Skip to main content
PMC home page
Genetic Testing and Molecular Biomarkers logoLink to Genetic Testing and Molecular Biomarkers
. 2012 Sep;16(9):1138–1141. doi: 10.1089/gtmb.2012.0061

No Association of Catechol-O-Methyltransferase Polymorphisms with Schizophrenia in the Han Chinese Population

Fuquan Zhang 1,2,✉, Chenxing Liu 1,2, Yaguang Chen 1,2, Lifang Wang 1,2, Tianlan Lu 1,2, Hao Yan 1,2, Yanyan Ruan 1,2, Weihua Yue 1,2, Dai Zhang 1,2
PMCID: PMC3438818  PMID: 22963606

Abstract

Aims: Genetics play a major role in the etiology of schizophrenia (SZ). Catechol-O-methyltransferase (COMT) is one of the promising candidate genes for SZ. A nonsynonymous single-nucleotide polymorphism (SNP), rs4680, causing a Valine (Val) to Methionine (Met) substitution, has been widely studied in relation to psychiatric phenotypes, including SZ, but with conflicting results. We conducted a two-stage study to examine the association of COMT polymorphisms with SZ in the Han Chinese population. Results: Association analysis of nine SNPs in 768 patients and 1348 controls failed to detect any positive markers or haplotypes. Then, we tested rs4680 in a validation sample of 963 patients and 992 controls, and no significant association was observed, but the cases significantly deviated from Hardy–Weinberg equilibrium (p=5.7e-4). There was no association of rs4680 with SZ in the combined sample (n=4071, p=0.110, odds ratio=1.08). Conclusions: Our results do not support the association of COMT with SZ in the Han Chinese population.

Introduction

Schizophrenia (SZ) is a complex genetic disease with a heritability of ∼80%–85% (Cardno and Gottesman, 2000). Dopamine (DA) signaling is strongly implicated in the pathophysiology of SZ, as evidenced by the fact that antipsychotic drugs target mainly on the DA receptors. Catechol-O-methyltransferase (COMT) catalyzes the degradation of the catecholamine neurotransmitters, including DA, norepinephrine, and epinephrine, thereby influencing the DA concentration in the dorsolateral prefrontal cortex (PFC). COMT maps at chromosome 22q11.2, a region that has been implicated in linkage areas of SZ (Lewis et al., 2003) and whose deletion causes the velo-cardio-facial syndrome. Thus, COMT is regarded as one of most promising candidate genes for SZ. It contains a missense polymorphism Val158Met (rs4680), resulting in a G to A substitution that changes Valine (Val) into Methionine (Met) at codon 108/158 in exon 4. rs4680 significantly affects the protein abundance and enzyme activity, with a higher COMT activity in individuals with Val homozygotes compared with those with Met homozygotes (Chen et al., 2004). This single-nucleotide polymorphism (SNP) has been widely studied for its connection with SZ susceptibility, but with conflicting results. Meta-analyses do not support the association with SZ (Fan et al., 2005; Munafo et al., 2005; Okochi et al., 2009). Several previous studies in the Han Chinese population failed to find a positive association with SZ (Fan et al., 2005; Yu et al., 2007; Kang et al., 2010; Chen et al., 2011); but these studies chiefly focused on only one SNP and the sample sizes involved were relatively small.

In this work, we aimed to evaluate the association of COMT with SZ in a two-stage study. In the discovery stage, we derived relevant data from our genome-wide association study (GWAS) data (Yue et al., 2011), involving nine SNPs in 768 SZ cases and 1348 healthy controls. In the validation stage, we tested the genetic distribution of rs4680 in 963 cases and 996 controls.

Materials and Methods

Subjects

All participants were unrelated Han Chinese recruited from the North of China. The initial GWAS sample consisted of 768 unrelated subjects with SZ (360 males and 408 females, aged 33.5±8.7 years) and 1348 control subjects (658 males and 690 females, aged 31.1±13.2 years). For validation, an independent sample consisting of 1030 cases (503 males and 527 females, aged 33.44±11.60 years) and 1032 controls (483 males and 549 females, aged 41.00±14.00 years) was recruited from northern China. The consensus diagnoses were made by at least two experienced psychiatrists according to the Diagnosis and Statistical Manual of Mental Disorders Fourth Edition (DSM-IV) criteria for SZ. None of the patients had severe medical complications. Healthy controls were recruited from communities with a simple nonstructured interview performed by psychiatrists, who excluded individuals with history of mental health and neurological diseases. The control subjects live in the same area with patients, and were group matched to patients by gender, age, and ethnicity.

The study was approved by the Medical Research Ethics Committee of the Institute of Mental Health, Peking University. All participants enrolled in the study signed written informed consent.

Genotyping

Peripheral blood samples were collected from all subjects. Genomic DNA was extracted using the Qiagen QIAamp DNA Mini Kit. The genotyping of the GWAS was performed on Illumina HumanHap610-Quad BeadChips, as previously described (Yue et al., 2011). In the validation stage, the genotypes of rs4680 were determined using the Sequenom MassARRAY system (Sequenom iPLEX). Nine hundred sixty-three of 1030 cases and 992 of 1032 controls were successfully genotyped, the calling rate being 94.8%. The primer pair for the polymorphism comprised the forward primer ACGTTGGATGACCCAGCGGATGGTGGATTT, and the reverse primer ACGTTGGATGTTTTCCAGGTCTGACAACGG.

Statistical analysis

Allelic and genotypic association tests were analyzed using PLINK 1.07 (Purcell et al., 2007). Haplotype analyses were performed using UNPHASED 3.1 (Dudbridge, 2008). The overdominance test compared heterozygosity versus homozygosity state at the rs4680 polymorphism using Pearson's χ2 test in R.

Results

Genotypic distributions of the 9 SNPs in the discovery sample did not deviate from Hardy–Weinberg equilibrium (HWE; p>0.001). rs4680 significantly deviated from HWE in the patient group of the validation sample (p=5.7e-4). Allele and genotype frequencies of the 9 SNPs did not significantly differ between patients and controls in the 768 SZ cases and 1348 controls (Table 1), nor did the haplotypes (data not shown). There was no association of rs4680 with SZ in the validation sample, nor in the combined sample (n=4071, p=0.11, odds ratio [OR]=1.08; Table 1). Overdominance test (GG+AA vs. GA) in the combined sample showed nominal significance (χ2=3.86, p=0.049), with GA being overrepresented in the cases.

Table 1.

Allelic and Genotypic Distributions of Three Single-Nucleotide Polymorphisms in Patients and Controls

St SNP 1/2 gr n 1 (MAF) p (d=1) 1/1 1/2 2/2 p (d=2) HWE OR (95% CI)
1 rs4646312 C/T SZ 768 548 (35.7) 0.585 95 (12.4) 358 (46.6) 315 (41) 0.465 0.695 1.04 (0.91–1.18)
      ctl 1346 938 (34.8)   174 (12.9) 590 (43.8) 582 (43.2)   0.208  
1 rs165656 C/G SZ 766 412 (26.9) 0.218 54 (7) 304 (39.7) 408 (53.3) 0.455 0.854 1.09 (0.95–1.26)
      ctl 1345 677 (25.2)   81 (6) 515 (38.3) 749 (55.7)   0.612  
1 rs165722 T/C SZ 766 412 (26.9) 0.233 54 (7) 304 (39.7) 408 (53.3) 0.472 0.854 1.09 (0.95–1.26)
      ctl 1348 680 (25.2)   81 (6) 518 (38.4) 749 (55.6)   0.517  
1 rs2239393 G/A SZ 768 552 (35.9) 0.546 96 (12.5) 360 (46.9) 312 (40.6) 0.419 0.639 1.04 (0.91–1.19)
      ctl 1348 944 (35.0)   176 (13.1) 592 (43.9) 580 (43)   0.209  
1 rs4680 A/G SZ 768 428 (27.9) 0.091 58 (7.6) 312 (40.6) 398 (51.8) 0.196 0.858 1.13 (0.98–1.3)
      ctl 1348 687 (25.5)   79 (5.9) 529 (39.2) 740 (54.9)   0.251  
1 rs4646316 T/C SZ 768 530 (34.5) 0.709 90 (11.7) 350 (45.6) 328 (42.7) 0.461 0.873 1.03 (0.90–1.17)
      ctl 1348 915 (33.9)   169 (12.5) 577 (42.8) 602 (44.7)   0.101  
1 rs165774 A/G SZ 768 228 (14.8) 0.077 18 (2.3) 192 (25) 558 (72.7) 0.214 0.775 1.18 (0.98–1.41)
      ctl 1348 348 (12.9)   24 (1.8) 300 (22.3) 1024 (76)   0.716  
1 rs174699 C/T SZ 768 606 (39.5) 0.999 120 (15.6) 366 (47.7) 282 (36.7) 0.983 0.940 1 (0.88–1.14)
      ctl 1346 1062 (39.5)   213 (15.8) 636 (47.3) 497 (36.9)   0.690  
1 rs165599 G/A SZ 768 756 (49.2) 0.943 189 (24.6) 378 (49.2) 201 (26.2) 0.975 0.665 1 (0.88–1.13)
      ctl 1348 1330 (49.3)   330 (24.5) 670 (49.7) 348 (25.8)   0.828  
2 rs4680 A/G SZ 963 540 (28.0) 0.745 54 (5.6) 432 (44.9) 477 (49.5) 0.117 5.7e-4 0.98 (0.85–1.12)
      ctl 992 547 (27.6)   71 (7.2) 405 (40.8) 516 (52)   0.525  
1&2 rs4680 A/G SZ 1731 968 (28.0) 0.110 112 (6.5) 744 (43) 875 (50.5) 0.127 0.006 1.08 (0.98–1.20)
      Ctl 2340 1234 (26.4)   150 (6.4) 934 (39.9) 1256 (53.7)   0.184  
Open in a new tab

st, stage; ctl, control; MAF, minor allele frequency; SZ, schizophrenia; SNP, single-nucleotide polymorphism; OR, odds ratio; HWE, Hardy–Weinberg equilibrium; CI, confidence interval.

Discussion

DA signaling is strongly implicated in the etiology of SZ. Because of its essential role in DA metabolism, COMT has been postulated to be involved in the development of SZ. The functional polymorphism, rs4680, leads to remarkable alteration of the enzyme efficiency. This functional relevance has stirred a big research interest for this marker in relation to cognitive function and psychiatric conditions. Although some studies supported an association of Val or Met allele with SZ, more studies failed to find any association (Fan et al., 2005; Munafo et al., 2005; Okochi et al., 2009). Cumulative evidence suggests that there is an inverted-U-shape relationship between DA activity in PFC and working memory performance (Goldman-Rakic et al., 2000), and that Val homozygotes may favor cognitive tasks demanding flexibility at the expense of lower stability, while Met homozygotes may perform better on tasks demanding more stability than flexibility (Durstewitz and Seamans, 2008). Therefore, the alleles of rs4680 might play a modulatory role rather than simply being “good” or “bad” in the onset of SZ (Tunbridge et al., 2006), and the precise effect of COMT activity on PFC function will be dependent on precisely where on the inverted-U curve the individual in question lies in any given environmental or genetic context.

Recently, Costas et al. (2011) proposed an overdominant model through their meta-analysis of Val158Met and SZ. In this model, they suggest that both too high and too low levels of DA signaling may be risk factors (i.e., heterozygotes perform better than homozygotes), with heterozygotes at rs6280 conferring a weak protective effect (OR=0.947). This result was in agreement with a Spanish study (Hoenicka et al., 2010). This model is intriguing, considering the inverted-U-shaped relationship of DA signaling and brain function, but has yet to be validated.

In this work, we extended rs6280 to nine common SNPs, spanning from intron 1 to the 3′UTR of COMT. Our analysis showed that there was no association of COMT polymorphisms or haplotypes with SZ in the Han Chinese population. In contrast to findings of Costas et al. (2011), we detected a nominally significant overrepresentation of rs6280 heterozygotes in the combined patient group compared with controls (p=0.049). Therefore, our data do not support the overdominant model of COMT rs6280 concerning SZ.

Of note is a strong deviation from HWE in the SZ cases in the validation sample (p=5.7e-4), and a nominal deviation in the combined sample (p=0.006). Although testing of HWE is commonly used for quality control in large-scale genotyping, there is little consensus regarding how to deal with the departure from HWE in the cases. Underlying reasons include genetic drift, population subdivision, genotyping error, and natural selection (Lachance, 2009). However, we genotyped another 22 SNPs in the same validation sample simultaneously and there were no severe departures from HWE (p>0.001) for these markers. These facts mitigate the likelihood of genetic drift, or population subdivision. Considering the calling rate of 94.8% we cannot exclude the possibility of genotyping errors. Otherwise, the lack of HWE for rs6280 in the cases might be selection-related.

There were several limitations to our study. Assuming a disease allele frequency of 0.25, and a type I error of 0.05, our sample has an 80% power to detect a variant with an OR larger than 1.22 (Dupont and Plummer, 1998). Although we tested nine SNPs within COMT, the selection of candidate SNPs was not unbiased but dependent on the design of the commercial array. The effect of rs4680 probably depends on the genetic background and environmental factors; therefore, testing rs4680 without accommodating other epistatic factors would result in reduced power and limited reproducibility in this work. Further studies taking into account the genetic context would be more revealing.

In conclusion, our study does not support the association of rs6280 with SZ in the Han Chinese population. The deviation from HWE of rs4680 in SZ cases calls for further investigation.

Acknowledgments

The authors thank all participants for their cooperation in our study. This work was supported by research grants from the National High-Tech Research and Development Program of China (2009AA022702), the National Natural Science Foundation of China (81000578, 81071087, and 81071088), the National Basic Research Program of China (2011CB707805), and the International Science and Technology Cooperation Program of China (2010DFB30820).

Author Disclosure Statement

The authors declare that they have no competing interests.

References

  1. Cardno AG. Gottesman II. Twin studies of schizophrenia: from bow-and-arrow concordances to star wars Mx and functional genomics. Am J Med Genet. 2000;97:12–17. [PubMed] [Google Scholar]
  2. Chen CY. Lu RB. Yeh YW, et al. Association study of catechol-O-methyltransferase gene polymorphisms with schizophrenia and psychopathological symptoms in Han Chinese. Genes Brain behav. 2011;10:316–324. doi: 10.1111/j.1601-183X.2010.00670.x. [DOI] [PubMed] [Google Scholar]
  3. Chen J. Lipska BK. Halim N, et al. Functional analysis of genetic variation in catechol-O-methyltransferase (COMT): effects on mRNA, protein, and enzyme activity in postmortem human brain. Am J Hum Genet. 2004;75:807–821. doi: 10.1086/425589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Costas J. Sanjuan J. Ramos-Rios R, et al. Heterozygosity at catechol-O-methyltransferase Val158Met and schizophrenia: new data and meta-analysis. J Psychiatr Res. 2011;45:7–14. doi: 10.1016/j.jpsychires.2010.04.021. [DOI] [PubMed] [Google Scholar]
  5. Dudbridge F. Likelihood-based association analysis for nuclear families and unrelated subjects with missing genotype data. Hum Hered. 2008;66:87–98. doi: 10.1159/000119108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dupont WD. Plummer WD. Power and sample size calculations for studies involving linear regression. Control Clin Trials. 1998;19:589–601. doi: 10.1016/s0197-2456(98)00037-3. [DOI] [PubMed] [Google Scholar]
  7. Durstewitz D. Seamans JK. The dual-state theory of prefrontal cortex dopamine function with relevance to catechol-o-methyltransferase genotypes and schizophrenia. Biol Psychiatry. 2008;64:739–749. doi: 10.1016/j.biopsych.2008.05.015. [DOI] [PubMed] [Google Scholar]
  8. Fan JB. Zhang CS. Gu NF, et al. Catechol-O-methyltransferase gene Val/Met functional polymorphism and risk of schizophrenia: a large-scale association study plus meta-analysis. Biol Psychiatry. 2005;57:139–144. doi: 10.1016/j.biopsych.2004.10.018. [DOI] [PubMed] [Google Scholar]
  9. Goldman-Rakic PS. Muly Er. Williams GV. D(1) receptors in prefrontal cells and circuits. Brain Res Brain Res Rev. 2000;31:295–301. doi: 10.1016/s0165-0173(99)00045-4. [DOI] [PubMed] [Google Scholar]
  10. Hoenicka J. Garrido E. Martinez I, et al. Gender-specific COMT Val158Met polymorphism association in Spanish schizophrenic patients. Am J Med Genet B Neuropsychiatr Genet. 2010;153B:79–85. doi: 10.1002/ajmg.b.30957. [DOI] [PubMed] [Google Scholar]
  11. Kang C. Xu X. Liu H, et al. Association study of catechol-O-methyltransferase (COMT) gene Val158Met polymorphism with auditory P300 in Chinese Han patients with schizophrenia. Psychiatry Res. 2010;180:153–155. doi: 10.1016/j.psychres.2008.07.008. [DOI] [PubMed] [Google Scholar]
  12. Lachance J. Detecting selection-induced departures from Hardy-Weinberg proportions. Genet Sel Evol. 2009;41:15. doi: 10.1186/1297-9686-41-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Lewis CM. Levinson DF. Wise LH, et al. Genome scan meta-analysis of schizophrenia and bipolar disorder, part II: Schizophrenia. Am J Hum Genet. 2003;73:34–48. doi: 10.1086/376549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Munafo MR. Bowes L. Clark TG, et al. Lack of association of the COMT (Val158/108 Met) gene and schizophrenia: a meta-analysis of case-control studies. Mol Psychiatry. 2005;10:765–770. doi: 10.1038/sj.mp.4001664. [DOI] [PubMed] [Google Scholar]
  15. Okochi T. Ikeda M. Kishi T, et al. Meta-analysis of association between genetic variants in COMT and schizophrenia: an update. Schizophr Res. 2009;110:140–148. doi: 10.1016/j.schres.2009.02.019. [DOI] [PubMed] [Google Scholar]
  16. Purcell S. Neale B. Todd-Brown K, et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 2007;81:559–575. doi: 10.1086/519795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Tunbridge EM. Harrison PJ. Weinberger DR. Catechol-o-methyltransferase, cognition, and psychosis: Val158Met and beyond. Biol Psychiatry. 2006;60:141–151. doi: 10.1016/j.biopsych.2005.10.024. [DOI] [PubMed] [Google Scholar]
  18. Yu R. Zhang XN. Huang XX, et al. Association analysis of COMT polymorphisms and schizophrenia in a Chinese Han population: a case-control study. Am J Med Genet B Neuropsychiatr Genet. 2007;144:570–573. doi: 10.1002/ajmg.b.30487. [DOI] [PubMed] [Google Scholar]
  19. Yue WH. Wang HF. Sun LD, et al. Genome-wide association study identifies a susceptibility locus for schizophrenia in Han Chinese at 11p11.2. Nat Genet. 2011;43:1228–1231. doi: 10.1038/ng.979. [DOI] [PubMed] [Google Scholar]

Articles from Genetic Testing and Molecular Biomarkers are provided here courtesy of Mary Ann Liebert, Inc.

RESOURCES