage development. No signal is observed with the sense oligonucleotide (Supplemental Figure, panels K, L). Continued and increasing sost mRNA expression determined by RT-PCR methods is consistent with the marked expression of this gene in developing cartilage (Figure 2M).

Figure 5.

Figure 5

Whole mount in situ hybridization of zebrafish embryos (2–5 dpf) using anti-sense Danio sost probe. Panel A. 2 dpf, dorsal view. Panel B. 2 dpf, lateral view. Panel C. 2 dpf, ventral view. Panel D. 3 dpf, dorsal view. Panel E. 3 dpf, lateral view. Panel F. 3 dpf, ventral view. Panel G. 4 dpf, dorsal view. Panel H. 4 dpf, lateral view. Panel I. 4 dpf, ventral view. Panel J. 5 dpf, dorsal view. Panel K. 5 dpf, lateral view. Panel L. 5 dpf, ventral view. PC = pharyngeal cartilage; PF = pectoral fin; M = Meckel’s; CB = ceratobranchial. Scale bar = 100 μm.

Figure 6.

Figure 6

Whole mount in situ hybridization of zebrafish embryos (3–5 dpf) using anti-sense Danio sost probe. Ventral views. Panel A. 3 dpf. Panel B. 4 dpf. Panel C. 5 dpf. PF = pectoral fin; M = Meckel’s; CB = ceratobranchial. CH = ceratohyal. Scale bar = 200 μm.

At day 4 and 5 dpf, sost mRNA expression becomes well demarcated in the developing pharyngeal cartilages (Figure 5, G–L). At 5 dpf, sost mRNA expression in the ceratobranchial and Meckel’s cartilage is apparent (Figure 5, K–L, bracketed area, ceratobrachial, CB; Meckel’s, M). In Figure 6, panels B and C, we show higher power views of the hybridization of the anti-sense sost probe to a 4 and 5 dpf zebrafish larva. Clear hybridization is seen in the certobranchial 1–5, ceratohyal and Meckel’s cartilages. These structures have been confirmed by us (data not shown) and by others (Gavaia et al., 2006; Schilling and Kimmel, 1997; Walker and Kimmel, 2007) to be alcian blue positive (cartilage) and alizarin red negative (bone).

In 5 dpf sclerostin protein is detected in Meckel’s, palatoquadrate, basibranchial and ceratohyal cartilages of zebrafish in a punctuate pattern by immuno-histochemistry (data not shown). No immunostaining is seen when pre-immune serum is used.

3. Discussion

The data suggest that maternally derived sost mRNA is not present in significant amounts early (<4 hpf) in embryo development, and that transcription of the embryo sost gene is required for the accumulation of tissue sost. This accrual begins early in zebrafish development, around the 12 hpf mark. Of great interest is the finding that sclerostin expression occurs in the nervous system as early as 15 hours post-fertilization. Sclerostin binds to, and antagonizes the activity of the bone morphogenetic proteins (Kusu et al., 2003; van Bezooijen et al., 2005a; Winkler et al., 2003; Winkler et al., 2004), and because of the critical role of BMPs in the development of the central nervous system in zebrafish (Aybar et al., 2002; Bainter et al., 2001; Barth et al., 1999; Neave et al., 1997; Nguyen et al., 2000; Tribulo et al., 2003), our findings suggest that sclerostin may play a role in modulating signals important for formation of the nervous system in the zebrafish. These findings greatly extend the possible role of sclerostin in developmental biology.

While the function of sclerostin has been primarily assigned to the formation of bone and to the regulation of osteoblast activity, the current data showing expression of sost in cartilage tissues suggests an earlier role for this protein in skeletal system development. Several other authors (Du et al., 2001; Gavaia et al., 2006; Schilling and Kimmel, 1997; Walker and Kimmel, 2007) have shown that pharyngeal arch structures (ceratobranchial, certahyal, Meckel’s and palatoquadrate) are exclusively composed of chondrocytes (alcian blue positive, alizarin red negative) with no calcification from the time of their appearance until >6.5 dpf. At 96 hpf the first calcified pharyngeal teeth appear, attached to ceratobranchial 5 that is still composed of chondrocytes. Markers of bone calcification are absent in the structures we have described until 5–6 dpf (Gavaia et al., 2006). Given the information in the literature, the sost positive cells in the pharyngeal arch structures shown are chondrocytes.

The zebrafish is a particularly useful model for studying skeletal formation since cartilage tissues emerge in a temporally distinct manner, at an early time in development. It will be of interest to examine the effects of reducing sclerostin expression in the central nervous system and developing skeleton by morpholino oligonucleotide methods (Ekker, 2000), zinc finger nucleases (Amacher, 2008; Doyon et al., 2008; Foley et al., 2009; McCammon et al., 2011) or TALENS (Huang et al., 2011; Sander et al., 2011). With knock-down of sclerostin expression in the central nervous system, alterations in nervous system development may develop, thus pointing to the importance of sclerostin in central nervous system development. In the skeleton, increases in bone density and alterations in structure or the temporal pattern of appearance of structures may be observed. The zebrafish is an excellent model system in which to sequentially follow such changes.

4. Materials and Methods

4.1 Embryo collection

Zebrafish embryos and larvae were obtained from mating of Segrest wild-type (SWT) parents under controlled barrier conditions and incubated at 28–30°C. Embryos greater than 24 hours post fertilization (hpf) were treated with 0.2 mM PTU (1-phenyl-2-thio-urea). Zebrafish were collected at various stages, fixed with 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS: 137 mM NaCl, 2.6 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.2) overnight at 4°C, washed with PBS, dehydrated in ethanol and stored at −20°C until use. Embryos less than 24 hpf were de-chorionated after fixing, prior to storage.

4.2 Riboprobe synthesis

Total RNA was isolated from adult zebrafish using an RNeasy mini kit (Qiagen). RNA (0.4 μg) was used to synthesize cDNA (20 μL) using an iScript cDNA Synthesis Kit (Bio-Rad Laboratories). The 630 bp coding sequence for zebrafish sclerostin (sost) (GenBank XM_001340647) was amplified by PCR using the following primers: 5′ primer, 5ZFSOSTBam: GAGAGGATCCATGCAGGTGTCTCTGGCGCTCGTGCACTGCGGC; 3′ primer, 3ZFSOSTHind: GAGAAAGCTTGTATGAATTGCTGTTGATGGACGGCACTTTGCTG The BamHI and HindIII restriction enzyme sites, respectively, are in bold. Aliquots (2 μL) of iScript RT reactions were used as template for PCR reactions using Platinum® Taq DNA Polymerase, High Fidelity (Invitrogen). After detection of DNA of appropriate mass on agarose gels, the PCR was repeated using 4 μL of the first PCR reaction as template. The PCR product was purified from low melting point agarose using Wizard SV purification columns (Promega). The gel-purified PCR product was cleaved with BamHI and HindIII, and ligated into the vector pSP73 cut with BamHI and HindIII (Promega). DNA sequence analyses of plasmid preparations from E. coli Top10 cells demonstrated the full length coding sequence was identical to XM_001340647 but for 4 nucleotide differences: T192C, A229T, T309C, A524G. This zebrafish Scl-pSP73 construct was used to generate probes for in situ hybridization. Briefly, the Scl-pSP73 vector was digested with BamHI (antisense probe) or HindIII (sense probe) and purified following gel electrophoresis. Riboprobe in vitro transcription system for SP6 and T7 promoters (Promega) was used to generate RNA probes labeled with digoxigenin- rUTP (Roche Diagnostics) according to manufacturer’s instructions. Probes were cleaned using RNeasy mini columns (Qiagen) and hydrolyzed at 60°C for 10–12 minutes using an equal volume of probe and of 0.2M Na2CO3; pH 10.2. The reaction was stopped by adding 3% vol/vol of 3M sodium acetate, pH 6.0 and 5% vol/vol of 10% glacial acetic acid. Reactions were cleaned using RNeasy mini columns, quantified and verified by gel electrophoresis. Intact probes ran at about 659/680bps (antisense/sense) while hydrolyzed probes appeared at approximately 500bps.

4.3 Whole mount in situ hybridizations

On day 1, embryos were gradually re-hydrated through an ethanol/phosphate buffered saline (PBS) series, washed with PBS + 0.1% Tween 20 (PBST) and digested with 10 μg/ml proteinase K in PBST for periods of time specific to embryo/larval stage (15 seconds to 50 minutes). Embryos were briefly rinsed in PBST, re-fixed in 4% paraformaldehyde (PFA) for 20 minutes and extensively washed in PBST before incubating overnight at 70°C in pre-hybridization buffer (50% de-ionized formamide, 5X SSC, 5 mM EDTA (pH 8.0), 50 μg/ml heparin, 0.5 mg/ml t-RNA, 9.2 mM citric acid, 0.1% Tween-20). On day 2, embryos were placed in pre-hybridization buffer containing 0.25 ng/μl of antisense or sense RNA probe labeled with digoxigenin and incubated overnight at 70°C. The next day, the embryos were washed through a gradient of pre-hybridization wash (PHW: 5X SSC, 50% de-ionized formamide, 5 mM EDTA (pH 8.0), 9.2 mM citric acid, 0.1% Tween-20) and saline-sodium citrate (SSC – 20X SSC: 3M NaCl, 0.3M Na-citrate, pH 7.0). The first set of washes was performed at 70°C: (i) PHW (quick rinse), (ii) 75% PHW / 25% 2xSSC (15 min), (iii) 50% PHW / 50% 2xSSC (15 min), (iv) 25% PHW / 75% 2xSSC (15 min), (v) 2xSSC (15 min), (vi) 0.2x SSC (30 min, x2 washes). The second set of washes (SSC/PBST series) was performed at room temperature: (i) 75% 0.2x SSC / 25% PBST (5 min), (ii) 50% 0.2x SSC / 50% PBST (5 min), (iii) 25% 0.2x SSC / 75% PBST (5 min), (iv) PBST (5 min). Embryos/larvae were transferred to blocking buffer (2% lamb serum, 2 mg/ml BSA in PBST) and incubated for 4–6 hours at 4°C. During this time, sheep anti-digoxigenin-AP Fab fragments (Roche Diagnostics) were pre-blocked at 4°C with fish acetone powder in blocking buffer. Embryos/larvae were transferred to antibody (1:6,000) in blocking buffer and incubated overnight with gentle agitation at 4°C. The next day, embryos were washed extensively with PBST followed by 3 × 5 min washes with AP buffer (100 mM NaCl, 50 mM MgCl2, 100 mM Tris (pH 9.5), 0.1% Tween-20). Chromogenic substrates NBT/BCIP (Roche, diluted to 0.225 mg/ml and 0.175 mg/ml, respectively) were added to AP buffer and applied to embryos. Color development proceeded until embryos were washed 3 × 15 min in stop solution (1X PBS, pH 5.5; 1 mM EDTA; 0.1% Tween-20), followed by 1 × 15 minute wash in PBST. Embryos were either mounted into glass capillaries in 75% glycerol in PBST for image capture by SCORE (Petzold et al., 2010), or dehydrated through a PBST/ethanol gradient for storage at −20°C. Composite images of embryos were generated by merging different planes using the software package iSolution.

4.4 RNA extraction and Reverse Transcriptase PCR

Embryos/larvae at various stages of development were collected, flash frozen and stored at −80°C until time of RNA extraction. Total RNA extraction was performed using NucleoSpin® RNA/Protein kit (Macherey-Nagel). Following the manufacturer’s instructions, one microgram of total RNA from each isolation was reverse transcribed using the Bio-Rad iScript cDNA Synthesis kit. Primer pair for reverse transcriptase polymerase chain reaction (RT-PCR) amplification of zebrafish sclerostin-like cDNA (sost, NCBI acc# XM_001340647.3): Sost122FqPCR (5′-TACCAGAATACGCGGAGGAC-3′) and Sost549RqPCR: CGATTGGTTGTGTTGTCGAG. This primer pair spans the first and second exon of sost. The housekeeping gene 18S was chosen based on the stable expression pattern of this transcript during zebrafish developmental stages. Primers for 18S were selected based on a previous assessment (McCurley and Callard, 2008). 18sRibQPCR-F (5′-TCGCTAGTTGGCATCGTTTATG-3′) and 18sRibQPCR-R (5′-CGGAGGTTCGAAGACGATCA-3′). Complementary DNA and no-RT samples were diluted in nuclease-free water prior to RT-PCR and amplified for 35 cycles with an annealing temperature of 53°C using HotStarTaq DNA Polymerase (Qiagen), according to manufacturer’s instructions. Reactions were supplemented with 5x Q-Solution and 2 mM MgCl2.

4.5 Generation of anti-sclerostin immune serum and whole mount immunofluorescence

A peptide corresponding to amino acids 188–204 (188-SSKKPRRNKKHRSKVPS-204-C) in zebrafish sost, with an extra carboxyl-terminal Cys, was synthesized using solid phase peptide synthetic methods (Stewart and Young, 1984) and conjugated to keyhole limpet hemocyanin in the (MPRC) Mayo Protein Core Facility Peptide Synthesis Facility. Antibodies were raised to the sost peptide in rabbits at Cocalico Biologicals using standard methods, and antigen-specific responses were confirmed by a direct ELISA. In addition, the antibodies recognized bacterially produced 1–210 zebrafish sost-maltose binding protein (sost-MBP) of the appropriate molecular mass, by SDS-PAGE/immunoblot analyses. In order to biosynthesize sost-MBP, the Bam HI/Hind III fragment of zebrafish sost in pSP73 (above) was inserted into the Bam HI/Hind III sites in pMAL-c4E (New England Biolabs). DNA sequence of clones from E. coli Top10 cells was the same as the pSP73 construct (4 nucleotide differences (see above) and two coding differences (T77S, H175R) (from XM_001340647). The T77S, H175R 1–210 sost-pMAL-c4E construct was expressed in, and purified from, E. coli Origami 2 (DE3) cells (Novagen, EMD) as described (Craig et al., 2010).

Whole mount immunofluorescence was performed using rabbit pre-immune serum and anti-sclerostin immune polyclonal serum, described above. Fixed larvae at 5 dpf were rehydrated through an ethanol/PBST gradient and digested with 10μg/ml proteinase K for 20 minutes. Larvae were quickly rinsed in water, PBST and re-fixed in 4% PFA in PBS for 20 minutes. Five PBST washes, 5 minutes each, were performed. Larvae were blocked (blocking buffer: 2% normal goat serum, 1% BSA in PBST) for 4 hours at room temperature. Immune or pre-immune sera (1:8000) were applied in blocking buffer and larvae were incubated overnight at 4°C. Following extensive washes (wash buffer: 1% BSA in PBST), Alexa Fluor 555 donkey anti-rabbit IgGs (Invitrogen) were applied in blocking buffer at 2.5 μg/ml. Larvae were incubated in secondary antibodies overnight at 4°C and washed extensively next day in wash buffer. One final wash in PBST was performed before transferring larvae SlowFade® Gold antifade reagent (Invitrogen). Fish were mounted into glass capillaries and images were acquired under 85% glycerol by fluorescence microscopy (Petzold et al., 2010).

4.6

Alcian blue and alizarin red staining of zebrafish embryos and larvae This was performed as described by Walker and Kimmel (Walker and Kimmel, 2007).

Supplementary Material

01. Supplemental figure.

Whole mount in situ hybridization of zebrafish embryos (15 hpf–5 dpf) using sense Danio sost probe. Lateral views. Panel A. 15 hpf. Panel B. 18 hpf. Panel C. 20 hpf. Panel D. 22 hpf. Panel E. 24 hpf. Panel F. 28 hpf. Panel G. 32 hpf. Panel H. 36 hpf. Panel I. 40 hpf. Panel J. 44 hpf. Panel K. 2 dpf. Panel L. 3 dpf. Panel M. 4 dpf. Panel N. 5dpf. Scale bar = 100 μm.

Highlights.

  • Sclerostin (sost) RNA is expressed early (15 hpf) in Danio

  • Sost expression is seen in the developing brain

  • Sost is expressed in developing pharyngeal cartilage

Acknowledgments

Supported by NIH grants AR-058003, AR-060869, and a grant from the Dr. Ralph and Marion Falk Foundation.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Amacher SL. Emerging gene knockout technology in zebrafish: zinc-finger nucleases. Brief Funct Genomic Proteomic. 2008;7:460–464. doi: 10.1093/bfgp/eln043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aybar MJ, Glavic A, Mayor R. Extracellular signals, cell interactions and transcription factors involved in the induction of the neural crest cells. Biol Res. 2002;35:267–275. doi: 10.4067/s0716-97602002000200018. [DOI] [PubMed] [Google Scholar]
  3. Bainter JJ, Boos A, Kroll KL. Neural induction takes a transcriptional twist. Dev Dyn. 2001;222:315–327. doi: 10.1002/dvdy.1210. [DOI] [PubMed] [Google Scholar]
  4. Balemans W, Ebeling M, Patel N, Van Hul E, Olson P, Dioszegi M, Lacza C, Wuyts W, Van Den Ende J, Willems P, Paes-Alves AF, Hill S, Bueno M, Ramos FJ, Tacconi P, Dikkers FG, Stratakis C, Lindpaintner K, Vickery B, Foernzler D, Van Hul W. Increased bone density in sclerosteosis is due to the deficiency of a novel secreted protein (SOST) Hum Mol Genet. 2001;10:537–543. doi: 10.1093/hmg/10.5.537. [DOI] [PubMed] [Google Scholar]
  5. Balemans W, Patel N, Ebeling M, Van Hul E, Wuyts W, Lacza C, Dioszegi M, Dikkers FG, Hildering P, Willems PJ, Verheij JB, Lindpaintner K, Vickery B, Foernzler D, Van Hul W. Identification of a 52 kb deletion downstream of the SOST gene in patients with van Buchem disease. J Med Genet. 2002;39:91–97. doi: 10.1136/jmg.39.2.91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Balemans W, Van Hul W. Identification of the disease-causing gene in sclerosteosis--discovery of a novel bone anabolic target? J Musculoskelet Neuronal Interact. 2004;4:139–142. [PubMed] [Google Scholar]
  7. Barembaum M, Bronner-Fraser M. Early steps in neural crest specification. Seminars in cell & developmental biology. 2005;16:642–646. doi: 10.1016/j.semcdb.2005.06.006. [DOI] [PubMed] [Google Scholar]
  8. Barth KA, Kishimoto Y, Rohr KB, Seydler C, Schulte-Merker S, Wilson SW. Bmp activity establishes a gradient of positional information throughout the entire neural plate. Development (Cambridge, England) 1999;126:4977–4987. doi: 10.1242/dev.126.22.4977. [DOI] [PubMed] [Google Scholar]
  9. Beighton P, Durr L, Hamersma H. The clinical features of sclerosteosis. A review of the manifestations in twenty-five affected individuals. Ann Intern Med. 1976;84:393–397. doi: 10.7326/0003-4819-84-4-393. [DOI] [PubMed] [Google Scholar]
  10. Brunkow ME, Gardner JC, Van Ness J, Paeper BW, Kovacevich BR, Proll S, Skonier JE, Zhao L, Sabo PJ, Fu Y, Alisch RS, Gillett L, Colbert T, Tacconi P, Galas D, Hamersma H, Beighton P, Mulligan J. Bone dysplasia sclerosteosis results from loss of the SOST gene product, a novel cystine knot-containing protein. Am J Hum Genet. 2001;68:577–589. doi: 10.1086/318811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Craig TA, Bhattacharya R, Mukhopadhyay D, Kumar R. Sclerostin binds and regulates the activity of cysteine-rich protein 61. Biochem Biophys Res Commun. 2010;392:36–40. doi: 10.1016/j.bbrc.2009.12.143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Doyon Y, McCammon JM, Miller JC, Faraji F, Ngo C, Katibah GE, Amora R, Hocking TD, Zhang L, Rebar EJ, Gregory PD, Urnov FD, Amacher SL. Heritable targeted gene disruption in zebrafish using designed zinc-finger nucleases. Nat Biotechnol. 2008;26:702–708. doi: 10.1038/nbt1409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Du SJ, Frenkel V, Kindschi G, Zohar Y. Visualizing normal and defective bone development in zebrafish embryos using the fluorescent chromophore calcein. Dev Biol. 2001;238:239–246. doi: 10.1006/dbio.2001.0390. [DOI] [PubMed] [Google Scholar]
  14. Ekker SC. Morphants: a new systematic vertebrate functional genomics approach. Yeast. 2000;17:302–306. doi: 10.1002/1097-0061(200012)17:4<302::AID-YEA53>3.0.CO;2-#. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ellies DL, Viviano B, McCarthy J, Rey JP, Itasaki N, Saunders S, Krumlauf R. Bone density ligand, Sclerostin, directly interacts with LRP5 but not LRP5G171V to modulate Wnt activity. J Bone Miner Res. 2006;21:1738–1749. doi: 10.1359/jbmr.060810. [DOI] [PubMed] [Google Scholar]
  16. Foley JE, Maeder ML, Pearlberg J, Joung JK, Peterson RT, Yeh JR. Targeted mutagenesis in zebrafish using customized zinc-finger nucleases. Nat Protoc. 2009;4:1855–1867. doi: 10.1038/nprot.2009.209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Galus R, Wlodarski K. New factors affecting bone remodeling. Ortop Traumatol Rehabil. 2004;6:120–122. [PubMed] [Google Scholar]
  18. Gavaia PJ, Simes DC, Ortiz-Delgado JB, Viegas CS, Pinto JP, Kelsh RN, Sarasquete MC, Cancela ML. Osteocalcin and matrix Gla protein in zebrafish (Danio rerio) and Senegal sole (Solea senegalensis): comparative gene and protein expression during larval development through adulthood. Gene Expr Patterns. 2006;6:637–652. doi: 10.1016/j.modgep.2005.11.010. [DOI] [PubMed] [Google Scholar]
  19. Glavic A, Silva F, Aybar MJ, Bastidas F, Mayor R. Interplay between Notch signaling and the homeoprotein Xiro1 is required for neural crest induction in Xenopus embryos. Development (Cambridge, England) 2004;131:347–359. doi: 10.1242/dev.00945. [DOI] [PubMed] [Google Scholar]
  20. Golden JA, Bracilovic A, McFadden KA, Beesley JS, Rubenstein JL, Grinspan JB. Ectopic bone morphogenetic proteins 5 and 4 in the chicken forebrain lead to cyclopia and holoprosencephaly. Proc Natl Acad Sci U S A. 1999;96:2439–2444. doi: 10.1073/pnas.96.5.2439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Huang P, Xiao A, Zhou M, Zhu Z, Lin S, Zhang B. Heritable gene targeting in zebrafish using customized TALENs. Nat Biotechnol. 2011;29:699–700. doi: 10.1038/nbt.1939. [DOI] [PubMed] [Google Scholar]
  22. Itin PH, Keseru B, Hauser V. Syndactyly/brachyphalangy and nail dysplasias as marker lesions for sclerosteosis. Dermatology. 2001;202:259–260. doi: 10.1159/000051649. [DOI] [PubMed] [Google Scholar]
  23. Kamiya N, Ye L, Kobayashi T, Mochida Y, Yamauchi M, Kronenberg HM, Feng JQ, Mishina Y. BMP signaling negatively regulates bone mass through sclerostin by inhibiting the canonical Wnt pathway. Development (Cambridge, England) 2008;135:3801–3811. doi: 10.1242/dev.025825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kronenberg HM. Developmental regulation of the growth plate. Nature. 2003;423:332–336. doi: 10.1038/nature01657. [DOI] [PubMed] [Google Scholar]
  25. Kusu N, Laurikkala J, Imanishi M, Usui H, Konishi M, Miyake A, Thesleff I, Itoh N. Sclerostin is a novel secreted osteoclast-derived bone morphogenetic protein antagonist with unique ligand specificity. J Biol Chem. 2003;278:24113–24117. doi: 10.1074/jbc.M301716200. [DOI] [PubMed] [Google Scholar]
  26. Londin ER, Niemiec J, Sirotkin HI. Chordin, FGF signaling, and mesodermal factors cooperate in zebrafish neural induction. Dev Biol. 2005;279:1–19. doi: 10.1016/j.ydbio.2004.11.016. [DOI] [PubMed] [Google Scholar]
  27. McCammon JM, Doyon Y, Amacher SL. Inducing High Rates of Targeted Mutagenesis in Zebrafish Using Zinc Finger Nucleases (ZFNs) Methods Mol Biol. 2011;770:505–527. doi: 10.1007/978-1-61779-210-6_20. [DOI] [PubMed] [Google Scholar]
  28. McCurley AT, Callard GV. Characterization of housekeeping genes in zebrafish: male-female differences and effects of tissue type, developmental stage and chemical treatment. BMC Mol Biol. 2008;9:102. doi: 10.1186/1471-2199-9-102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Muroyama Y, Fujihara M, Ikeya M, Kondoh H, Takada S. Wnt signaling plays an essential role in neuronal specification of the dorsal spinal cord. Genes Dev. 2002;16:548–553. doi: 10.1101/gad.937102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Neave B, Holder N, Patient R. A graded response to BMP-4 spatially coordinates patterning of the mesoderm and ectoderm in the zebrafish. Mech Dev. 1997;62:183–195. doi: 10.1016/s0925-4773(97)00659-x. [DOI] [PubMed] [Google Scholar]
  31. Nguyen VH, Trout J, Connors SA, Andermann P, Weinberg E, Mullins MC. Dorsal and intermediate neuronal cell types of the spinal cord are established by a BMP signaling pathway. Development (Cambridge, England) 2000;127:1209–1220. doi: 10.1242/dev.127.6.1209. [DOI] [PubMed] [Google Scholar]
  32. Owen RH. Van Buchem’s disease (hyperostosis corticalis generalisata) Br J Radiol. 1976;49:126–132. doi: 10.1259/0007-1285-49-578-126. [DOI] [PubMed] [Google Scholar]
  33. Petzold AM, Bedell VM, Boczek NJ, Essner JJ, Balciunas D, Clark KJ, Ekker SC. SCORE imaging: specimen in a corrected optical rotational enclosure. Zebrafish. 2010;7:149–154. doi: 10.1089/zeb.2010.0660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Reddi AH. Bone and cartilage differentiation. Curr Opin Genet Dev. 1994;4:737–744. doi: 10.1016/0959-437x(94)90141-o. [DOI] [PubMed] [Google Scholar]
  35. Sander JD, Cade L, Khayter C, Reyon D, Peterson RT, Joung JK, Yeh JR. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nat Biotechnol. 2011;29:697–698. doi: 10.1038/nbt.1934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Schilling TF, Kimmel CB. Musculoskeletal patterning in the pharyngeal segments of the zebrafish embryo. Development (Cambridge, England) 1997;124:2945–2960. doi: 10.1242/dev.124.15.2945. [DOI] [PubMed] [Google Scholar]
  37. Semenov M, Tamai K, He X. SOST is a ligand for LRP5/LRP6 and a Wnt signaling inhibitor. J Biol Chem. 2005;280:26770–26775. doi: 10.1074/jbc.M504308200. [DOI] [PubMed] [Google Scholar]
  38. Semenov MV, He X. LRP5 mutations linked to high bone mass diseases cause reduced LRP5 binding and inhibition by SOST. J Biol Chem. 2006;281:38276–38284. doi: 10.1074/jbc.M609509200. [DOI] [PubMed] [Google Scholar]
  39. Staehling-Hampton K, Proll S, Paeper BW, Zhao L, Charmley P, Brown A, Gardner JC, Galas D, Schatzman RC, Beighton P, Papapoulos S, Hamersma H, Brunkow ME. A 52-kb deletion in the SOST-MEOX1 intergenic region on 17q12-q21 is associated with van Buchem disease in the Dutch population. Am J Med Genet. 2002;110:144–152. doi: 10.1002/ajmg.10401. [DOI] [PubMed] [Google Scholar]
  40. Stein SA, Witkop C, Hill S, Fallon MD, Viernstein L, Gucer G, McKeever P, Long D, Altman J, Miller NR, Teitelbaum SL, Schlesinger S. Sclerosteosis: neurogenetic and pathophysiologic analysis of an American kinship. Neurology. 1983;33:267–277. doi: 10.1212/wnl.33.3.267. [DOI] [PubMed] [Google Scholar]
  41. Stewart JM, Young JD. Solid Phase Peptide Synthesis. Pierce Chemical Company; Rockford: 1984. [Google Scholar]
  42. Sutherland MK, Geoghegan JC, Yu C, Turcott E, Skonier JE, Winkler DG, Latham JA. Sclerostin promotes the apoptosis of human osteoblastic cells: a novel regulation of bone formation. Bone. 2004;35:828–835. doi: 10.1016/j.bone.2004.05.023. [DOI] [PubMed] [Google Scholar]
  43. Tribulo C, Aybar MJ, Nguyen VH, Mullins MC, Mayor R. Regulation of Msx genes by a Bmp gradient is essential for neural crest specification. Development (Cambridge, England) 2003;130:6441–6452. doi: 10.1242/dev.00878. [DOI] [PubMed] [Google Scholar]
  44. van Bezooijen RL, Papapoulos SE, Lowik CW. Bone morphogenetic proteins and their antagonists: the sclerostin paradigm. J Endocrinol Invest. 2005a;28:15–17. [PubMed] [Google Scholar]
  45. van Bezooijen RL, Roelen BA, Visser A, van der Wee-Pals L, de Wilt E, Karperien M, Hamersma H, Papapoulos SE, ten Dijke P, Lowik CW. Sclerostin is an osteocyte-expressed negative regulator of bone formation, but not a classical BMP antagonist. J Exp Med. 2004;199:805–814. doi: 10.1084/jem.20031454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. van Bezooijen RL, Svensson JP, Eefting D, Visser A, van der Horst G, Karperien M, Quax PH, Vrieling H, Papapoulos SE, ten Dijke P, Lowik CW. Wnt but not BMP signaling is involved in the inhibitory action of sclerostin on BMP-stimulated bone formation. J Bone Miner Res. 2007;22:19–28. doi: 10.1359/jbmr.061002. [DOI] [PubMed] [Google Scholar]
  47. van Bezooijen RL, ten Dijke P, Papapoulos SE, Lowik CW. SOST/sclerostin, an osteocyte-derived negative regulator of bone formation. Cytokine Growth Factor Rev. 2005b;16:319–327. doi: 10.1016/j.cytogfr.2005.02.005. [DOI] [PubMed] [Google Scholar]
  48. Walker MB, Kimmel CB. A two-color acid-free cartilage and bone stain for zebrafish larvae. Biotech Histochem. 2007;82:23–28. doi: 10.1080/10520290701333558. [DOI] [PubMed] [Google Scholar]
  49. Winkler DG, Sutherland MK, Geoghegan JC, Yu C, Hayes T, Skonier JE, Shpektor D, Jonas M, Kovacevich BR, Staehling-Hampton K, Appleby M, Brunkow ME, Latham JA. Osteocyte control of bone formation via sclerostin, a novel BMP antagonist. Embo J. 2003;22:6267–6276. doi: 10.1093/emboj/cdg599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Winkler DG, Sutherland MS, Ojala E, Turcott E, Geoghegan JC, Shpektor D, Skonier JE, Yu C, Latham JA. Sclerostin inhibition of Wnt-3a-induced C3H10T1/2 cell differentiation is indirect and mediated by bone morphogenetic proteins. J Biol Chem. 2005;280:2498–2502. doi: 10.1074/jbc.M400524200. [DOI] [PubMed] [Google Scholar]
  51. Winkler DG, Yu C, Geoghegan JC, Ojala EW, Skonier JE, Shpektor D, Sutherland MK, Latham JA. Noggin and sclerostin bone morphogenetic protein antagonists form a mutually inhibitory complex. J Biol Chem. 2004;279:36293–36298. doi: 10.1074/jbc.M400521200. [DOI] [PubMed] [Google Scholar]
  52. Yanagita M. BMP antagonists: their roles in development and involvement in pathophysiology. Cytokine Growth Factor Rev. 2005;16:309–317. doi: 10.1016/j.cytogfr.2005.02.007. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01. Supplemental figure.

Whole mount in situ hybridization of zebrafish embryos (15 hpf–5 dpf) using sense Danio sost probe. Lateral views. Panel A. 15 hpf. Panel B. 18 hpf. Panel C. 20 hpf. Panel D. 22 hpf. Panel E. 24 hpf. Panel F. 28 hpf. Panel G. 32 hpf. Panel H. 36 hpf. Panel I. 40 hpf. Panel J. 44 hpf. Panel K. 2 dpf. Panel L. 3 dpf. Panel M. 4 dpf. Panel N. 5dpf. Scale bar = 100 μm.

RESOURCES