Abstract
Congenital reduction in nephron number (renal hypoplasia) is a predisposing factor for chronic kidney disease and hypertension. Despite identification of specific genes and pathways in nephrogenesis, determinants of final nephron endowment are poorly understood. Here, we report that mice with germ-line p53 deletion (p53−/−) manifest renal hypoplasia; the phenotype can be recapitulated by conditional deletion of p53 from renal progenitors in the cap mesenchyme (CMp53−/−). Mice or humans with germ-line heterozygous mutations in Pax2 exhibit renal hypoplasia. Since both transcription factors are developmentally expressed in the metanephros, we tested the hypothesis that p53 and Pax2 cooperate in nephrogenesis. In this study, we provide evidence for the presence of genetic epistasis between p53 and Pax2: a) p53−/− and CMp53−/−embryos express lower Pax2 mRNA and protein in nephron progenitors than their wild-type littermates; b) ChIP-Seq identified peaks of p53 occupancy in chromatin regions of the Pax2 promoter and gene in embryonic kidneys; c) p53 binding to Pax2 gene is significantly more enriched in Pax2 -expressing than non-expressing metanephric mesenchyme cells; d) in transient transfection assays, Pax2 promoter activity is stimulated by wild-type p53 and inhibited by a dominant negative mutant p53; e) p53 knockdown in cultured metanephric mesenchyme cells down-regulates endogenous Pax2 expression; f) reduction of p53 gene dosage worsens the renal hypoplasia in Pax2 +/− mice. Bioinformatics identified a set of developmental renal genes likely to be co-regulated by p53 and Pax2. We propose that the cross-talk between p53 and Pax2 provides a transcriptional platform that promotes nephrogenesis, thus contributing to nephron endowment.
Introduction
Mammalian kidney development is dependent on reciprocal inductive interactions between the metanephric mesenchyme and the ureteric bud (reviewed in [1]). Nephrons arise exclusively from the nephron progenitor cell population that is adjacent to the ureteric bud, and is referred to as the cap mesenchyme (CM) [2], [3]. Conversion of the progenitor CM cells to nephron epithelia requires co-ordinated expression of key transcriptional regulators that drive expression of distinct gene targets [4]–[6]. The CM expresses key transcription regulators that include Six2, Pax2, Eya1, Sall1, Wt1, Meox, and Cited1 ([1], [7], reviewed in [8]). These genes, either individually or combinatorially, drive cell-survival, self-renewal, differentiation and nephrogenesis.
The paired box (Pax) gene family of transcription factors consists of nine members that are grouped into four classes based on their DNA binding specificities and developmental expression [9], [10]. Of the Pax2/5/8 sub-group, expression of Pax2/8 is essential and sufficient to induce nephric lineage and nephric duct morphogenesis, and both genes are required for nephron differentiation [11], [12]. Pax2−/− mice exhibit anomalous development of the midbrain, the cerebellum [13] and the optic nerve [14] and renal agenesis [15]. Pax2 is a known determinant of ureteric bud (UB) branching and nephron number and Pax2 haplo-insufficiency in mice or humans are associated with renal hypodysplasia [16], [17]. Pax2, in concert with Hox11 and Eya1, is required for expression of Six2 and GDNF [18], [19], essential regulators of nephron progenitor cell population and branching morphogenesis, respectively. Pax2-null mice lack GDNF expression and have decreased Six2 expression [15], [20]. Wnt4 is another important Pax2 target in the developing nephron. Decreased Wnt4 expression was demonstrated in vivo in hypoplastic kidneys of heterozygous Pax2 mutant mice [21].
The role of p53 in maintaining genomic stability is well-documented. In the absence of stress, p53 levels in adult cells are low. Stabilization and activation occur upon genotoxic or oncogenic stress, resulting in a transcriptional program that activates cell cycle arrest, apoptosis or senescence [22]–[24]. Induction of differentiation programs is also viewed as a tumor suppressor function of p53 since this results in removal of the cell from the proliferative pool [22]. p53 represses expression of pluripotency genes such as Nanog in mESCs thereby promoting their differentiation and preventing dedifferentiation of induced progenitors to pluripotent cells [25]. With respect to this function, p53 inactivation results in loss of asymmetric cell division of stem cells resulting in only self-renewing symmetric cell division generating more stem cells [26], [27]. Thus, p53 plays a key role in cell-fate determination. In addition to these well-characterized roles, emerging evidence implicates p53 in tumor suppression by regulating genes in metabolic pathways, e.g., oxidative and glycolytic pathways for energy generation and glucose homeostasis [28] and anti-angiogenic pathways [29], [30].
p53 expression is ubiquitously high during early embryonic life [31]. After mid-gestation, p53 expression is tissue-specific and higher in differentiating tissues. Although p53-null mice develop tumors early (∼4–6 mo), they are viable and show genetic background dependent developmental abnormalities, such as defects in spermatogenesis, severe ocular abnormalities, and ∼20% female embryonic lethality due to exencephaly [32]–[37]. Developmental abnormalities with incomplete penetrance in mice are in contrast to embryonic lethality observed in Xenopus embryos upon p53 depletion [38], [39]. Compensation by p53 family members, p63 and p73, that are present in early mouse embryo has been suggested as a possible reason for the non-lethal phenotype [40]. We have described duplex ureter formation and renal hypoplasia in p53−/− mice [41], as well as impaired terminal differentiation of renal epithelia [42]. p53 deletion also impairs differentiation of skeletal muscle cells, various hematopoietic cell-lines, thyroid cells, keratinocytes, oligodendrocytes [22], [43], [44], neuronal maturation, axon outgrowth and regeneration [45]. In contrast, excess p53 activity, achieved by deletion of its negative regulator MDM2, results in embryonic death at peri-implantation stage that can be rescued by p53 deletion [46]. We recently showed that conditional Mdm2 deletion in the nephric duct lineage derived ureteric epithelium results in severe hypodysplastic kidneys as a result of excessive apoptosis, decreased proliferation of the ureteric epithelium, and repression of the nephron inducer Wnt9b [47]. Inhibition of UB branching and concomitant nephrogenesis defects were rescued by genetic depletion of p53.
Like Pax2, p53 is expressed in the intermediate mesoderm and urogenital ridge and later in development in the mesonephros and metanephros [11], [41]. In this study, we demonstrate that p53 and Pax2 are epistatic and that p53 is an endogenous activator of Pax2 gene expression during kidney development. These findings led us to propose that down-regulation of Pax2 contributes to renal hypoplasia in p53-null embryos.
Results
Nephron Deficit in Germ-line p53−/− Mouse Kidneys is Recapitulated by Conditional p53 Deletion from Six2+ Cap Mesenchyme
We previously described a defect in UB branching morphogenesis in p53−/− mice [41]. Additional characterization of p53−/− kidneys revealed 50% fewer and less complex LTA-positive proximal tubules in E11.5 kidneys cultured for 72 h (Fig. 1A, B). Mutant kidneys exhibit significantly fewer LTA+ structures than wild-type kidneys (p<0.005). WT1 staining of E17.5 kidney sections showed fewer immature nephrons in the nephrogenic zone as well as a reduction of mature glomeruli in the inner cortex (Fig. 1C). Notably, the presence of renal hypoplasia and fewer nephrons in p53−/− metanephroi is recapitulated in mice with conditional p53 deletion from Six2+ cap mesenchyme (CMp53−/−) (Fig. 1D), which are the nephron progenitor cells, suggesting an autonomous role for p53 in the CM in nephron formation. At P0, 6/8 (75%) examined CMp53−/− kidneys were hypoplastic compared to wild-type littermate kidneys (n = 8) (Fig. 1D). Persistence of hypoplasia post-natally suggests that the phenotype cannot be attributed simply to developmental delay. Lhx1 staining marks the differentiating nascent nephron population. Note fewer generations of Lhx1+ nascent nephrons in CMp53−/− kidneys (Fig. 1D, x10 images). Results of microarray analysis revealed that Pax2 expression is down-regulated in p53−/− kidneys versus p53+/+ (p = 0.037; n = 3 animals/group). This finding prompted us to test the hypothesis that Pax2 is a p53 target gene. The details of the microarray will be published elsewhere (manuscript in preparation).
P53 and Pax2 have overlapping expression in the developing kidney
p53 expression is developmentally regulated in the kidney [41]. At early stages (E11.5–12.5) p53 expression is ubiquitous; however, it is progressively restricted to differentiating renal epithelia as postnatal development proceeds and declines to non-detectable levels in adult kidneys. Pax2 expression is also developmentally regulated [11]. Pax2 is expressed throughout nephrogenesis in the Six2+ CM, in pretubular aggregates (PTA) and renal vesicles (RV) which are the differentiating nascent nephrons, in distal portions of the S-shaped body of the maturing nephron and in the ureteric tips/collecting ducts [12]. p53 expression is more widespread in the mesenchyme than Pax2, showing expression in metanephric and stromal mesenchyme. Immunofluorescence staining demonstrated that p53 is expressed in the Pax2+ CM as well as in the UB (Fig. 2A).
Decreased Pax2 Expression in p53−/− Metanephroi
To validate our microarray findings, we examined Pax2 gene expression in kidneys from p53 −/− and p53+/+ littermates. In situ hybridization revealed lower Pax2 mRNA levels (Fig. 2B) in 4/11 (36%) null embryos, in line with the variable severity of renal hypoplasia in p53−/− mice [41]. To confirm the Pax2 ISH data, QPCR was done on RNA from individual E15.5 kidney pairs from wild-type (n = 4 pairs) and germ-line p53−/− embryos (n = 4 pairs). The scatter-plot in Fig. 2C shows a significant decrease in Pax2 gene expression in individual mutant kidney pairs. In addition to decrease in Pax2 transcript, immunofluorescence staining with Pax2 antibody of wild-type and mutant E15.5 kidney sections showed significantly decreased expression of Pax2 protein in both ureteric and mesenchyme lineages in p53−/− kidneys (Fig. 2D, E). Quantitation of staining intensity was done using Slidebook software and is shown graphically (Fig. 2E). Since kidneys with conditional p53 deletion from CM cells recapitulate the nephron deficit phenotype of global p53-null kidneys, we examined Pax2 expression in CMp53−/− kidneys. Intensity of Pax2 staining was markedly reduced in the cap mesenchyme of E12.5 CMp53−/− kidneys in comparison to wild-type CM (Fig. 3A) indicative of lower Pax2 protein levels. Moreover, Pax2 mRNA is ∼40% lower in E15.5 CMp53−/− kidneys (Fig. 3B).
ChIP-Seq Identification of p53 Bound to Multiple Regions in the Pax2 Promoter in Developing Kidneys
In silico analysis of the Pax2 promoter revealed several putative consensus p53 binding sites, suggesting p53 may directly regulate Pax2 expression during kidney development. To identify putative targets of p53 transcriptional function in the developing kidney, we performed ChIP-Seq using the Genome Analyzer (Illumina) on chromatin from E15.5 kidneys. The complete annotated data set of genes associated with p53-bound regions will be reported elsewhere. ChIP-PCR validation of several genes identified in the ChIP-Seq was recently published [48]. Figure 4 shows the ChIP tracks of p53 enrichment at the Pax2 gene. Tracks for the Input (pre-ChIP) sample show non-specific background that was subtracted from p53-IP sample prior to peak-calling. p53 is enriched at the Pax2 proximal promoter (Region 1) and at an intronic region (Region 2) (Fig. 4A). Region 1 extends from ∼−1200 bp to ∼+60 bp relative to the RefSeq annotated transcription start site (TSS) (http://www.ncbi.nlm.nih.gov/nuccore/NM_011037), with peak sequenced fragment density at −844 bp (Fig. 4A, green bars). p53 binding within the gene body encompasses a ∼400 bp region and overlaps intron2 and exon3, with peak fragment density in intron2. Two additional regions of high p53-occupancy were found at Regions 3 and 4 at −15 kb and −87 kb, respectively, from the Pax2 TSS (Fig. 4A).
Multiple p53 binding motifs were identified in and around p53-occupied regions, thus validating specificity of the ChIP (Fig. 4C). Interestingly, while sequence conservation in mammals is high as expected for proximal promoter and gene sequences at Regions 1 and 2, respectively, non-genic distal p53-enriched regions 3 and 4 also show high sequence conservation (Fig. 4B). Non-genic conserved regions are postulated to function as transcriptional regulators [49]. Indeed, transcription factor binding site search (Genomatix) revealed p300 and CTCF binding sites, which are suggestive of enhancer function, flanking p53 binding sites in the −83 kb p53-enriched region (region 4). Therefore, we sub-cloned this ∼2 kb region upstream to SV40 minimal promoter in pGL3-promoter-luciferase reporter plasmid. However, reporter activity was not enhanced either at baseline or in response to p53 in metanephric mesenchyme mK4 cells (data not shown). Enhanced Pax2 expression in response to p53 via this putative enhancer-fragment in other cell types (e.g., neural or intermediate mesoderm) cannot be ruled out. Collectively, these data strongly suggest that Pax2 is a physiological target of p53-mediated transcriptional regulation.
Differential p53 Binding at −844 in Pax2 Promoter in mK4 (Pax2+) versus mK3 (Pax2-) Cells
Pax2 is expressed in induced metanephric mesenchyme derived mK4 cells, but not in mK3 cell line that represent early uninduced mesenchyme cells [50]. Both cell lines express p53 (Fig. S1). To determine whether p53 is differentially bound at the Pax2 proximal promoter in Pax2-expressing versus non-expressing cells, chromatin was immunoprecipitated from both cell lines with anti-p53 antibody and amplified by PCR. Primers were designed to amplify regions shown to be p53 enriched in the immunoprecipitated sample over input by ChIP-Seq data (Fig. 5Aa, b). p53 motifs (blue bars in Fig. 5Ad) identified by Genomatix and manually are shown relative to TSS (Fig. 5Ac). Species-appropriate IgG was used as negative control. PCR band intensities were quantified using the Alphaimager software as described in Methods, and band intensity of immunoprecipitated fragments was normalized to Input band intensity for each cell line. Normalized values for each amplicon (Fig. 5Ae) were plotted as mK4/mK3 ratios (Fig. 5B). Values greater than 1.0 indicate fragment enrichment in mK4 relative to mK3, as a result of increased p53 binding and immunoprecipitation as seen for amplicons P3 and P7. Ratios for rest of the fragments showed values close to 1.0, indicating p53 binding in these regions is not enhanced in mK4 cells.
p53 Activates the Pax2 Promoter in Transient Transfection Assays
In vivo gene expression and ChIP data shown above strongly suggest that Pax2 is a direct transcriptional target of p53. To further test this hypothesis, the 4.1-Pax2-reporter construct was co-transfected with a p53 expression plasmid into p53−/− H1299 human lung cancer cell-line. The 4.1-Pax2 BamHI/Not1 promoter fragment contains 3500 bp upstream to the transcription start site and ∼600 bp sequences in 5′UTR fused to the CAT or luciferase gene [51]. Greater than 15-fold increase in Pax2 promoter activity was observed in this cell-line in the presence of wild-type p53 but not with a non-DNA-binding mutant of p53, p53-E258K (Mt-p53) (Fig. 6A), indicating the requirement for p53-DNA binding for transactivation to occur. Mt-p53 acts as a dominant-negative and inhibits transcriptional activity of wild-type p53. 4.1Pax2-reporter was also responsive to p53 in two kidney cell-lines tested, one from UB-lineage (see below) and another from mesenchyme (mK4). Kidney mesenchyme-derived mK4 cells represent induced cap mesenchyme cells [50]. Co-transfection of pCMV-p53 expression plasmid with 4.1Pax2-Luc resulted in greater than 20-fold increase in luciferase activity compared to baseline luciferase activity from transfectants that did not receive p53 expression plasmid (Fig. 6B). Further, shRNA-mediated knockdown of p53 in mK4 cells showed corresponding decrease in endogenous Pax2 mRNA levels. p53 knock-down was achieved by transfecting mK4 cells with 4 different p53 shRNA-GFP plasmids (Fig. 6C). GFP ‘+’ and ‘-‘ cells were separated 48 h after transfection by FACS. P53 and Pax2 mRNA levels from GFP+ cells were normalized to levels from GFP- cells. Transfection with scrambled control shRNA plasmid did not result in decreased p53 or Pax2 mRNA levels (not shown).
Collectively, our results thus far show that not only is the Pax2 promoter highly responsive to p53 but is also p53-bound both in kidneys and mK4 cells. The p53 binding motifs identified by Genomatix along the Pax2 promoter were located within or in close proximity to identified p53 peaks identified by ChIP-Seq (Fig. 6D, numbered 1–14). To test the functional relevance of the identified sites, serial truncations were made to the full-length promoter 4.1-Pax2 which has 3500 bp of DNA upstream of the TSS (Fig. 6D and E). Although the deletion constructs show increased CAT activity in response to p53, relative activity of the truncated constructs was consistently lower than from the full-length construct (Fig. 6E). The deletion constructs −3.2kbPax2-CAT and −0.45kbPax2-CAT exhibited 50% and 80% reduction in reporter activity in response to p53, respectively.
The p53 binding motifs along the Pax2 promoter (Fig. 6D, numbered 1–14) were tested for p53 binding. In EMSA, recombinant p53 showed weak binding to multiple sites (Fig. S2A). A consensus, high affinity p53 binding site [52] was used as positive control. The consensus sequence showed robust binding to p53 (Fig. S2A, complex 1). Pax2 promoter sites, however, showed weak binding. Further, several sites generated a higher mobility p53-DNA complex (complex 2), possibly from less multimerized p53 at these sites; this complex was not observed with the consensus site. To circumvent labeling efficiency issues for any probes, competition EMSA was done using p53 consensus sequence as probe and competing its binding to recombinant p53 with the identified putative sites. Binding of the p53 consensus oligoduplex to purified p53 was abolished or attenuated by addition of 200-fold excess of unlabeled p53 consensus sequence (self) or by the p53 binding site in the p21 gene (Fig. S2B, lanes 2–3). However, p53 binding sites in the Pax2 promoter competed weakly or not at all for p53 binding. Competition obtained with different sites was quantified (Fig. S2C).
To identify a specific site responsible for Pax2 transactivation, site-directed mutagenesis was done on the full-length promoter construct. Not all peaks contain consensus binding site sequences. We picked the following sites for site-directed mutagenesis because – sites 7 and 8 showed p53-binding by EMSA, sites 11 and 12 occur within the interval and peak region, and sites 12 and 14 showed high percent conservation between mammals (Table 1). Percent conservation is the percentage of nucleotides predicted to be conserved in 30 mammalian species, calculated using the UCSC browser built-in method (Placental Mammal Basewise Conservation by PhyloP) (Methods S1). As the −3.2 kb deletion construct (without site 13) showed decreased CAT activity relative to the −3.5 kb construct (with site 13) (Fig. 6E), we also tested site 13 for functionality and response to p53 in vitro. Sites mutated by site-directed mutagenesis were re-tested by EMSA to confirm lack of binding to p53 (not shown). Point mutagenesis of single or double sites did not decrease reporter gene activity in response to p53 (Fig. 6F, and data not shown). Since multiple weak sites may promote p53 binding at the Pax2 promoter and transactivation co-operatively, further individual site mutagenesis was not pursued. In summary, our data from ChIP, p53 over-expression and promoter deletion analysis indicate that p53 binds to and transcriptionally activates the Pax2 promoter.
Table 1. Percent conservation in mammals of p53 binding sites in the Pax2 promoter.
Binding site | Location on Chromosome 19 | Percent Conservation | Oligonucleotide sequence 5′→3′ |
1 | 44829010–44829059 | 43.75% | cagacatacc aagacttaac ttaagcacac ccaacaagag ttcctttatg |
2 | 44829110–44829159 | 68.00% | aaggaagata aggctactgc ggttactacc accttagagc ttctggctcc |
3 | 44829150–44829189 | 72.50% | ttctggctcc ccagtatggg agctgaccct tttaggctga |
4 | 44828571–44828608 | 63.16% | ttg attatctaga cccagaaacc agctggaaaa ctaac |
5 | 44828707–44828769 | 42.86% | cct gggaaggcat gcctgagttt tctggagcta catagaaatt agactatcac tagccctcat |
6 | 44828785–44828821 | 40.54% | tgtgg cagatacttg cgtaagtgca acttcaaaag tg |
7 | 44830101–44830143 | 72.09% | ggga gcgagtgcgg gccaggctgc agagactggg ccagcggct |
8 | 44830295–44830340 | 74.42% | gcatcctctg tcactgccgc ggacaagccg ctgcgcaccg tctccc |
9 | 44830465–44830518 | 59.57% | aggcgtctgg actgcccaga ctccggggag ggggtgcgcg ccaccgcgtg tggg |
10 | 44830665–44830724 | 60.00% | gaactcagcg caagggtagc cgagttagga caggggctgc ggactcgcgg gcgtctggga |
11 | 44830735–44830794 | 73.33% | ttggccggtg gatggcaggg ctgggcgagt taggactgag agcctggctt cggagtgccg |
12 | 44831085–44831124 | 97.50% | gaatctattg cctttgtctg acaagtcatc catctcccgg |
13 | 44827769–44827817 | 40.82% | ggtta gcagacagga tctctgcctg cactttactt atgcatgatc cgcc |
14 | 44828298–44828333 | 94.44% | aaccaa gcctgacagg tcgagccctg gctgtgtttg |
Epistasis between p53 and Pax2
In addition to regulating each other ([53] and this study), both Pax2 and p53 independently regulate a cohort of genes. To determine whether an epistatic relationship exists between the two genes, we reduced p53 gene dosage on a Pax2+/− background by crossing p53+/− to Pax2LacZ/+ mice which contain the β-galactosidase gene knocked-in to the Pax2 locus. Pax2 haploinsufficiency is known to result in reduced kidney size with lower UB tip and nephron number [16]. Similarly, p53−/− kidneys exhibit renal hypoplasia with fewer UB tips [41]. Thus, we used UB tip number as a phenotypic readout of renal hypoplasia in Pax2LacZ/+;p53−/− animals. On this mixed genetic background (C3H/He; C57BL6), reduction of either Pax2 gene dosage or elimination of p53 gene reduced UB tip number by ∼12–15% (Fig. 7A, B). However, complete p53 deficiency superimposed on Pax2 haploinsufficiency resulted in ∼55% decrease in tip number, suggesting functional co-operativity between the two transcription factors.
Discussion
In this study we have shown that Pax2 is a physiological target for p53-mediated transcription in the embryonic kidney. Pax family of transcription factors plays a key role in lineage specification and organogenesis. Pax2 expression is essential for development of the urogenital system and mid-hindbrain patterning [15], [54]. While complete loss of Pax2 expression results in renal agenesis, Pax2+/− kidneys are hypoplastic. Pax2 loss in the CNS results in exencephaly [55]. p53 expression is ubiquitous early in embryogenesis. P53 activity is essential for mesodermal determination in co-operation with Smads [40], [56], [57]. Pax2 and p53 expression overlaps temporally and spatially in metanephric development, when expression is ubiquitous in the ureteric epithelia and surrounding metanephric mesenchyme. p53 is expressed in all cells of the embryo up to E10.5 [31], thus its expression precedes that of Pax2 in the intermediate mesoderm. However, Pax2/8 expression is required to induce and specify the nephric lineage [11]. Unlike Pax2−/− mutants, renal agenesis has never been observed or reported in p53−/− embryos suggesting a modulatory role for p53 in regulating Pax2 expression rather than an on-off regulation. Indeed, this is in line with the findings of this study, since elimination of p53 activity results in decreased Pax2 expression but not its complete loss in p53−/− kidneys.
The 4.1Pax2 promoter-reporter construct, which contains the kidney- and mid-hindbrain-specific enhancers faithfully recapitulates endogenous Pax2 expression pattern in the intermediate mesoderm and neural tissue in vivo. The transgene is expressed in the nephric duct epithelia and its derivatives but not in the metanephric mesenchyme [51]. The ability of this promoter fragment to exhibit relatively high baseline activity and response to p53 in mesenchyme mK4 cells reflect inherent differences between in vivo and in vitro models. However, decreased Pax2 expression with p53-knockdown in these cells indicates p53 does positively regulate Pax2 expression in both mesenchyme and UB cells.
Our data does not rule out the possibility of an intermediate factor X as regulator of Pax2 promoter activity. However, p53 is enriched at the Pax2 promoter in mK4 cells that express Pax2 but not in Pax2 non-expressing mK3 cells, although p53 is expressed in both cell lines. This finding, along with collective in vivo data showing decreased Pax2 expression in germ-line p53−/− and conditional CMp53−/− kidneys, along with in vitro transient transfection data strongly suggest p53 is directly upstream to Pax2. Unlike the deletion mutants, none of the point-mutants showed decreased activation by p53 (Fig. 6F and data not shown). Since DNA-binding activity of p53 is required to activate the Pax2 promoter (Fig. 6A) we surmise that multiple binding sites may function co-operatively to enrich p53 at the Pax2 promoter and enhance transcription.
p53 chromatin occupancy profile in mK4 cells overlaps with the in vivo occupancy profile at the Pax2 proximal promoter region, although the resolution offered by ChIP-Seq is far greater than by ChIP-PCR. Also, whole embryonic kidneys were used for chromatin preparation for ChIP-Seq. Thus, the relative differences in p53 occupancy between mK4 cells and kidneys probably reflect differential binding in different cell types.
The synergistic decrease in tip number implies that in addition to autonomously regulating gene expression in the kidney, p53 and Pax2 may co-regulate genes and demonstrate epistasis to each other (Fig. 8A). We identified Pax2 binding sites in a subset of genes with altered expression in p53−/− kidneys and that are bound by p53. Protein products of these genes (Fgf8, Fgfr2, Dlg1, Cdh6, and Bcl2– Fig. 8A, blue box) have been shown to be required for kidney development [58]–[64]. While both transcription factors regulate distinct repertoire of genes in response to specific stimuli independent of each other [20], [65]–[69], we propose some known p53 (Gadd45a, Cdkn1a) [65], [70] or Pax2 (Fgf8) [69] target genes may be regulated co-operatively by p53 and Pax2 in the kidney. The validity of this model remains to be tested.
The ability of both p53 and Pax2 to associate with multiple transcriptional regulatory complexes, as well as their ability to recruit chromatin modifying enzymes to regulate expression of genes encoding transcription factors they physically associate with, would allow p53-Pax2 cross-talk to integrate various stimuli in different developing tissues. Depending on the interacting partners, both transcription factors can activate or repress transcription. Our data places p53 upstream to Pax2 in the developing kidney. The increased severity of hypoplasia in Pax2LacZ/+;p53−/− double mutants relative to single mutants suggests interactions beyond a linear genetic pathway. The two proteins may either directly or as part of a larger complex, or combinatorially, bind to and co-regulate transcription of genes. For example, several putative p53 target genes (altered expression in p53−/− kidneys and show p53 occupancy in vivo - our unpublished data) that also contain Pax2 binding sites (Fig. 8A, below dotted arrow) may be co-regulated.
Pax2 positively regulates expression of pro-survival gene Bcl2 [71] whereas p53 is a known transactivator of pro-apoptotic genes such as Bax, PUMA and Noxa [67], [72], [73]. Pax2 deficiency results in increased apoptosis [17], [74]. Although this study did not compare the apoptotic index between wild-type, single and Pax2LacZ/+;p53−/− double mutants, the worsening hypoplasia upon p53 deletion in Pax2LacZ/+ kidneys suggests increased apoptosis may result from further Pax2 decrease as a result of p53 loss. Effects of p53 deletion are genetic background dependent. Pax2LacZ/+ mice are on a C3H/He background [13]. When p53−/− mice are crossed to this background, these mixed background mice did not show as severe a renal phenotype as we observed in C57BL6 mice.
Given that Pax2 is a proto-oncogene, promotes cell survival and is up-regulated in Wilm’s tumour and renal cell carcinoma [10], [75], why does p53, a tumor suppressor, positively regulate Pax2 expression? In addition to lineage specification and promoting cell survival, Pax2 is also implicated in promoting mesenchyme-to-epithelial transition and cell differentiation [76]. We propose a feed-back model wherein Pax2 in the nephrogenic zone down-regulates p53 expression [53] in the self-renewing cap mesenchyme (Fig. 8B). Our data from conditional p53-deletion kidneys (CMp53−/−) show recapitulation of renal hypoplasia observed in germ-line p53−/− kidneys. CMp53−/− kidneys exhibit decreased Pax2 levels specifically in the CM (Fig. 3A) indicating that p53 levels in the CM are sufficient to enhance Pax2 expression in mesenchyme cells and promote their transition to epithelia. An alternate explanation for decreased Pax2 staining in the CM may be precocious differentiation of CM to nascent nephrons. To address this possibility, we stained embryonic and post-natal kidneys sections with Lhx1, a marker for nascent nephrons. Not only is Lhx1 staining decreased in the mutant kidneys (Fig. 1D), but these kidneys showed no ectopic Lhx1+ differentiated structures that would be expected if these cells were undergoing precocious differentiation. Modulation of p53 function by Pax2 may be viewed as a cell survival mechanism, since unconstrained p53 activity results in excessive apoptosis [46].
We conclude that p53 serves to promote differentiation of progenitor cells to nascent nephrons, and in its absence Pax2 down-regulation is a possible mechanism of renal hypoplasia observed in these kidneys. We propose that the cross-talk between p53 and Pax2 provides a transcriptional platform that promotes nephrogenesis, thus contributing to nephron endowment. Our data contribute to further elucidate mechanisms regulating de novo nephrogenesis in the embryonic kidney, an area of interest not only for potential use in in utero intervention but also from the point of regenerative medicine.
Materials and Methods
Mice
p53+/− mice on C57BL/6 background (Jackson labs) were time-paired to obtain E15.5 p53+/+ and p53−/− litter-matched kidneys. For conditional p53 deletion in cap mesenchyme, Six2GC;p53loxP/+ mice were crossed to p53loxP/loxP mice and embryonic kidneys obtained from resultant crosses. The Six2GC mice were a gift from A. McMahon [3]. Pax2LacZ/+ knock-in mice were a kind gift of M. Bouchard, and maintained on a C3H/He background [13]. For epistasis experiments, Pax2LacZ/+;p53+/− mice were generated and crossed to p53+/− to obtain p53−/− mice on a Pax2+/− background. All animal protocols utilized in this study were approved by and in strict adherence to guidelines established by the Tulane University Institutional Animal Care and Use Committee.
Immunofluorescence Staining
E15.5 kidneys were fixed in 10% formalin and processed for paraffin embedding and sectioning. Five micrometer paraffin sections were subjected to antigen retrieval (10 mM sodium citrate, pH 6.0) after deparaffinization and rehydration. Immuno-staining was done as previously described [47]. Antibodies for the following proteins were used: p53FL (SantaCruz, 1∶500) and Pax2 (1∶200, Zymed/Invitrogen). DAPI (1∶500, D1306, Invitrogen) was used to stain nuclei. Whole-mount staining was done on E12.5–13.5 kidneys as previously described [41] with Pan-cytokeratin antibody (Sigma, 1∶200). The immunofluorescent images were captured using a 3D or deconvolution scope (Leica DMRXA2) and staining intensity was quantified using Intelligent Imaging Innovations SlideBook software.
Chromatin Immunoprecipitation (ChIP) Assays
Chromatin was prepared from 15 pairs of E15.5 kidneys. After shearing, p53-bound chromatin was immunoprecipitated with p53FL antibody (SantaCruz) and subjected to ChIP coupled to next generation sequencing (ChIP-Seq) using the Illumina protocol on the Solexa GAII. p53 peaks were called using the MACS program [77]. P53 antibody (Santa Cruz, SC-6243x) was used for all p53 ChIP experiments. ChIP-PCR on mK3 and mK4 cells was performed using reagents and protocols from the Upstate Biotechnology ChIP kit with modifications as previously described [78]. PCR primer sequences are shown in Table 2. ChIP tracks showing p53 occupancy at the Pax2 gene locus were generated by Integrated Genome Browser (IGB; http://bioviz.org/igb) using ChIP-Seq-derived sequence files.
Table 2. ChIP-PCR primer sequences.
Primer | Chr.19: Amplicon Start | Chr.19: Amplicon End | Amplicon (bp) | Sequence |
P1 | 44830940 | 44831180 | 240 | F atcctcaccctccctcttc |
R tgtgtctctctaaaagctgc | ||||
P2 | 44830233 | 44830617 | 384 | F ttcatagcctcctcctctcc |
R gtccttccctttcgcctt | ||||
P3 | 44829920 | 44830314 | 394 | F gcctgggaggagggagcgaa |
R cggcagtgacagaggatgc | ||||
P4 | 44829512 | 44829938 | 426 | F gtttcttactttccagcag |
R ttcgctccctcctcccaggc | ||||
P5 | 44829275 | 44829678 | 403 | F ttccctatgagaagttagtg |
R acattctgggtgagtttcagg | ||||
P6 | 44828895 | 44829328 | 433 | F tatccattgtctatgttcaca |
R caaatctcacaacctcaca | ||||
P7 | 44828544 | 44828972 | 428 | F cttccaaagcagcagggtag |
R gttcctcactccaacagagat |
In situ hybridization
Whole mount in situ hybridization was performed as described [79]. E10.5-E11.5 mouse embryos or E12.5 kidneys were fixed overnight in 4% formaldehyde in PBS, then dehydrated in methanol and stored at −20°C until use. Digoxigenin-dUTP labeled RNA probes were used at 0.5 µg/ml. Alkaline phosphatase-conjugated anti-digoxigenin Fab fragments were used at 1∶5000. Color reactions were carried out overnight. Embryonic tissue was photographed in glycerol.
p53 knockdown and RT-qPCR
mK4 cells were transfected with p53-shRNA-GFP plasmid (SuperArray Biosciences, KM0931G) for 72 h. Transfected cells were sorted by FACS and RNA was isolated from GFP+ and GFP- cells. Real-time primers for p53 (TaqMan Gene Expression Assay, ID Mm01731287_m1) and Pax2 (TaqMan Gene Expression Assay, Mm01217939_m1) were from Applied Biosystems. The TaqMan expression assay was constituted using reagents from the Brilliant II QRT–PCR 1-step Master Mix kit (Agilent Technologies). The thermal profile used was as follows: 50°C for 30 min, 95°C for 10 min and 45 cycles of 95°C for 15 s, 56°C for 1 min and 72°C for 30 s. The reactions were done in triplicate. The scale bars represent the standard error of mean. Expression was normalized to GAPDH or β-actin levels.
Plasmids
4.1Pax2-Luc, 4.3Pax2-CAT and truncated Pax2-CAT constructs were a kind gift of G. Dressler [51]. The p53 expression vectors have been described previously [80]. Site-directed mutagenesis was done using the QuickChangeTM Site-directed Mutagenesis System (Stratagene, La Jolla, CA) as per manufacturer’s directions.
Cell Culture, Transient Transfection, and Reporter Assays
p53-null human lung carcinoma cells H1299 (ATCC), an E11.5 mouse ureteric bud cell line (UB cells; kind gift of J. Barasch) and mouse kidney cap mesenchyme cell lines (mK3 and mK4 cells; kind gift of S. Potter) were maintained in media supplemented with 10% fetal bovine serum, penicillin (100 units/ml), and streptomycin (100 µg/ml) at 37°C in a humidified incubator with 5% CO2. Cells were transfected with 1.0 µg of DNA/well promoter-reporter vectors along with pCMV-p53-(wt) or pCMV-p53-(mutant) expression plasmids (0–250 ng). Transfection was performed using the Lipofectamine Plus reagent (Invitrogen) according to the manufacturer’s recommendations. Four hours after transfection, fresh medium was replaced, and cell extracts were prepared 24–48 h later using a reporter lysis reagent (Promega). Aliquots of cell lysate were analyzed for CAT or luciferase activity after normalization for protein content or β-galactosidase activity as previously described [81].
Supporting Information
Acknowledgments
The authors would like to thank the Tulane Hypertension and Renal Center of Excellence Molecular and Imaging Core. We thank Dr. G. Dressler for generously providing Pax2-CAT deletion constructs and 4.1Pax2-Luc construct, Dr. Maxime Bouchard for his generous gift of Pax2LacZ/+ mice, and Dr. Michelle Barton for recombinant purified p53. We also thank Drs. S. Potter (mK3 and mK4) and J. Barasch (UB cells) for providing cell-lines. We are grateful to Dr. Karam Aboudehen for his help with the EMSA, and to members of the El-Dahr and Saifudeen laboratories for insightful discussions.
Funding Statement
This work was supported by the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) grant R01DK62550 to SED and by National Institutes of Health National Center for Research Resources (NIH-NCRR) Center of Biomedical Research Excellence grant support P20RR017659 to ZS. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Costantini F, Kopan R (2010) Patterning a complex organ: branching morphogenesis and nephron segmentation in kidney development. Dev Cell 18: 698–712. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Boyle S, Misfeldt A, Chandler KJ, Deal KK, Southard-Smith EM, et al. (2008) Fate mapping using Cited1-CreERT2 mice demonstrates that the cap mesenchyme contains self-renewing progenitor cells and gives rise exclusively to nephronic epithelia. Developmental Biology 313: 234–245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Kobayashi A, Valerius MT, Mugford JW, Carroll TJ, Self M, et al. (2008) Six2 Defines and Regulates a Multipotent Self-Renewing Nephron Progenitor Population throughout Mammalian Kidney Development. Cell Stem Cell 3: 169–181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Karner CM, Das A, Ma Z, Self M, Chen C, et al. (2011) Canonical Wnt9b signaling balances progenitor cell expansion and differentiation during kidney development. Development 138: 1247–1257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Boyle SC, Kim M, Valerius MT, McMahon AP, Kopan R (2011) Notch pathway activation can replace the requirement for Wnt4 and Wnt9b in mesenchymal-to-epithelial transition of nephron stem cells. Development 138: 4245–4254. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Mugford JW, Sipila P, McMahon JA, McMahon AP (2008) Osr1 expression demarcates a multi-potent population of intermediate mesoderm that undergoes progressive restriction to an Osr1-dependent nephron progenitor compartment within the mammalian kidney. Dev Biol 324: 88–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Mugford JW, Yu J, Kobayashi A, McMahon AP (2009) High-resolution gene expression analysis of the developing mouse kidney defines novel cellular compartments within the nephron progenitor population. Dev Biol 333: 312–323. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Reidy KJ, Rosenblum ND (2009) Cell and molecular biology of kidney development. Semin Nephrol 29: 321–337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Chi N, Epstein JA (2002) Getting your Pax straight: Pax proteins in development and disease. Trends in Genetics 18: 41–47. [DOI] [PubMed] [Google Scholar]
- 10. Muratovska A, Zhou C, He S, Goodyer P, Eccles MR (2003) Paired-Box Genes are Frequently Expressed in Cancer and Often required for Cancer Cell Survival. Oncogene 22: 7989–7997. [DOI] [PubMed] [Google Scholar]
- 11. Bouchard M, Souabni A, Mandler M, Neubüser A, Busslinger M (2002) Nephric lineage specification by Pax2 and Pax8. Genes and Dev 16: 2958–2970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Narlis M, Grote D, Gaitan Y, Boualia SK, Bouchard M (2007) Pax2 and pax8 regulate branching morphogenesis and nephron differentiation in the developing kidney. J Am Soc Nephrol 18: 1121–1129. [DOI] [PubMed] [Google Scholar]
- 13. Bouchard M, Pfeffer P, Busslinger M (2000) Functional equivalence of the transcription factors Pax2 and Pax5 in mouse development. Development 127: 3703–3713. [DOI] [PubMed] [Google Scholar]
- 14. Schwarz M, Cecconi F, Bernier G, Andrejewski N, Kammandel B, et al. (2000) Spatial specification of mammalian eye territories by reciprocal transcriptional repression of Pax2 and Pax6. Development 127: 4325–4334. [DOI] [PubMed] [Google Scholar]
- 15. Torres M, Gómez-Pardo E, Dressler GR, Gruss P (1995) Pax-2 controls multiple steps of urogenital development. Development 121: 4057–4065. [DOI] [PubMed] [Google Scholar]
- 16. Sanyanusin P, Schimmenti LA, McNoe LA, Ward TA, Pierpont ME, et al. (1995) Mutation of the PAX2 gene in a family with optic nerve colobomas, renal anomalies and vesicoureteral reflux. Nat Genet 9: 358–364. [DOI] [PubMed] [Google Scholar]
- 17. Porteous S, Torban E, Cho NP, Cunliffe H, Chua L, et al. (2000) Primary renal hypoplasia in humans and mice with PAX2 mutations: evidence of increased apoptosis in fetal kidneys of Pax2(1Neu) +/− mutant mice. Hum Mol Genet 9: 1–11. [DOI] [PubMed] [Google Scholar]
- 18. Gong K-Q, Yallowitz AR, Sun H, Dressler GR, Wellik DM (2007) A Hox-Eya-Pax Complex Regulates Early Kidney Developmental Gene Expression. Mol Cell Biol 27: 7661–7668. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Brodbeck S, Englert C (2004) Genetic Determination of Nephrogenesis: the Pax/Eya/Six Gene Network. Pediatr Nephrol 19: 249–255. [DOI] [PubMed] [Google Scholar]
- 20. Brophy PD, Ostrom L, Lang KM, Dressler GR (2001) Regulation of ureteric bud outgrowth by Pax2-dependent activation of the glial derived neurotrophic factor gene. Development 128: 4747–4756. [DOI] [PubMed] [Google Scholar]
- 21. Torban E, Dziarmaga A, Iglesias D, Chu LL, Vassilieva T, et al. (2006) PAX2 activates WNT4 expression during mammalian kidney development. J Biol Chem 281: 12705–12712. [DOI] [PubMed] [Google Scholar]
- 22. Stiewe T (2007) The p53 family in differentiation and tumorigenesis. Nat Rev Cancer 7: 165–168. [DOI] [PubMed] [Google Scholar]
- 23. Zhao T, Yu X (2010) p53 and Stem cells: New Developments and New Concerns. Trends in Cell Biology 20: 170–175. [DOI] [PubMed] [Google Scholar]
- 24. Horn HF, Vousden KH (2007) Coping with stress: multiple ways to activate p53. Oncogene 26: 1306–1316. [DOI] [PubMed] [Google Scholar]
- 25. Lin T, Chao C, Saito S, Mazur SJ, Murphy ME, et al. (2005) p53 induces differentiation of mouse embryonic stem cells by suppressing Nanog expression. Nat Cell Biol 7: 165–171. [DOI] [PubMed] [Google Scholar]
- 26. Cicalese A, Bonizzi G, Pasi CE, Faretta M, Ronzoni S, et al. (2009) The tumor suppressor p53 regulates polarity of self-renewing divisions in mammary stem cells. Cell 138: 1083–1095. [DOI] [PubMed] [Google Scholar]
- 27. Zhao Z, Zuber J, Diaz-Flores E, Lintault L, Kogan SC, et al. (2010) p53 loss promotes acute myeloid leukemia by enabling aberrant self-renewal. Genes Dev 24: 1389–1402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Armata HL, Golebiowski D, Jung DY, Ko HJ, Kim JK, et al. (2010) Requirement of the ATM/p53 Tumor Suppressor Pathway for Glucose Homeostasis. Mol Cell Biol 30: 5787–5794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Zhang L, Yu D, Hu M, Xiong S, Lang A, et al. (2000) Wildtype p53 suppresses angiogenesis in human leiomyosarcoma and synovial sarcoma by transcriptional suppression of vascular endothelial growth factor expression. Cancer Res 60: 3655–3661. [PubMed] [Google Scholar]
- 30. Teodoro JG, Parker AE, Zhu X, Green MR (2006) p53-mediated inhibition of angiogenesis through up-regulation of a collagen prolyl hydroxylase. Science 313: 968–971. [DOI] [PubMed] [Google Scholar]
- 31. Schmid P, Lorenz A, Hameister H, Montenarh M (1991) Expression of p53 during mouse embryogenesis. Development 113: 857–865. [DOI] [PubMed] [Google Scholar]
- 32. Choi J, Donehower LA (1999) p53 in embryonic development: maintaining a fine balance. Cell Mol Life Sci 55: 38–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Jacks T, Remington L, Williams BO, Schmitt EM, Halachmi S, et al. (1994) Tumor spectrum analysis in p53-mutant mice. Curr Biol 4: 1–7. [DOI] [PubMed] [Google Scholar]
- 34. Sah VP, Attardi LD, Mulligan GJ, Williams BO, Bronson RT, et al. (1995) A subset of p53-deficient embryos exhibit exencephaly. Nat Genet 10: 175–180. [DOI] [PubMed] [Google Scholar]
- 35. Baatout S, Jacquet P, Michaux A, Buset J, Vankerkom J, et al. (2002) Developmental abnormalities induced by X-irradiation in p53 deficient mice. In Vivo 16: 215–221. [PubMed] [Google Scholar]
- 36. Ikeda S, Hawes NL, Chang B, Avery CS, Smith RS, et al. (1999) Severe ocular abnormalities in C57BL/6 but not in 129/Sv p53-deficient mice. Invest Ophthalmol Vis Sci 40: 1874–1878. [PubMed] [Google Scholar]
- 37. Rotter V, Schwartz D, Almon E, Goldfinger N, Kapon A, et al. (1993) Mice with reduced levels of p53 protein exhibit the testicular giant-cell degenerative syndrome. Proc Natl Acad Sci U S A 90: 9075–9079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Hoever M, Clement JH, Wedlich D, Montenarh M, Knochel W (1994) Overexpression of wild-type p53 interferes with normal development in Xenopus laevis embryos. Oncogene 9: 109–120. [PubMed] [Google Scholar]
- 39. Wallingford JB, Seufert DW, Virta VC, Vize PD (1997) p53 activity is essential for normal development in Xenopus. Curr Biol 7: 747–757. [DOI] [PubMed] [Google Scholar]
- 40. Cordenonsi M, Dupont S, Maretto S, Insinga A, Imbriano C, et al. (2003) Links between tumor suppressors: p53 is required for TGF-beta gene responses by cooperating with Smads. Cell 113: 301–314. [DOI] [PubMed] [Google Scholar]
- 41. Saifudeen Z, Dipp S, Stefkova J, Yao X, Lookabaugh S, et al. (2009) p53 regulates metanephric development. J Am Soc Nephrol 20: 2328–2337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Saifudeen Z, Dipp S, El-Dahr SS (2002) A role for p53 in terminal epithelial cell differentiation. J Clin Invest 109: 1021–1030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Molchadsky A, Shats I, Goldfinger N, Pevsner-Fischer M, Olson M, et al. (2008) p53 plays a role in mesenchymal differentiation programs, in a cell fate dependent manner. PLoS One 3: e3707. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Almog N, Rotter V (1997) Involvement of p53 in cell differentiation and development. Biochim Biophys Acta 1333: F1–27. [DOI] [PubMed] [Google Scholar]
- 45. Qin Q, Baudry M, Liao G, Noniyev A, Galeano J, et al. (2009) A Novel Function for p53: Regulation of Growth Cone Motility through Interaction with Rho Kinase. 29: 5183–5192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Montes de Oca Luna R, Wagner DS, Lozano G (1995) Rescue of early embryonic lethality in mdm2-deficient mice by deletion of p53. Nature 378: 203–206. [DOI] [PubMed] [Google Scholar]
- 47. Hilliard S, Aboudehen K, Yao X, El-Dahr SS (2011) Tight regulation of p53 activity by Mdm2 is required for ureteric bud growth and branching. Dev Biol 353: 354–366. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Aboudehen K, Hilliard S, Saifudeen Z, El-Dahr SS (2012) Mechanisms of p53 activation and physiological relevance in the developing kidney. American Journal of Physiology - Renal Physiology 302: F928–F940. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Dermitzakis ET, Reymond A, Antonarakis SE (2005) Conserved non-genic sequences – an unexpected feature of mammalian genomes. Nat Rev Genetics 6: 151–157. [DOI] [PubMed] [Google Scholar]
- 50. Valerius MT, Patterson LT, Witte DP, Potter SS (2002) Microarray analysis of novel cell lines representing two stages of metanephric mesenchyme differentiation. Mech Dev 112: 219–232. [DOI] [PubMed] [Google Scholar]
- 51. Patel SR, Dressler GR (2004) Expression of Pax2 in the intermediate mesoderm is regulated by YY1. Dev Biol 267: 505–516. [DOI] [PubMed] [Google Scholar]
- 52. el-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW, Vogelstein B (1992) Definition of a consensus binding site for p53. Nat Genet 1: 45–49. [DOI] [PubMed] [Google Scholar]
- 53. Stuart ET, Haffner R, Oren M, Gruss P (1995) Loss of p53 function through PAX-mediated transcriptional repression. EMBO J 14: 5638–5645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Pfeffer PL, Payer B, Reim G, di Magliano MP, Busslinger M (2002) The activation and maintenance of Pax2 expression at the mid-hindbrain boundary is controlled by separate enhancers. Development 129: 307–318. [DOI] [PubMed] [Google Scholar]
- 55. Torres M, Gomez-Pardo E, Gruss P (1996) Pax2 contributes to inner ear patterning and optic nerve trajectory. Development 122: 3381–3391. [DOI] [PubMed] [Google Scholar]
- 56. Sasai N, Yakura R, Kamiya D, Nakazawa Y, Sasai Y (2008) Ectodermal factor restricts mesoderm differentiation by inhibiting p53. Cell 133: 878–890. [DOI] [PubMed] [Google Scholar]
- 57. Takebayashi-Suzuki K, Funami J, Tokumori D, Saito A, Watabe T, et al. (2003) Interplay between the tumor suppressor p53 and TGF beta signaling shapes embryonic body axes in Xenopus. Development 130: 3929–3939. [DOI] [PubMed] [Google Scholar]
- 58. Grieshammer U, Cebrian C, Ilagan R, Meyers E, Herzlinger D, et al. (2005) FGF8 is required for cell survival at distinct stages of nephrogenesis and for regulation of gene expression in nascent nephrons. Development 132: 3847–3857. [DOI] [PubMed] [Google Scholar]
- 59. Perantoni AO, Timofeeva O, Naillat F, Richman C, Pajni-Underwood S, et al. (2005) Inactivation of FGF8 in early mesoderm reveals an essential role in kidney development. Development 132: 3859–3871. [DOI] [PubMed] [Google Scholar]
- 60. Poladia DP, Kish K, Kutay B, Hains D, Kegg H, et al. (2006) Role of fibroblast growth factor receptors 1 and 2 in the metanephric mesenchyme. Developmental Biology 291: 325–339. [DOI] [PubMed] [Google Scholar]
- 61. Sims-Lucas S, Cusack B, Baust J, Eswarakumar VP, Masatoshi H, et al. (2011) Fgfr1 and the IIIc isoform of Fgfr2 play critical roles in the metanephric mesenchyme mediating early inductive events in kidney development. Dev Dyn 240: 240–249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62. Naim E, Bernstein A, Bertram JF, Caruana G (2005) Mutagenesis of the epithelial polarity gene, discs large 1, perturbs nephrogenesis in the developing mouse kidney. Kidney Int 68: 955–965. [DOI] [PubMed] [Google Scholar]
- 63. Mah SP, Saueressig H, Goulding M, Kintner C, Dressler GR (2000) Kidney Development in Cadherin-6 Mutants: Delayed Mesenchyme-to-Epithelial Conversion and Loss of Nephrons. Developmental Biology 223: 38–53. [DOI] [PubMed] [Google Scholar]
- 64. Sorenson CM (2004) Interaction of bcl-2 with Paxillin through Its BH4 Domain Is Important during Ureteric Bud Branching. Journal of Biological Chemistry 279: 11368–11374. [DOI] [PubMed] [Google Scholar]
- 65. Hollander MC, Alamo I, Jackman J, Wang MG, McBride OW, et al. (1993) Analysis of the mammalian gadd45 gene and its response to DNA damage. Journal of Biological Chemistry 268: 24385–24393. [PubMed] [Google Scholar]
- 66. Morris GF, Bischoff JR, Mathews MB (1996) Transcriptional activation of the human proliferating-cell nuclear antigen promoter by p53. Proceedings of the National Academy of Sciences 93: 895–899. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67. Thornborrow EC, Manfredi JJ (1999) One Mechanism for Cell Type-specific Regulation of thebax Promoter by the Tumor Suppressor p53 Is Dictated by the p53 Response Element. Journal of Biological Chemistry 274: 33747–33756. [DOI] [PubMed] [Google Scholar]
- 68. Zauberman A, Flusberg D, Haupt Y, Barak Y, Oren M (1995) A functional p53-responsive intronic promoter is contained within the human mdm2 gene. Nucleic Acids Research 23: 2584–2592. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69. Bouchard M, Grote D, Craven SE, Sun Q, Steinlein P, et al. (2005) Identification of Pax2-regulated genes by expression profiling of the mid-hindbrain organizer region. Development 132: 2633–2643. [DOI] [PubMed] [Google Scholar]
- 70. El-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, et al. (1993) WAF1, a potential mediator of p53 tumor suppression. Cell 75: 817–825. [DOI] [PubMed] [Google Scholar]
- 71. Park D, Jia H, Rajakumar V, Chamberlin HM (2006) Pax2/5/8 proteins promote cell survival in C. elegans. Development 133: 4193–4202. [DOI] [PubMed] [Google Scholar]
- 72. Yu J, Zhang L, Hwang PM, Kinzler KW, Vogelstein B (2001) PUMA Induces the Rapid Apoptosis of Colorectal Cancer Cells. Molecular Cell 7: 673–682. [DOI] [PubMed] [Google Scholar]
- 73. Oda E, Ohki R, Murasawa H, Nemoto J, Shibue T, et al. (2000) Noxa, a BH3-Only Member of the Bcl-2 Family and Candidate Mediator of p53-Induced Apoptosis. Science 288: 1053–1058. [DOI] [PubMed] [Google Scholar]
- 74. Clark P, Dziarmaga A, Eccles M, Goodyer P (2004) Rescue of Defective Branching Nephrogenesis in Renal-Coloboma Syndrome by the Caspase Inhibitor, Z-VAD-fmk. Journal of the American Society of Nephrology 15: 299–305. [DOI] [PubMed] [Google Scholar]
- 75. Dressler GR, Douglass EC (1992) Pax-2 is a DNA-binding protein expressed in embryonic kidney and Wilms tumor. Proceedings of the National Academy of Sciences 89: 1179–1183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76. Rothenpieler UW, Dressler GR (1993) Pax-2 is required for mesenchyme-to-epithelium conversion during kidney development. Development 119: 711–720. [DOI] [PubMed] [Google Scholar]
- 77. Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, et al. (2008) Model-based analysis of ChIP-Seq (MACS). Genome Biol 9: R137. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78. Saifudeen Z, Diavolitsis V, Stefkova J, Dipp S, Fan H, et al. (2005) Spatiotemporal switch from DeltaNp73 to TAp73 isoforms during nephrogenesis: impact on differentiation gene expression. J Biol Chem 280: 23094–23102. [DOI] [PubMed] [Google Scholar]
- 79. Chen S, Bellew C, Yao X, Stefkova J, Dipp S, et al. (2011) Histone Deacetylase (HDAC) Activity Is Critical for Embryonic Kidney Gene Expression, Growth, and Differentiation. J Biol Chem 286: 32775–32789. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80. Saifudeen Z, Dipp S, Fan H, El-Dahr SS (2005) Combinatorial control of the bradykinin B2 receptor promoter by p53, CREB, KLF-4, and CBP: implications for terminal nephron differentiation. Am J Physiol Renal Physiol 288: F899–909. [DOI] [PubMed] [Google Scholar]
- 81. Saifudeen Z, Du H, Dipp S, El-Dahr SS (2000) The bradykinin type 2 receptor is a target for p53-mediated transcriptional activation. J Biol Chem 275: 15557–15562. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.