Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Oct 1.
Published in final edited form as: FEBS J. 2012 Aug 31;279(19):3715–3726. doi: 10.1111/j.1742-4658.2012.08733.x

Homeodomain containing protein HOXB9 regulates expression of growth and angiogenic factors, facilitates tumor growth in vitro and is overexpressed in breast cancer tissue

Bishakha Shrestha 1, Khairul I Ansari 1, Arunoday Bhan 1, Sahba Kasiri 1, Imran Hussain 1, Subhrangsu S Mandal 1,*
PMCID: PMC3445661  NIHMSID: NIHMS398740  PMID: 22863320

Abstract

HOXB9 is a homeobox containing gene and is critical for the development of mammary gland and sternum. HOXB9 is also regulated by estrogen and is critical for angiogenesis. Herein, we investigated the biochemical roles of HOXB9 and its homeodomain in cell cycle progression and tumorigenesis. Our studies demonstrated that HOXB9 is overexpressed in breast cancer tissue. HOXB9 overexpression stimulated three-dimensional colony formation in soft-agar assay. HOXB9 binds to the promoters of various tumor growth and angiogenic factors and regulates their expression. Homeodomain of HOXB9 plays crucial roles in transcriptional regulation of tumor growth factors and also in three dimensional colony formation indicating crucial roles of HOXB9 homeodomain in tumorigenesis. Overall, we demonstrated that HOXB9 is critical regulators of tumor growth factors and is associated with tumorigenesis.

Keywords: HOXB9, Breast cancer, tumor growth, colony formation, gene regulation

Introduction

Homeobox (HOX) containing genes are evolutionarily conserved family of genes that play pivotal roles during embryogenesis and development [1-3]. HOX gene expression controls regional identity along the body axis and hence regulates the morphogenesis during development. There are 39 HOX genes in human that are organized in four different clusters, HOXA-D, located in chromosomes 7, 17, 12, and 2, respectively [4]. Colinear expression of HOX genes are linked with the nature of the body structures at different stages of development [5-7]. In addition to their critical roles in embryogenesis, HOX genes are also important in adult tissue where each HOX gene expression appears to be regulated independently [3, 8]. HOX genes encode transcription factors that contain a characteristic homeodomain through which they recognize the promoters of target genes and regulate their expression [9, 10]. The homeodomain is a highly conserved DNA-binding domain containing a helix-turn-helix motif usually about 60 amino acids in length, and is encoded by the homeobox present in the HOX genes. The homeodomain binds to 5′-TAAT-3′ core sequence present in the promoter of the target genes [10, 11]. The sequences surrounding TAAT motif also play important role in recognition of target motif by HOX proteins. The HOX gene binding facilitates subsequent recruitment of various chromatin remodeling factors, histone acetyl transferases, and general transcription factors on the gene promoter leading to transcription activation [12-14]. Beyond their critical roles during embryogenesis, increasing amounts of studies demonstrate that HOX genes are overexpressed in variety of cancers including breast and prostate cancer [15, 16]. HOX gene expression is linked with cell proliferation, tumor growth, and angiogenesis [8, 17-19]. Though HOX genes are key players in development and their dysregulation is associated with human diseases, little is known about their gene expression and regulation and their roles in disease pathogenesis.

HOXB9 is a well known player in development of mammary gland and sternum [20, 21]. Homozygous mutation of HOXB9 in mice results in abnormal thoracic skeletal development [20, 22]. Ribs get fused and attached with abnormally developed sternum [21]. HOXB9 appears to play synergistic activity with other paralogous HOX genes such as HOXA9 during thoracic and sternum development. The defects in HOXB9 and HOXA9/HOXB9 mutant mice are concentrated along the axial column at the points of transition between vertebral types [21]. Beyond its developmental roles, HOXB9 plays critical roles in transcriptional regulation of renin, an aspartyl protease that is crucial for the production of angiotensin and regulation of blood pressure and cardiac function [23]. HOXB9, in coordination with PBX (another homeodomain containing protein), binds to the promoter of renin and regulates its expression [23]. HOXB9 has also been implicated in angiogenesis [24]. Although HOXB9 itself is not associated with oncogenic transformation, it promotes tumor progression and distal metastasis when co-expressed with transforming oncogene (such as Ras) [25]. HOXB9 is also shown to be involved in DNA damage response and radiation resistance through transactivation of TGFβ in breast cancer cells [24, 25]. Recently we demonstrated that HOXB9 is an estrogen-responsive gene and mixed lineage leukemia (MLL) family of histone methyl-transferases coordinate with estrogen-receptors (ER) and transcriptionally regulate HOXB9 expression in presence of estrogen [26]. Though, HOXB9 is a critical player during organogenesis, limb development, and disease, and is transcriptionally regulated by estrogen, the biochemical mechanism of action and roles of HOXB9 in tumorigenesis is mostly unknown. Herein, we investigated the biochemical function of HOXB9 and its homeodomain in tumorigenesis and regulation of tumor growth and angiogenic factors. Our results demonstrated that HOXB9 plays crucial roles in regulating tumor growth factors, three dimensional (3D) colony formation through its homeodomain and is overexpressed in breast cancer.

Results

HOXB9 is overexpressed in breast cancer tissue

As HOXB9 is associated with mammary gland development and its transcription is regulated by estrogen [26], we examined its expression in different types of malignant and non-malignant human cell lines including breast cancer cells and tissue. Real-time PCR (qPCR) analysis of the RNA isolated from different cell lines demonstrated that HOXB9 is differentially expressed in various cell lines and its expression was higher in breast cancer cell (MCF7) and cervical cancer cells (HeLa) in comparison to other cell lines (Figure 1A). Notably, MCF7 is an estrogen-receptor (ER) positive breast cancer cell line [27] and thus overexpression of HOXB9 in MCF7 cells might be associated with estrogen-induced gene activation.

Figure 1.

Figure 1

Open in a new tab

HOXB9 expression in different human cell lines and breast cancer tissue. (A) The total RNA was isolated from different cell lines, reverse-transcribed to cDNA and analyzed by real-time PCR using primers specific to HOXB9. GAPDH was used as a loading control. HOXB9 expression relative to GAPDH is plotted. Each experiment was repeated at least thrice. Bars indicate standard errors (n=3, p<0.05)). (B-D) HOXB9 expression in breast cancer tissue: Human breast cancer tissue microarray (6 cases of breast cancer along with their matched adjacent normal breast tissue) was immunostained (DAB staining) with HOXB9 antibody. Magnified view of tissue histology (at two different magnification) showing HOXB9 expression in case 6 is shown in panel C and the relative quantification of HOXB9 expression within the tissue section is presented in panel D. Statistical analysis of 6 control and 6 breast cancer tissues showing the cumulative expression level of the control and cancer tissues is also shown (n= 6, p<0.05)

To examine the expression of HOXB9 in breast cancer tissue, we obtained breast cancer tissue microarray from commercial source that contains 6 cases of breast cancer (in duplicates) along with corresponding adjacent normal tissue and subjected to immunohistochemical staining (DAB staining) using HOXB9 antibody. Analysis of immunohistological staining of tissue microarray showed that HOXB9 expression was relatively higher (more intense DAB staining) in most cases of breast cancer tissue examined in comparison to its corresponding adjacent breast normal tissues (Figure 1B, the microscopic images of case-6 is shown in two different level of magnifications in figure 1C, quantification is shown in 1D). Notably cell densities in each case of breast cancer tissue were much higher in comparison to the surrounding normal tissue (Figure 1C). In combination with cell culture analysis in figure 1A, the increased level of HOXB9 protein in breast cancer tissue compared to its corresponding normal healthy tissue indicated that HOXB9 expression is potentially upregulated in breast cancer.

HOXB9 over expression induces 3D tumor colony formation via involvement of its homeodomain in soft-agar assay

As our studies showed that HOXB9 is over expressed in breast cancer, we examined if it has any roles in tumor growth using a in vitro 3-dimensional colony formation assay in soft-agar media [28]. Toward this goal, initially we generated a HOXB9 overexpressed stable transfected cell line in HEK293 cells. HEK293 cell line is originated from a healthy embryonic tissue but not a tumor cell line and it has been extensively used for making stable transfected cell line for over expressing diverse types of genes. HOXB9 is a 258 amino acid long homeodomain containing protein where the homeodomain is located towards the carboxy-terminus (185 aa-247aa) (Figure 2A). Notably, HOXB9 also contains a nuclear localization signal (NLS) which is present within its homeodomain (Figure 2A). HOX genes are well known as transcription factors and they bind to their target gene promoters via homeodomain and regulate gene expression [9, 10]. To explore potential cellular functions of HOXB9 and its homeodomain, in addition to full-length HOXB9 stable cells, we also generated another stable transfected cell line overexpressing the homeodomain truncated HOXB9 (Figure 2A). Briefly, the full-length HOXB9 and HOXB9 with homeodomain deletion were cloned in a pFlag-CMV4 human expression construct, transfected into HEK293 cells and stable transformants were selected using G418 antibiotic selection procedure [29]. Individual colonies expressing the Flag-HOXB9 or homeodomain deleted HOXB9 (Flag-HOXB9-ΔHD) were isolated and maintained separately under G418 containing media [29]. To examine the expression level as well as cellular localization of HOXB9, we fractionated the cytoplasm and nuclear extracts from Flag-HOXB9 and Flag-HOXB9-ΔHD stable cell lines and analyzed by Western blotting using anti-Flag antibody. These analyses demonstrated that full length protein (Flag-HOXB9) is overexpressed in the stable cell line and primarily enriched in the nuclear fraction in comparison to cytoplasmic fraction (compare lanes 1 and 3, Figure 2B). However, upon deletion of homeodomain, HOXB9-ΔHD is redistributed and enriched primarily in the cytoplasm (compare lanes 2 and 4, Figure 2B).

Figure 2.

Figure 2

Open in a new tab

Subcellular distribution of HOXB9 and homeodomain truncated HOXB9. (A) Diagrammatic representation of Flag-HOXB9 and Flag-HOXB9-ΔHD. (B) Stable cells expressing Flag-HOXB9 and Flag-HOXB9-ΔHD were fractionated to cytoplasmic and nuclear extracts and analyzed by Western blotting using anti-flag antibody. (C) Flag-HOXB9 and Flag-HOXB9-ΔHD stable cells were immunostained with Flag and RNAPII antibodies followed by FITC or TRITC conjugated secondary antibodies. DAPI was used to stain the nucleus and visualized under a fluorescence microscope.

We further examined the cellular distribution of HOXB9 using immunofluorescence staining and microscopy. We performed co-immunostaining of Flag-HOXB9 and Flag-HOXB9-ΔHD stable cell lines using anti-flag and RNA polymerase II (RNAPII) antibodies. Nucleus was visualized by DAPI staining. Fluorescence microscopic analysis of the immunostained cells showed that HOXB9 (Flag-HOXB9) is primarily localized in the nucleus (Figure 2C). Upon deletion of homeodomain (Flag-HOXB9-ΔHD) nuclear localization is lost and homeodomain deleted HOXB9 protein was spread all over the cells (Figure 2C). RNAPII was used as nuclear protein marker which binds to the transcriptionally active chromatins [30]. These observations demonstrated that HOXB9 is primarily a nuclear protein and its homeodomain plays essential roles in this process.

In order to examine the impact of HOXB9 in tumorigenesis we performed 3D-colony formation assay using Flag-HOXB9 and Flag-HOXB9-ΔHD in soft agar. In brief, we plated HEK293 cells and stable cell lines overexpressing Flag-HOXB9 and Flag-HOXB9-ΔHD in soft agar, cells were fed with 2×FBS containing media and allowed to grow for 5-6 week, until visible colonies were formed. Colonies at different layers were counted under microscope and plotted. This analysis demonstrated that HEK293 stable cells overexpressing Flag-HOXB9 formed distinctly visible three dimensional colonies embedded in different layers of soft agar (Figure 3A, expanded view of colonies is shown in the bottom panels). The number of colonies in different cell lines were counted under a microscope and plotted in figure 3B. Interestingly, there were very few small colonies of cells in the plates containing Flag-HOXB9-ΔHD stable cell line and almost no colonies were observed in the untransfected HEK293 cells (Figure 3A-B), whereas about 8-10 fold more colonies were distinctly visible in the Flag-HOXB9 overexpressed cell lines. These observations demonstrated that HOXB9 overexpression contributed towards the formation of large 3D-growth of cell colonies indicating potential roles of HOXB9 in tumorigenesis. The reduction in number of colonies and sizes of the 3D-growth in the homeodomain deleted HOXB9 strain (Flag-HOXB9-ΔHD) demonstrated potential roles of HOXB9 homeodomain in 3D-colony formation and tumorigenesis.

Figure 3.

Figure 3

Open in a new tab

Colony forming ability of Flag-HOXB9 and Flag-HOXB9-ΔHD cells. HEK293 cells, Flag-HOXB9 and Flag-HOXB9-ΔHD overexpressed cells (stable cell lines) were grown in soft agar for 21 days and fed with media every 2 days. The colonies formed in soft agar were stained with 0.005% crystal violet solution and observed under microscope (panel A). Magnified views of selected colonies are shown on the bottom panel (A). Number of colonies grown in soft agar were counted under light microscope and plotted. Bars represent standard errors (n = 3, p<0.05).

HOXB9 overexpression induces the expression of tumor growth and angiogenic factors through the involvement of its homeodomain

To examine potential mechanism of tumor growth mediated by HOXB9, we examined its roles in transcriptional regulation of various tumor growth and angiogenic factors such as vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), transforming growth factor (TGFβ), and neuregulin-2 (NRG2) under both HOXB9-overexpressed and homeodomain deleted environment [24, 31, 32]. We isolated RNA from the control HEK293, Flag-HOXB9 and Flag-HOXB9-ΔHD stable cell lines, reverse-transcribed into cDNA, and analyzed the expression of VEGF, bFGF, TGFβ1, and NRG2. Our results demonstrated that overexpression of HOXB9 (Flag-HOXB9 stable cell line) resulted in upregulation of VEGF, bFGF, TGFβ1 and NRG2 genes (Figure 4A, quantifications are shown in right panel). The deletion of homeodomain of HOXB9 (HOXB9-ΔHD) resulted in decreased expression of above genes almost to the basal level further indicating critical roles of HOXB9 and its homeodomain in transcriptional regulation of tumor growth and angiogenic factors.

Figure 4.

Figure 4

Open in a new tab

Role of HOXB9 in expression of tumor growth and angiogenic factors (A) Analysis of expression of growth and angiogenic factors. The RNA extracts of HEK293, Flag-HOXB9 and Flag-HOXB9-ΔHD over expressed cells were subjected to RT-PCR with primers specific to HOXB9, VEGF, bFGF, TGFβ1 and NRG2 and GAPDH (loading control). Real-time quantification is shown in right panel. Bars indicate statdard error ((n = 3, p<0.05). (B) ChIP assay: HEK293, Flag-HOXB9 and Flag-HOXB9-ΔHD cells were subjected to ChIP assay with anti-Flag, RNAPII and H3K4-trimethyl antibodies and the ChIP DNA was anlayzed by PCR with primers specific to promoters of VEGF, bFGF, TGFβ1 and NRG2. Real-time quantification of recruitment level of Flag-HOXB9 (relative to input) is on bottom panel. Bars indicate standard errors ((n = 3, p<0.05).

ChIP assay demonstrated that in Flag-HOXB9 overexpressed cells, the level of RNAPII recruitment and H3K4-trimethylation were increased in the promoter of VEGF, bFGF, TGFβ1 and NRG2 genes, while these recruitment levels were decreased in Flag-HOXB9-ΔHD stable cell line (Figure 4B, quantification in the bottom panel). Actin ChIP was performed as negative control (data not shown). Notably, H3K4-trimethylation in the promoter is associated with gene activation [26, 29, 33-38]. Therefore, the increased recruitment of RNAPII and level of H3K4-trimethylation in the HOXB9 target gene promoters upon over expression of HOXB9, indicated that HOXB9 is a key regulator of transcription activation of tumor growth and angiogenic factors.

HOXB9 knockdown downregulated the expression of tumor growth and angiogenic factors

To further confirm the roles of HOXB9 in controlling tumor growth factors, we knocked down HOXB9 in HEK293 cells (as well as in MCF7, data not shown) using HOXB9 specific antisense-oligonucleotide and examined its impact on VEGF, bFGF, TGFβ1 and NRG2 genes expression. We transfected HEK293 cells using HOXB9 antisense (and scramble antisense with no homology to HOXB9) using lipofectamine transfection reagent for 60 h, isolated the RNA, reverse transcribed and subjected to real-time PCR analysis. Our analysis demonstrated that HOXB9 antisense efficiently knocked down HOXB9 expression both at the mRNA and protein levels (Figures 5A and B, quantifications in the right panel). Scramble antisense has no significant impact on HOXB9 expression (Figures 5A-B). Interestingly, upon knockdown of HOXB9, VEGF, bFGF, TGFβ1 and NRG2 genes were downregulated (Figure 5B, quantifications on the right panel). ChIP analysis showed that HOXB9 knockdown also downregulated the recruitment of HOXB9, RNAPII and level of H3K4-trimethylation at the promoter of above target genes (Figure 5C). These results further demonstrated that HOXB9 plays critical roles in transcriptional regulation of key genes associated with tumor growth and angiogenesis.

Figure 5.

Figure 5

Open in a new tab

A-B) Effect of HOXB9 knockdown on the expression of tumor growth and angiogenic factors. HEK293 cells were transfected with HOXB9 specific and scramble antisenses (72 h). The protein extracts of control and antisense-treated cells were analyzed by Western blotting with HOXB9 and actin (loading control) antibodies (panel A, quantification on the bottom panel). The RNA from the control and antisense-treated cells were analyzed by RT-PCR with primers specific to HOXB9, VEGF, bFGF, TGFβ1 and NRG2 (panel B). GAPDH was used as control. Real time quantification of expression relative to GAPDH is shown in right panel. Bars indicate standard errors (n = 3, p<0.05). (C) ChIP assay: The control, scramble and HOXB9 antisense treated cells were subjected to ChIP assay with RNAPII, HOXB9, and H3K4-trimethyl antibodies. The ChIP DNA was PCR-amplified using primers specific to VEGF, bFGF, TGFβ1 and NRG2.

Discussion

In addition to their crucial roles during embryogenesis, increasing amounts of studies recognize that HOX genes play crucial roles in adult tissue and often some of the HOX genes are misregulated in various types of cancer [16, 39]. For example, HOXC6, a critical player in mammary gland development, is over expressed in breast and prostate cancer [8]. HOXA10 expression is associated with endometrial cancer [40]. In this study, we demonstrated that HOXB9, which is well known to be a critical player in developments of mammary gland and sternum [41] and in regulation of renin-angiotensin system [23], is upregulated in breast cancer tissue. HOXB9 expression was also higher in various tumor cells including estrogen-receptor positive breast cancer cells MCF7. In a recent study, we also observed that HOXB9 transcription is stimulated by estrogen in estrogen-receptor positive breast cancer cells (MCF7) and also in placenta choriocarcinoma cells (JAR) [26]. The transcriptional regulation of HOXB9 by estrogen, its association with steroid responsive organogenesis and overexpression in breast cancer tissue suggest that it is an estrogen-regulated gene. The overexpression of HOXB9 in breast cancer is likely due to the higher estrogenic activity present in the breast cancer tissues. HOXB9 is also over expressed in other types of cancer cells such as HeLa (cervical cancer), H358 (lung cancer), JAR (placenta choriocarcinoma), etc, and these results indicate that HOXB9 may be associated with other types of cancer as well.

Our studies demonstrated that HOXB9 is overexpressed in breast cancer tissue and cells. Recent studies also demonstrated that HOXB9 is a critical player in angiogenesis and tumor growth [42]. Herein, using in vitro colony formation assay we examined the roles of HOXB9 and its homeodomain in three-dimensional growth and colony formation of HEK293 cells. Notably, in order to examine the effects of HOXB9 over expression on tumorigenesis, we selected HEK293 cell line because it is originally not a tumor cell line, but originated from a healthy embryonic tissue. This allowed us to examine the impact of HOXB9 over expression and its functions on tumorigenesis under a non-tumorigenic background. Our studies demonstrated that overexpression of full-length HOXB9 resulted in formation of large number (20 fold) of 3D-colonies in soft-agar media in comparison to the untransfected normal HEK293 cells under similar condition. Sizes of the colonies were big enough to visualize under naked eye. Interestingly, overexpression of homeodomain truncated HOXB9 in HEK293 cells, reduced numbers of cell colonies almost to the level of untransfected cell. These observations demonstrated that HOXB9 overexpression induced colony formation and 3D-growth of cells and hence may be critical for tumorigenesis and this role of HOXB9 is mediated via coordination of its homeodomain.

Tumor growth is critically linked with expression of various growth and angiogenic factors and their receptors within tumor [43-45]. For example, vascular endothelial growth factor (VEGF) that generally overexpresses within tumor microenvironment binds to VEGF receptor (VEGFR) localized in the endothelial cell surface [43, 44]. The activated VEGFR regulates various angiogenic factors and promotes vasculogenesis. The basic fibroblast growth factor (bFGF) expresses in the basement membranes neighboring endothelial cell and supports differentiation and maintenance of endothelial layers of blood vessels [44]. Similarly the Transforming growth factor β1 (TGFβ1) is a multifunctional molecule that generally controls cell cycle, induces cell differentiation and promotes apoptosis [45]. In cancerous cell the TGFβ1 signaling pathways is often disrupted leading to over expression of the growth factor. Increased expression of TGFβ1 causes immunosuppression and angiogenesis, which makes the cancer more invasive [45]. Similarly, the epidermal-growth-factor-like (EGF-like) factor NRG2 (neuregulin 2) influences the growth, differentiation and survival of several cell types [46]. NRG2 is required for angiogenesis and arteriogenesis induced by ischaemic injury [46, 47]. In our study, we demonstrated that HOXB9 overexpression induced the expression of VEGF, bFGF, TGFβ1 and NRG2. HOXB9 is a homeodoamin containing transcription factor and our studies demonstrated that HOXB9 binds to the promoters of tumor growth and angiogenic factors via its homeodoamin and hence regulates their transcription. Furthermore, knockdown of HOXB9 down regulated the expression of those tumor growth and angiogenic factors. Additionally, HOXB9 contains a nuclear localization signal (NLS) which is localized within its homeodoamin (Fig. 2A). In the homeodoamin deletion mutant (HOXB9-ΔHD), we have deleted the NLS along with the homeodoamin and that may have resulted in the loss in nuclear localization of HOXB9-ΔHD (Fig 2B-C) and decrease in binding of HOXB9-ΔHD to the target gene promoters (Fig 4) leading to down regulation of target gene expression. Thus, our biochemical studies demonstrated that HOXB9 is a critical transcription factor that regulates the expression of tumor growth and angiogenic factors, via involvement of HOXB9 homeodoamin. The overexpression of HOXB9 upregulated the expression of tumor growth and angiogenic factors in tumor tissue and hence facilitated the tumor growth.

Overall our studies demonstrated that HOXB9, a gene which is critical in hormone regulated organogenesis and development, is overexpressed in breast cancer. HOXB9 potentially influence tumor growth and 3D colony formation via modulating the expression of tumor growth and angiogenic proteins. Notably, we observed that HOXB9 is overexpressed in breast cancer tissue, our biochemical studies demonstrated that HOXB9 controls the tumor growth and induced 3D colony formation in HEK293 cell which is originated from embryonic kidney cells. These results indicate that HOXB9 may be associated with tumorigenesis in kidney. In summary, our studies revealed novel function of HOXB9 and its homeodomain in breast cancer and potential roles in tumorigenesis.

Materials and Methods

Cell culture and establishment of HOXB9 stable cell lines

SW480 (human colorectal adenocarcinoma), HEPG2 (hepatocellular carcinoma), HeLa (human cervical cancer), H358 (bronchioalveolar carcinoma), JAR (Human choriocarcinoma placenta), MCF7 (human adenocarcinoma mammary), MDA-MB231 (ER-negative human adenocarcinoma mammary), and HEK293 (human embryonic kidney) cells were grown and maintained in DMEM containing 10% FBS, 2 mM L-glutamine and 1% Penicillin/Streptomycin (100 unit and 0.1 mg/mL respectively) in presence of 5% CO2 at 37°C.

Human full-length HOXB9 and homeodomain deleted HOXB9 genes were cloned in human expression construct pFlag-CMV4 and were used for making respective stable transfected cell lines using G418 antibiotic selection procedure [29]. The Flag-tagged HOXB9 (Flag-HOXB9) and Flag-tagged homeodomain deleted HOXB9 (Flag-HOXB9-ΔHD) constructs were transfected into HEK293 cells using Lipofectamine-2000 (Invitrogen) transfection reagent following manufacturer’s instruction. In brief, 5 μg of the Flag-tagged constructs were incubated with 8 μL of lipofectamine transfection reagent for 30 min in 500 μL DMEM at room temperature and the mixture was added to HEK293 cells (at 80% confluency). After 30 h, cells were washed with PBS, trypsinized and replated in medium supplemented with 500 μg/mL of G418 disulfate (Sigma). The individual colonies expressing Flag-HOXB9 and Flag-HOXB9-ΔHD were isolated and maintained in G418 containing media.

Antisense-mediated knockdown of HOXB9

Cells were grown up to 60 % confluency and transfected with varying concentrations (0.75 to 2.25 μg/mL) of HOXB9 or scramble antisense oligonucleotides (IDT-DNA) with iFECT transfection reagent (KD Medical Inc.). In brief, antisense oligonucleotides along with the transfection reagent were mixed in 300 μL of blank DMEM and incubated for a period of 45 minutes at room temperature before applying directly into 60 mm plates containing cells in 1.7 mL of serum-free DMEM. After 24 h of antisense application, the cells were treated with 2 mL of media containing all the supplements and an additional 20 % FBS. Cells were harvested after 72 h for RNA/protein extraction or fixed in 4% formaldehyde for ChIP assay.

RNA extraction, reverse transcription and real-time PCR

For RNA extraction, the cells were harvested by centrifugation at 500 g and resuspended in buffer A (20 mM tris.HCl pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT and 0.2 mM PMSF) and incubated for 10 min on ice. The cells were centrifuged at 3500 g for 5 min and the supernatant was subjected to phenol-chloroform and then chloroform extraction and ethanol precipitation of RNA. For cDNA synthesis, 500 ng of RNA was mixed with 2.5 μM of oligo-dT (Promega) and incubated at 70°C for 10 min. A reaction cocktail containing 2.5 unit MMLV Reverse Transcriptase (Promega), 1X first strand buffer (Promega), 100 μM of dNTPs (Invitrogen), 1 mM DTT and 20 units of RNaseOut (Invitrogen) was added to the RNA and incubated for 1 h at 37°C. The resulting cDNA was subjected to PCR-amplification using specific primers (Table 1). For real-time PCR analysis, the cDNA was amplified using SsoFast Eva Green super mix (Bio-Rad) using CFX96 real-time PCR detection system. The real-time PCR results were analyzed using the CFX Manager software. The experiments were repeated at least twice with three replicates each time.

Table 1.

Sequence of primers used for PCR and cloning and antisenses

Gene Forward primer (5◻-3◻) Reverse primer (5◻-3◻)
ORF Primers
GAPDH CAATGACCCCTTCATTGACC GACAAGCTTCCCGTTCTCAG
HOXB9 CTACGGTCCCTGGTGAGGTA TAATCAAAGACCCGGCTACG
VEGF TCCACCATGCCAAGTGGTCCC TGGATGGCAGTAGCTGCGCT
bFGF TTCTTCCTGCGCATCCAC CGGTTAGCACACACTCCTTTGAT
NRG2 AACCGCAGCCGAGACATT TGCTCACGCTGTTGACGTAA
TGFβ1 TCTCGGAAGAGAAAGGGCCCTGTT GGACATTTCTCACAGTGTGGCCCA
Promoter Primers
bFGF ATCTGGAGTTAAAGCCTTCTTGG TAATGTTGAGTGTGTGGGAGATG
VEGF TCCGGGTTTTATCCCTCTTC TCTGCTGGTTTCCAAAATCC
TGFβ1 GGAAAGGGTGGGAGTCCAA TTGCTCCAAACGCCAACC
Cloning Primers
HOXB9-Flag-CMV4 AAGCTTTCCATTTCTGGGACGCTTAGCAGa GGATCCTTACTCTTTGCCCTGCTCCTTATTCa
Antisense
HOXB9 CCTCTCTTTGTCCTCGCTTCCb
Scramble CGTTTGTCCCTCCAGCATCTb
Open in a new tab
a

Flanked by appropriate restriction sites

b

Phosphorothioate antisense oligonucleotide.

Protein extraction and Western blotting

Cells were harvested by centrifugation at 500g, resuspended in whole cell extract buffer containing 50 mM tris-HCl pH 8.0, 150 mM NaCl, 5 mM EDTA, 0.05 % NP-40, 0.2 mM PMSF and 1× protease inhibitors (1 mg/mL) and incubated for 20 min on ice and then centrifuged for whole cell protein extraction. For extraction of cytoplasmic and nuclear protein, cells were resuspended and lyzed in buffer A for 10 min on ice, centrifuged at 3500 g for 5 min. The supernatant was considered as cytoplasmic extract. The nuclear pellet was resuspended in buffer C (20 mM tris-HCl pH 7.9, 1.5 mM MgCl2, 0.42 M NaCl, 0.5 mM DTT, 0.2 mM PMSF and 0.2 mM EDTA) for 20 min on ice, centrifuged at 13000g for 20 min. The supernatant containing the nuclear protein was separated. Whole cell protein extract, cytoplasmic extract and nuclear extracts were analyzed by Western blotting using alkaline phosphatase method.

Chromatin Immunoprecipitation (ChIP) assays

ChIP assays were performed on HEK293, HOXB9 and HOXB9-ΔHD stable cell lines using EZ Chip chromatin immunoprecipitation kit (Upstate) [26]. For ChIP assay, cells were fixed in 4% formaldehyde, lysed and sonicated to shear the chromatin to ~ 150-450 bp in length. The sonicated chromatin was pre-cleaned using protein G agarose (Millipore) beads and subjected to immunoprecipitation using antibodies specific to Flag (Sigma), H3K4-trimethyl (Upstate), RNA polymerase II (Abcam), HOXB9 (Santa Cruz) and actin (Sigma). The immune-precipitated chromatin was reverse-cross-linked and ChIP DNA was PCR-amplified using promoter specific primers (Table 1).

Immunohistological analysis of breast cancer tissue microarray

The breast cancer tissue microarray slide containing 6 different cases (duplicates of each) of breast cancer and their corresponding adjacent normal tissues were purchased from US Biomax Inc and subjected to immunohistological staining [15]. Briefly, the paraffin embedded tissue microarray slide was immersed twice in xylene (10 min) and then sequentially immerged in 100%, 95% and 70% ethanol (5 min each) to deparaffinize the tissue. Antigen retrieval was done by incubating the slide in 0.1M sodium citrate buffer at 95 °C for 15 min following supplier’s instruction. For immunohistological staining, the tissue microarray slide was then incubated with 3% H2O2 for 15 min, washed with PBS thrice, and blocked with blocking buffer containing donkey serum. The slide was then incubated with HOXB9 antibody overnight, washed thrice in PBS, and then incubated with biotinylated donkey secondary antibody for 1.5 h. The slide was washed thrice with PBS, incubated with avidin–biotin complexes for 1.5 h, washed twice with PBS and then twice with 0.1 M tris-HCl (pH 7.4). Slide was incubated with a DAB substrate (kit, Vector Laboratories) for peroxidase labeling. The tissue microarray slide was dehydrated by sequential immersion in 70 %, 95 %, and 100 % ethanol and then cleaned by sequentially incubation in CitriSolv clearing agent. Tissue sections were finally mounted with DPX mounting solution, photographed, and examined under microscope (Nikon Eclipse TE2000-U, Japan).

Immunofluorescence microscopy

HEK293, Flag-HOXB9 and Flag-HOXB9-ΔHD stable cell lines were grown overnight on cover slips, fixed in 4% formaldehyde for 20 min, washed with PBS and permeabilized with 0.2% Triton X-100 for 15 min. Cells were washed with PBS, blocked with 30 μL of goat serum for 1 h and immunostained with the primary antibodies specific to FLAG and RNAPII (Abcam) for 2 h. Cells were washed twice with PBS for 5 min each, incubated with fluorescein isothiocyanate (FITC) or rhodamine (Jackson Immuno Research Laboratories) conjugated secondary antibodies in goat serum for 1 h, washed thrice with PBS, stained with DAPI for nuclear staining and visualized under a fluorescence microscope.

Colony formation assay

Colony forming ability of Flag-HOXB9 and Flag-HOXB9-ΔHD stably expressing cells were assessed using soft agar method [28]. In brief, 1.2 % agar was made in PBS, autoclaved, cooled down (to approximately 40°C) and added to an equal volume of 2× DMEM with 20 % FBS, 4 mM L-glutamine and 2% Penicillin/Streptomycin (100 unit and 0.1 mg/mL respectively) and the mixture was plated on 60 mm culture plate. The plates were allowed to cool down to solidify the base agar layer. Approximately 10,000 HEK293, Flag-HOXB9 and Flag-HOXB9-ΔHD cells were added to a mixture of 1.75 mL 2× DMEM and 1.75 ml of 1.2 % agar at room temperature and then plated on top of the base agar layer. The dishes were then kept in room temperature for 45 min to allow the top agar to solidify and then kept in cell culture incubator under normal growth conditions. The cells were fed with 0.5 mL of normal growth media at 2 days interval for 21 days. Prior to counting the colonies, the media was removed from the plates and the plates were rinsed with PBS. The plates were then stained with 0.005 % crystal violet for 2 h and then washed with PBS and then the colonies were examined under light microscope.

Acknowledgement

We thank all the Mandal lab members for helpful discussions. Research in Mandal laboratory is supported in parts by grants from National Institute of Health (1R15 ES019129-01, 2R15 CA113747-02) and National Science Foundation (1148541).

List of abbreviations

HOX genes

(Homeobox containing genes)

HOXB9-ΔHD

(HOXB9-homeodomain deleted)

HEK293

(Human embryonic kidney)

ChIP

(Chromatin immunoprecipitation)

VEGF

(vascular endothelial growth factor)

bFGF

(basic fibroblast growth factor)

TGFβ1

(transforming growth factor)

NRG2

(neuregulin-2)

References

  • 1.Zakany J, Duboule D. The role of Hox genes during vertebrate limb development. Curr Opin Genet Dev. 2007;17:359–66. doi: 10.1016/j.gde.2007.05.011. [DOI] [PubMed] [Google Scholar]
  • 2.Lappin TR, Grier DG, Thompson A, Halliday HL. HOX genes: seductive science, mysterious mechanisms. Ulster Med J. 2006;75:23–31. [PMC free article] [PubMed] [Google Scholar]
  • 3.Grier DG, Thompson A, Kwasniewska A, McGonigle GJ, Halliday HL, Lappin TR. The pathophysiology of HOX genes and their role in cancer. J Pathol. 2005;205:154–71. doi: 10.1002/path.1710. [DOI] [PubMed] [Google Scholar]
  • 4.Alexander T, Nolte C, Krumlauf R. Hox genes and segmentation of the hindbrain and axial skeleton. Annu Rev Cell Dev Biol. 2009;25:431–56. doi: 10.1146/annurev.cellbio.042308.113423. [DOI] [PubMed] [Google Scholar]
  • 5.Hejnol A, Martindale MQ. Coordinated spatial and temporal expression of Hox genes during embryogenesis in the acoel Convolutriloba longifissura. BMC Biol. 2009;7:65. doi: 10.1186/1741-7007-7-65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Krumlauf R. Hox genes in vertebrate development. Cell. 1994;78:191–201. doi: 10.1016/0092-8674(94)90290-9. [DOI] [PubMed] [Google Scholar]
  • 7.Coulombe Y, Lemieux M, Moreau J, Aubin J, Joksimovic M, Berube-Simard FA, Tabaries S, Boucherat O, Guillou F, Larochelle C, Tuggle CK, Jeannotte L. Multiple promoters and alternative splicing: Hoxa5 transcriptional complexity in the mouse embryo. PLoS One. 5:e10600. doi: 10.1371/journal.pone.0010600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chen H, Sukumar S. Role of homeobox genes in normal mammary gland development and breast tumorigenesis. J Mammary Gland Biol Neoplasia. 2003;8:159–75. doi: 10.1023/a:1025996707117. [DOI] [PubMed] [Google Scholar]
  • 9.Rubin MR, King W, Toth LE, Sawczuk IS, Levine MS, D’Eustachio P, Nguyen-Huu MC. Murine Hox-1.7 homeo-box gene: cloning, chromosomal location, and expression. Mol Cell Biol. 1987;7:3836–41. doi: 10.1128/mcb.7.10.3836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Shen WF, Chang CP, Rozenfeld S, Sauvageau G, Humphries RK, Lu M, Lawrence HJ, Cleary ML, Largman C. Hox homeodomain proteins exhibit selective complex stabilities with Pbx and DNA. Nucleic Acids Res. 1996;24:898–906. doi: 10.1093/nar/24.5.898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chen CY, Schwartz RJ. Identification of novel DNA binding targets and regulatory domains of a murine tinman homeodomain factor, nkx-2.5. J Biol Chem. 1995;270:15628–33. doi: 10.1074/jbc.270.26.15628. [DOI] [PubMed] [Google Scholar]
  • 12.Knoepfler PS, Bergstrom DA, Uetsuki T, Dac-Korytko I, Sun YH, Wright WE, Tapscott SJ, Kamps MP. A conserved motif N-terminal to the DNA-binding domains of myogenic bHLH transcription factors mediates cooperative DNA binding with pbx-Meis1/Prep1. Nucleic Acids Res. 1999;27:3752–61. doi: 10.1093/nar/27.18.3752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Mann RS, Chan SK. Extra specificity from extradenticle: the partnership between HOX and PBX/EXD homeodomain proteins. Trends Genet. 1996;12:258–62. doi: 10.1016/0168-9525(96)10026-3. [DOI] [PubMed] [Google Scholar]
  • 14.Shen WF, Krishnan K, Lawrence HJ, Largman C. The HOX homeodomain proteins block CBP histone acetyltransferase activity. Mol Cell Biol. 2001;21:7509–22. doi: 10.1128/MCB.21.21.7509-7522.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ansari KI, Hussain I, Kasiri S, Mandal SS. HOXC10 is overexpressed in breast cancer and transcriptionally regulated by estrogen via involvement of histone methylases MLL3 and MLL4. J Mol Endocrinol. 2012;48:61–75. doi: 10.1530/JME-11-0078. [DOI] [PubMed] [Google Scholar]
  • 16.Chen H, Sukumar S. HOX genes: emerging stars in cancer. Cancer Biol Ther. 2003;2:524–5. doi: 10.4161/cbt.2.5.525. [DOI] [PubMed] [Google Scholar]
  • 17.Amalinei C. [Morphogenesis and differentiation of the female genital tract. Genetic determinism and epithelium-stromal interactions] Rev Med Chir Soc Med Nat Iasi. 2007;111:200–9. [PubMed] [Google Scholar]
  • 18.Winnik S, Klinkert M, Kurz H, Zoeller C, Heinke J, Wu Y, Bode C, Patterson C, Moser M. HoxB5 induces endothelial sprouting in vitro and modifies intussusceptive angiogenesis in vivo involving angiopoietin-2. Cardiovasc Res. 2009;83:558–65. doi: 10.1093/cvr/cvp133. [DOI] [PubMed] [Google Scholar]
  • 19.McGonigle GJ, Lappin TR, Thompson A. Grappling with the HOX network in hematopoiesis and leukemia. Front Biosci. 2008;13:4297–308. doi: 10.2741/3006. [DOI] [PubMed] [Google Scholar]
  • 20.Medina-Martinez O, Bradley A, Ramirez-Solis R. A large targeted deletion of Hoxb1-Hoxb9 produces a series of single-segment anterior homeotic transformations. Dev Biol. 2000;222:71–83. doi: 10.1006/dbio.2000.9683. [DOI] [PubMed] [Google Scholar]
  • 21.Chen F, Capecchi MR. Targeted mutations in hoxa-9 and hoxb-9 reveal synergistic interactions. Dev Biol. 1997;181:186–96. doi: 10.1006/dbio.1996.8440. [DOI] [PubMed] [Google Scholar]
  • 22.Chen F, Greer J, Capecchi MR. Analysis of Hoxa7/Hoxb7 mutants suggests periodicity in the generation of the different sets of vertebrae. Mech Dev. 1998;77:49–57. doi: 10.1016/s0925-4773(98)00126-9. [DOI] [PubMed] [Google Scholar]
  • 23.Pan L, Xie Y, Black TA, Jones CA, Pruitt SC, Gross KW. An Abd-B class HOX.PBX recognition sequence is required for expression from the mouse Ren-1c gene. J Biol Chem. 2001;276:32489–94. doi: 10.1074/jbc.M011541200. [DOI] [PubMed] [Google Scholar]
  • 24.Hayashida T, Takahashi F, Chiba N, Brachtel E, Takahashi M, Godin-Heymann N, Gross KW, Vivanco MM, Wijendran V, Shioda T, Sgroi D, Donahoe PK, Maheswaran S. HOXB9, a gene overexpressed in breast cancer, promotes tumorigenicity and lung metastasis. Proc Natl Acad Sci U S A. 2010;107:1100–5. doi: 10.1073/pnas.0912710107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Chiba N, Comaills V, Shiotani B, Takahashi F, Shimada T, Tajima K, Winokur D, Hayashida T, Willers H, Brachtel E, Vivanco MD, Haber DA, Zou L, Maheswaran S. Homeobox B9 induces epithelial-to-mesenchymal transition-associated radioresistance by accelerating DNA damage responses. Proc Natl Acad Sci U S A. 2011 doi: 10.1073/pnas.1018867108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ansari KI, Shrestha B, Hussain I, Kasiri S, Mandal SS. Histone Methylases MLL1 and MLL3 Coordinate with Estrogen Receptors in Estrogen-Mediated HOXB9 Expression. Biochemistry. 2011;50:3517–27. doi: 10.1021/bi102037t. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Dadiani M, Seger D, Kreizman T, Badikhi D, Margalit R, Eilam R, Degani H. Estrogen regulation of vascular endothelial growth factor in breast cancer in vitro and in vivo: the role of estrogen receptor alpha and c-Myc. Endocr Relat Cancer. 2009;16:819–34. doi: 10.1677/ERC-08-0249. [DOI] [PubMed] [Google Scholar]
  • 28.Zhang J, Park SI, Artime MC, Summy JM, Shah AN, Bomser JA, Dorfleutner A, Flynn DC, Gallick GE. AFAP-110 is overexpressed in prostate cancer and contributes to tumorigenic growth by regulating focal contacts. J Clin Invest. 2007;117:2962–73. doi: 10.1172/JCI30710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ansari KI, Mishra BP, Mandal SS. Human CpG binding protein interacts with MLL1, MLL2 and hSet1 and regulates Hox gene expression. Biochim Biophys Acta. 2008;1779:66–73. doi: 10.1016/j.bbagrm.2007.11.006. [DOI] [PubMed] [Google Scholar]
  • 30.Orphanides G, Reinberg D. A unified theory of gene expression. Cell. 2002;108:439–51. doi: 10.1016/s0092-8674(02)00655-4. [DOI] [PubMed] [Google Scholar]
  • 31.Dai J, Rabie AB. VEGF: an essential mediator of both angiogenesis and endochondral ossification. J Dent Res. 2007;86:937–50. doi: 10.1177/154405910708601006. [DOI] [PubMed] [Google Scholar]
  • 32.Advani SH. Targeting mTOR pathway: A new concept in cancer therapy. Indian J Med Paediatr Oncol. 31:132–6. doi: 10.4103/0971-5851.76197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ansari KI, Mandal SS. Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing. FEBS J. 2010;277:1790–1804. doi: 10.1111/j.1742-4658.2010.07606.x. [DOI] [PubMed] [Google Scholar]
  • 34.Bannister AJ, Schneider R, Kouzarides T. Histone methylation: dynamic or static? Cell. 2002;109:801–6. doi: 10.1016/s0092-8674(02)00798-5. [DOI] [PubMed] [Google Scholar]
  • 35.Ansari KI, Hussain I, Das HK, Mandal SS. Overexpression of human histone methylase MLL1 upon exposure to a food contaminant mycotoxin, deoxynivalenol. Febs J. 2009;276:3299–3307. doi: 10.1111/j.1742-4658.2009.07055.x. [DOI] [PubMed] [Google Scholar]
  • 36.Ansari KI, Hussain I, Shrestha B, Kasiri S, Mandal SS. HOXC6 Is transcriptionally regulated via coordination of MLL histone methylase and estrogen receptor in an estrogen environment. J Mol Biol. 2011;411:334–49. doi: 10.1016/j.jmb.2011.05.050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ansari KI, Kasiri S, Hussain I, Mandal SS. Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13. FEBS J. 2009;276:7400–11. doi: 10.1111/j.1742-4658.2009.07453.x. [DOI] [PubMed] [Google Scholar]
  • 38.Ansari KI, Mishra BP, Mandal SS. MLL histone methylases in gene expression, hormone signaling and cell cycle. Front Biosci. 2009;14:3483–95. doi: 10.2741/3466. [DOI] [PubMed] [Google Scholar]
  • 39.Flagiello D, Gibaud A, Dutrillaux B, Poupon MF, Malfoy B. Distinct patterns of all-trans retinoic acid dependent expression of HOXB and HOXC homeogenes in human embryonal and small-cell lung carcinoma cell lines. FEBS Lett. 1997;415:263–7. doi: 10.1016/s0014-5793(97)01118-6. [DOI] [PubMed] [Google Scholar]
  • 40.Lane DB, Rutherford TJ, Taylor HS. HOXA10 expression in endometrial adenocarcinoma. Tumour Biol. 2004;25:264–9. doi: 10.1159/000081390. [DOI] [PubMed] [Google Scholar]
  • 41.Chen F, Capecchi MR. Paralogous mouse Hox genes, Hoxa9, Hoxb9, and Hoxd9, function together to control development of the mammary gland in response to pregnancy. Proc Natl Acad Sci U S A. 1999;96:541–6. doi: 10.1073/pnas.96.2.541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Chiba N, Comaills V, Shiotani B, Takahashi F, Shimada T, Tajima K, Winokur D, Hayashida T, Willers H, Brachtel E, Vivanco MD, Haber DA, Zou L, Maheswaran S. Homeobox B9 induces epithelial-to-mesenchymal transition-associated radioresistance by accelerating DNA damage responses. Proc Natl Acad Sci U S A. 2011;109:2760–5. doi: 10.1073/pnas.1018867108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Favaro E, Lord S, Harris AL, Buffa FM. Gene expression and hypoxia in breast cancer. Genome Med. 2011;3:55. doi: 10.1186/gm271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Roskoski R., Jr. Vascular endothelial growth factor (VEGF) signaling in tumor progression. Crit Rev Oncol Hematol. 2007;62:179–213. doi: 10.1016/j.critrevonc.2007.01.006. [DOI] [PubMed] [Google Scholar]
  • 45.Wendt MK, Smith JA, Schiemann WP. Transforming growth factor-beta-induced epithelial-mesenchymal transition facilitates epidermal growth factor-dependent breast cancer progression. Oncogene. 29:6485–98. doi: 10.1038/onc.2010.377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Russell KS, Stern DF, Polverini PJ, Bender JR. Neuregulin activation of ErbB receptors in vascular endothelium leads to angiogenesis. Am J Physiol. 1999;277:H2205–11. doi: 10.1152/ajpheart.1999.277.6.H2205. [DOI] [PubMed] [Google Scholar]
  • 47.Hedhli N, Dobrucki LW, Kalinowski A, Zhuang ZW, Wu X, Russell RR, 3rd, Sinusas AJ, Russell KS. Endothelial-derived neuregulin is an important mediator of ischaemia-induced angiogenesis and arteriogenesis. Cardiovasc Res. 2011;93:516–24. doi: 10.1093/cvr/cvr352. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES