Skip to main content
NCBI home page
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1975 Nov;2(11):2091–2100. doi: 10.1093/nar/2.11.2091

Studies on bacteriophage fd DNA. III. Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment.

K Sugimoto, H Sugisaki, T Okamoto, M Takanami
PMCID: PMC343575  PMID: 1052531

Abstract

A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined. The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3').

Full text

PDF
2091

Images in this article

2093Image
on p.2093
2095Image
on p.2095

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Dhar R., Weissman S. M., Zain B. S., Pan J., Lewis A. M., Jr The nucleotide sequence preceding an RNA polymerase initiation site on SV40 DNA. Part 2. The sequence of the early strand transcript. Nucleic Acids Res. 1974 Apr;1(4):595–611. doi: 10.1093/nar/1.4.595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Dickson R. C., Abelson J., Barnes W. M., Reznikoff W. S. Genetic regulation: the Lac control region. Science. 1975 Jan 10;187(4171):27–35. doi: 10.1126/science.1088926. [DOI] [PubMed] [Google Scholar]
  3. Maniatis T., Ptashne M., Barrell B. G., Donelson J. Sequence of a repressor-binding site in the DNA of bacteriophage lamda. Nature. 1974 Aug 2;250(465):394–397. doi: 10.1038/250394a0. [DOI] [PubMed] [Google Scholar]
  4. Mirzabekov A. D., Griffin B. E. 5 s RNA conformation. Studies of its partial T 1 ribonuclease digestion by gel electrophoresis and two-dimensional thin-layer chromatography. J Mol Biol. 1972 Dec 30;72(3):633–643. doi: 10.1016/0022-2836(72)90181-7. [DOI] [PubMed] [Google Scholar]
  5. Okamoto T., Sugimoto K., Sugisaki H., Takanami M. Studies on bacteriophage fd DNA. II. Localization of RNA initiation sites on the cleavage map of the fd genome. J Mol Biol. 1975 Jun 15;95(1):33–44. doi: 10.1016/0022-2836(75)90333-2. [DOI] [PubMed] [Google Scholar]
  6. Pribnow D. Nucleotide sequence of an RNA polymerase binding site at an early T7 promoter. Proc Natl Acad Sci U S A. 1975 Mar;72(3):784–788. doi: 10.1073/pnas.72.3.784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Schaller H., Gray C., Herrmann K. Nucleotide sequence of an RNA polymerase binding site from the DNA of bacteriophage fd. Proc Natl Acad Sci U S A. 1975 Feb;72(2):737–741. doi: 10.1073/pnas.72.2.737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Sekiya T., Khorana H. G. Nucleotide sequence in the promoter region of the Escherichia coli tyrosine tRNA gene. Proc Natl Acad Sci U S A. 1974 Aug;71(8):2978–2982. doi: 10.1073/pnas.71.8.2978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Studies on bacteriophage fd DNA I. A cleavage map of the fd genome. J Mol Biol. 1975 Jun 15;95(1):21–31. [PubMed] [Google Scholar]
  10. Sugimoto K., Okamoto T., Sugisaki H., Takanami M. The nucleotide sequence of an RNA polymerase binding site on bacteriophage fd DNA. Nature. 1975 Feb 6;253(5491):410–414. doi: 10.1038/253410a0. [DOI] [PubMed] [Google Scholar]
  11. Walz A., Pirrotta V. Sequence of the PR promoter of phage lambda. Nature. 1975 Mar 13;254(5496):118–121. doi: 10.1038/254118a0. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES