Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Oct 1.
Published in final edited form as: J Immunol. 2012 Sep 5;189(7):3724–3733. doi: 10.4049/jimmunol.1201313

Murine immunodeficiency virus-induced peripheral neuropathy and the associated cytokine responses1

Ling Cao *,2, M Brady Butler *, Leonard Tan *, Kyle S Draleau *, Woon Yuen Koh †
PMCID: PMC3448875  NIHMSID: NIHMS397167  PMID: 22956581

Abstract

Distal symmetrical polyneuropathy (DSP) is the most common form of HIV infection-associated peripheral neuropathy and is often associated with pain. C57BL/6 (B6) mice infected with LPBM5, a murine retroviral isolate, develop a severe acquired immunodeficiency syndrome similar to that developed by humans infected with HIV-1, hence the term murine AIDS (MAIDS). We investigated the induction of peripheral neuropathy post-LP-BM5 infection in B6 mice. Infected B6 mice, like HIV-infected humans, exhibited behavioral (increased sensitivity to mechanical and heat stimuli) and pathological (transient loss of intraepidermal nerve fibers) signs of peripheral neuropathy. The levels of viral gag RNA were significantly increased in all tissues tested, including spleen, paw skin, lumbar dorsal root ganglia (DRG), and lumbar spinal cord, post-infection (p.i.). Correlated with the development of peripheral neuropathy, the tissue levels of several cytokines, including IFNγ, IL-1β, IL-6, and IL-12, were significantly elevated p.i.. These increases had cytokine-specific and tissue-specific profiles and kinetics. Further, treatment with the anti-retroviral agent zidovudine (AZT) either significantly reduced or completely reversed the aforementioned behavioral, pathological, and cytokines changes p.i.. These data suggest that LP-BM5 infection is a potential mouse model of HIV-associated DSP that can be used for the investigation of the roles of various cytokines in infection-induced neuropathic pain. Further investigation of this model could give a better understanding of, and lead to more effective treatments for, HIV infection-associated painful peripheral neuropathy.

Introduction

HIV infection is now considered to be a chronic disease due to more effective viral suppressive treatments significantly prolonging survival after infection. As such, greater attention is now being focused on the treatment of the numerous HIV infection-related complications, including neurological disorders, opportunistic infections, and tumors.

HIV-associated peripheral neuropathies are the most common neurological disorders associated with HIV infection. The most common forms of HIV-associated peripheral neuropathies that have been characterized include antiretroviral agent-induced toxic neuropathy and infection-induced distal symmetrical polyneuropathy (DSP) (1, 2). HIV DSP occurs in about one third of HIV/AIDS patients (3, 4). Patients with DSP present with symptoms typical of neuropathic pain, pain caused by a lesion or disease of the somatosensory system (5), including both spontaneous and evoked pain. In general, the symptoms of DSP are more pronounced in the distal lower extremities and are symmetrically distributed, with the upper extremities being affected later in the course of DSP (1, 2). Neuropathological changes have been correlated with the clinical course and described to progress in a “dying back” pattern as usually the distal regions of nerve fibers are first affected, and the changes eventually progressing proximally (2, 6). The major pathological changes associated with HIV DSP include reduced intraepidermal nerve fiber (IENF) density, damage to primary sensory fibers and neurons, and macrophage infiltration into peripheral nerves and the dorsal root ganglia (DRG). However, the underlying mechanism of the pathogenesis of HIV DSP is in large part unknown due at least in part to the lack of appropriate animal models. As such, HIV DSP is often under-diagnosed and/or under-treated and there are no FDA-approved pharmacological agents specifically designed for the treatment of HIV DSP.

Due to humans being the only natural hosts of HIV-1, there is a limited number of approaches available for the study of HIV DSP. LP-BM5, first isolated by Latarjet and Duplan in 1962 (7), is a retroviral mixture that contains mainly a pathogenic yet replication-defective virus (BM5def) and a non-pathogenic helper virus (ecotropic (mouse tropic) retrovirus (BM5eco)) (8). BM5eco is necessary for the replication and cell-to-cell spreading of BM5def. Despite certain differences between LP-BM5 and HIV-1, decades of research have established that LP-BM5 infection in susceptible C57BL/6 (B6) mice induces an HIV-like immunodeficiency syndrome, hence, the term murine AIDS (MAIDS). The characteristic responses following LP-BM5 infection in B6 mice (9) include splenomegaly, lymphadenopathy, polyclonal hypergammaglobulinemia, profoundly decreased T and B cell responses (particularly CD4+ T lymphocyte responses to mitogens), increased susceptibility to opportunistic pathogens, and the development of terminal B cell lymphomas. This model also mimics HIV-1 infection in humans in that LP-BM5 induces encephalopathy and cognitive deficits characterized by impairments in spatial learning and memory in B6 mice that appear to be associated with the progression of LP-BM5-induced MAIDS (10, 11) and neuronal degeneration (12). Further, various cytokines, including IFNγ, TNFα, IL-1β, IL-6, and IL-12, are known to be critical in the development of LP-BM5-induced immunodeficiency and CNS deficits (13–17). Treatment with the anti-retroviral agent zidovudine (AZT) significantly inhibits LP-BM5-induced immunodeficiency and CNS deficits (10, 18, 19). The MAIDS system may presently represent the best small animal model for retrovirus-induced immunodeficiency and provides a valuable tool in studying certain aspects of HIV-1 infection and anti-retroviral drug development (20).

In this current study, we, for the first time, explored the potential of using LP-BM5 infection as a rodent model of HIV DSP. We found that B6 mice infected with LP-BM5 displayed both behavioral and pathological signs of peripheral neuropathy and tissue-specific cytokine responses were observed. Most of these LP-BM5-induced changes including the changes in mechanical sensitivities, density of IENFs, and the expression of selected cytokines, could be reversed by AZT treatment. We believe that this model will help to further elucidate the underlying mechanisms of HIV DSP and could be used to delineate and test candidate therapeutic drugs for HIV DSP in the future.

Materials and Methods

Mice

Male adult B6 mice were purchased from the National Cancer Institute (Frederick, MD) and were allowed to habituate to the institutional animal facility for at least one week before experimental use (8–9 wks old). All mice were group-housed (four per cage) with food and water ad libitum and maintained on a 12-h light/dark cycle. For selected experiments, the anti-retroviral drug AZT (Sigma, St Louis, MO) was added to the drinking water (at 0.2 mg/ml) from the day of infection to week 12 post-infection (p.i.). This dose was chosen based on previous studies regarding MAIDS-induced neurological deficits (10). AZT-containing water was replaced weekly during regular cage changes. All water bottles that contained AZT were covered with foil to avoid direct light exposure. The mice treated with AZT water did not show any signs of dehydration, atypical growth, or abnormal behavior. In addition, it is known that AZT alone does not cause peripheral neuropathy in patients or neurotoxicity in vitro (21–23). The Institutional Animal Care and Use Committee (IACUC) at UNE approved all experimental procedures used in this study.

LP-BM5 virus preparation and inoculation

The initial complete LP-BM5 isolate was provided by Dr. William Green in Geisel School of Medicine at Dartmouth. The LP-BM5 viral isolates used in our experiments were prepared in either Dr. Green's laboratory or our laboratory as previously described (24, 25). The titer of the viral stock was determined by a standard retroviral XC plaque assay for BM5eco virus (26). Mice were infected (i.p.) with approximately 5 × 104 ecotropic PFU per mouse, a dose of LPBM5 that has been shown to induce typical MAIDS (27).

Mechanical sensitivity

Mechanical sensitivities of the hind paws of the mice were assessed under non-restrained conditions as previously described (28). During the test, each animal was subjected to stimulation from a series of von Frey filaments ranging from 0.008 g to 2 g (Stoelting, Wood Dale, IL) following the Up-Down paradigm (detailed in (29)). The 50% threshold force needed for paw withdrawal was calculated and used to represent mechanical sensitivity. For each experiment, testing of both hind paws was performed before (baseline) and weekly after infection up to 12 weeks p.i.. The person performing the behavioral tests was blinded to the experimental groups. Based on our previous experience, a minimum of six animals per group are needed for the mechanical sensitivity test to obtain statistical significance. Thus, a total of 12 animals were used in each group in the initial experiment that tested the effects of LP-BM5 (Figure 1A) and seven animals were used in each group to test the effect of AZT treatment (Figure 6A).

Figure 1. LP-BM5-induced behavioral hypersensitivity along with MAIDS-associated features in B6 mice.

Figure 1

Open in a new tab

Adult B6 mice were randomly assigned to LP-BM5 infection and no-infection groups. Separate animals were used for the assessment of the hind paw mechanical sensitivity (A, n = 12), hind paw heat sensitivity (B, n = 20), and MAIDS-associated features (splenomegaly (C), hyper serum IgM (D), and hyper serum IgG2a (E); n = 16–19 for C–E) in time course studies. In A and B, no differences between the left and right sides were detected in both behavioral tests, thus two-way RM ANOVA was performed for each data set with “infection” and “time” as factors (regardless of “side”). *indicates p < 0.05 between the infected group and the non-infected group at the indicated time (regardless of “side”). #iindicates p < 0.05 between the indicated infected group and the corresponding “no infection wk 0” group (regardless of “side”); and #nindicates p < 0.05 between the indicated non-infected group and the corresponding “no infection wk 0” group (regardless of “side”). In C–E, two-way ANOVA was performed for each data set with “infection” and “time” as factors. *indicates p < 0.05 between the infected group and the non-infected group at the indicated time. #indicates p < 0.05 between the indicated infected group and the “no infection wk 0” group. In D and E, the “no infection wk 0” group = 100%.

Figure 6. Effects of AZT on LP-BM5-induced responses in B6 mice.

Figure 6

Open in a new tab

Adult B6 mice were randomly assigned to four treatment groups: no treatment, AZT, LP-BM5 infection, and LP-BM5 + AZT. AZT was administered via the drinking water (0.2 mg/ml) for 12 weeks beginning at the day of infection. Hind paw mechanical sensitivity (A, n = 7) was tested weekly from week 0 before infection to week 12 p.i. (The average responses from the left and the right paws are shown). Two-way RM ANOVA was performed with “infection” and “time” as factors. At each indicated time, *indicates p < 0.05 between the indicated group and all other groups, #indicates p < 0.05 between the indicated group and the corresponding “no infection wk 0” group. aindicates p < 0.05 between the indicated group and both the “no treatment” and “AZT” groups at the indicated time. bindicates p < 0.05 between the indicated group and both the “no treatment” and “LP-BM5” groups at the indicated time. Upon sacrifice at 12 weeks p.i., the development of MAIDS-associated features (B–D), changes in viral gag expression (E–H; similar results were obtained from BM5def gag and BM5eco gag measurement, thus only the BM5def gag data are shown here), and cytokine responses (I–K) were also determined. In B–K, all data are presented as mean ± SEM (n = 7). One-way ANOVA was performed for each data set with “treatment” as main factor. *indicates p < 0.05 between the indicated group and all other groups. Note that the result of the statistical analysis for DRG IFNγ is described in the figure K. In C and D, the “no treatment” group = 100%. In E–H, “ND” = not detectable.

Hargreaves test

Heat sensitivities were assayed under non-restrained conditions with the Ugo Basile thermal plantar analgesia instrument for mice (Ugo Basile Srl, Comerio VA, Italy). Each mouse was placed in a plastic chamber (~3”x3”x8”) upon an elevated glass surface at room temperature. A movable infrared heat source beneath the glass floor was focused on the plantar surface of the hind paw. The heat stimulus and an automatic timer were activated simultaneously by a hand-operated switch. In this paradigm, upon sensing discomfort, a mouse lifts its paw, turning off the stimulus and timer. The intensity of the light stimulus was set for a baseline latency of approximately 15–20 sec. In the absence of a response within a predetermined maximum latency (30 sec), the test was terminated to prevent tissue damage. The person performing the behavioral tests was blinded to the experimental groups. Based on our previous experience, a minimum of 10 animals per group are needed for the heat sensitivity test to obtain statistical significance. Thus, a total of 20 animals were used in each group in the experiment that tested the effects of LP-BM5 (Figure 1B)

For both of these sensitivity tests, the hind paw was chosen because the symptoms of HIV DSP usually start from the lower limbs in humans (1, 2). Separate animals were used in each of the sensory test to avoid interference between the tests.

Measurement of the development of MAIDS disease

Spleen weight and serum Ig levels were measured to monitor the development of MAIDS disease as described previously (27). Mice were euthanized through CO2 inhalation. Blood from each mouse was collected via cardiac puncture. Sera were obtained following centrifugation and stored at −20°C until analysis. Serum IgM and IgG2a were measured via an established ELISA protocol (27). The spleen of each animal was collected following blood collection, and the total weight of each spleen was measured before storing the tissue at −80°C for further analysis. Based on experiences in Dr. William Green's laboratory, a minimum of four animals per group are needed for the statistical analyses of these MAIDS disease-related parameters to reach statistical significance. We collected all available samples from our studies to determine the changes in these parameters. Thus, there are 16–19 mice per group in Figure 1C–E and seven mice per group in Figure 6B–D.

RNA isolation and real-time quantitative RT-PCR (qRT-PCR) for viral load

Spleens, lumbar (L4-L6) DRG, and lumbar spinal cord tissue were collected upon sacrificing each animal and stored at −80°C until viral load determination. The viral load in the tissue was determined by evaluating the expression of both BM5def and BM5eco gag RNAs via qRT-PCR as previously described (30, 31). Briefly, total RNA was isolated from the selected tissue via RNeasy lipid tissue kit (Qiagen, Valencia, CA). cDNA was synthesized with the iScript cDNA Synthesis kit (Bio-Rad, Hercules, CA) from 1 μg of total RNA, and qRT-PCR was performed by amplifying the cDNA (0.5 μl) with the SYBR Green Supermix (Bio-Rad) on an iCycler with iCycler iQ software (Bio-Rad). Mousẹ β-actin RNA expression was measured in parallel. As previously described (30), the relative expression levels of the BM5def gag and BM5eco gag genes were calculated via the ΔΔCt method using β-actin expression as the control. Based on our preliminary experiment, the expression of β-actin did not change with LP-BM5 infection or AZT treatment. Further, it was determined that a minimum of four animals per group from each type of tissue were needed for the statistical analyses of tissue levels of viral RNA to reach statistical significance. We collected all available samples from our studies to determine the changes of viral RNA levels. In Figure 3, the number of samples used to analyze the changes in viral load in splenic, hind paw skin, lumbar DRG, and lumbar spinal cord tissue were n = 16–18, n = 4–8, n = 8, and n = 7–8, respectively. Seven animals per group were used to test the effects of AZT on viral loads (Figure 6E–H).

Figure 3. Viral loads in various tissues post-LP-BM5 infection in B6 mice.

Figure 3

Open in a new tab

Adult B6 mice were randomly assigned to LP-BM5 infection and no-infection groups. Viral loads in spleens (A and B, n = 16–18), hind paw skin (C and D, n= 4–8, pooled samples from the left and right paws), lumbar DRG (E and F, n = 8, pooled samples from left and right L4–L6 DRG), and lumbar spinal cords (G and H, n = 7–8) were determined by measuring BM5def gag RNA (A, C, E and G) and BM5eco gag RNA levels (B, D, F and H) via qRT-PCR in time course studies. Viral gag RNA levels are presented as their relative expression to β-actin control. Two-way ANOVA was performed for each data set with “infection” and “time” as factors. *indicates p < 0.05 between the infected group and the non-infected group at the indicated time. #indicates p < 0.05 between the indicated group and the “no infection wk 0” group.

Intraepidermal nerve fiber (IENF) density

At indicated times (see Results), selected groups of mice were euthanized by inhalation of CO2,and hind paw plantar foot pads were harvested for the evaluation of IENF density according to a previously published method (32). Briefly, foot pad tissues were fixed in 4% formaldehyde fixative for 24 h, cryoprotected with 30% sucrose, and then sectioned into 15-μm sections. At least three sections were collected for analysis from each foot pad. Fluorescent immunohistochemistry for specific markers was conducted following our published procedure (33). Sample sections were stained with either a rabbit Ab against the pan-axonal marker protein gene product (PGP) 9.5 (1:500) (AbD Serotec, Raleigh, NC), a rabbit Ab against calcitonin gene-related peptide CGRP (1:5000) (Sigma), or a mouse Ab against growth associated protein (GAP) 43 (1:1000) (a gift from Dr. Frank Rice at the Albany Medical College), followed by a fluorescence-labeled secondary Ab (goat anti-rabbit-Cy3 for PGP9.5 and CGRP (1:800 for both) (Jackson ImmunoResearch Laboratories, West Grove, PA), and goat anti-mouse-FITC for GAP43 (1:250) (Invitrogen/Life Technology, Grand Island, NY)). The numbers of positively stained IENFs were counted in each section in a blinded manner, and the density of IENFs per mm of skin was determined based on the total numbers of positively stained IENFs and the length of the corresponding skin tissue. The final IENF density for each foot pad tissue was obtained by calculating the average IENF density of the sections obtained from a foot pad. Based on our preliminary experiment, a minimum of four animals per group were needed for the statistical analysis of IENF density to reach significance. Thus, 4–7 animals per group were used in the initial experiment for testing the effects of LP-BM5 (Figure 2C and D) and four animals per group were used to test the effects of AZT treatment (Figure 7A and B).

Figure 2. LP-BM5-induced reduction of hind paw skin intraepidermal nerve fibers (IENFs) in B6 mice.

Figure 2

Open in a new tab

Adult B6 mice were randomly assigned to LP-BM5 infection and no-infection groups. The density of total (PGP9.5+) and CGRP+ IENFs in the hind paw skin were examined via immunohistochemistry and presented as the number of each type of nerve fiber per 1 mm length of skin tissue. Representative PGP9.5 (A, 20×) and CGRP (B, 20×) images are shown (Scale bar = 50 μm). All images shown were taken at 2 weeks p.i. and from animals' left paws. Arrows indicate examples of positively stained nerve fibers. Corresponding quantitative data are shown in C (PGP 9.5) and D (CGRP) (n = 4–7 for both C and D). Since no differences between the left and right sides were detected in either C or D, two-way ANOVA was performed for each data set with “infection” and “time” as factors (regardless of “side”). *indicates p < 0.05 between the infected group and non-infected group at the indicated time (regardless of “side”). #indicates p < 0.05 between the indicated group and the “no infection wk 0” group (regardless of “side”).

Figure 7. Effects of AZT on LP-BM5-induced changes in PGP9.5+ and CGRP+ IENF density in B6 mice.

Figure 7

Open in a new tab

Adult B6 mice were randomly assigned to four treatment groups: no treatment, AZT, LP-BM5 infection, and LP-BM5 + AZT (n = 4 for each group). AZT was administered via the drinking water (0.2 mg/ml) beginning at the day of infection. All mice were sacrificed at 2 weeks p.i.. The density of total (PGP9.5+) and CGRP+ IENFs in the hind paw skin were examined via immunohistochemistry and presented as the number of each type of nerve fiber per 1 mm length of skin tissue (as described in Figure 2). Quantitative data are shown in A (PGP 9.5) and B (CGRP). Representative images from each treatment group are shown in C (PGP9.5, 20×) and D (CGRP, 20×) (Scale bar = 50 μm). All images shown are from animals' left paws. Since no differences between the left and right sides were detected in either A or B, one-way ANOVA was performed for each data set with “treatment” as main factor (regardless of “side”). *indicates p < 0.05 between the indicated treatment group (regardless of “side”) and all other treatment groups.

Cytokine qRT-PCR

mRNA levels of selected cytokines in the lumbar spinal cord and DRG were determined via qRT-PCR. cDNA samples obtained for the determination of viral loads (described above) were also used for cytokine qRT-PCR. qRT-PCR was performed with 0.5 μl of cDNA per sample and SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) on an iCycler with iCycler iQ software (Bio-Rad). Primers for mouse cytokine IL-1β, TNFα, IL-6, and IL-12p40, and β-actin were purchased from (OriGene, Rockville, MD) and the PCR protocols suggested by the manufacturer were used. For each of these cytokines, OriGene supplies the mixture of both the forward and reverse primers. Accession numbers for individual cytokines are as follows: NM_008361 (IL-1β) , NM_013693 (TNFα), NM_031168 (IL-6), and NM_008352 (IL-12p40), and NM_007393 (β-actin). Primers for mouse IFNγ were as follows: forward primer: GCCATCAGCAACAACATAAGC, reverse primer: CAGCAGCGACTCCTTTTCC (sequences were obtained from Dr. Paul Massa, SUNY Upstate Medical University). A published PCR protocol (34) was used for IFNγ PCR. The relative expression levels of all the cytokines measured were calculated using β-actin expression as the control via the ΔΔCt method. Based on our preliminary experiment, a minimum of six animals per group were needed for the statistical analysis of the levels of cytokine RNA to reach significance. Thus, the number of samples used during the initial experiment for testing the effects of LP-BM5 were n = 7–8 for lumbar spinal cord and n = 8 for lumbar DRG (Figure 4) and seven animals per group were used to test the effects of AZT treatment (Figure 6I–K).

Figure 4. LP-BM5-induced increase of cytokine expression in lumbar spinal cord and lumbar DRG in B6 mice.

Figure 4

Open in a new tab

Adult B6 mice were randomly assigned to LP-BM5 infection and no-infection groups. The mRNA expression of lumbar spinal cord IL-12p40 (A, LSC= lumbar spinal cord, n = 7–8), and lumbar DRG (pooled from the left and right L4–L6 DRG) IL-1β (B, n = 8), and IFNγ (C, n = 8) were measured via qRT-PCR using β-actin for normalization in time course studies. Two-way ANOVA was performed for each data set with “infection” and “time” as factors. *indicates p < 0.05 between the infected group and the non-infected group at the indicated time. #indicates p < 0.05 between the indicated group and the “no infection wk 0” group. aindicates 0.05 < p < 0.10 between the infected group and the non-infected group at the indicated time. bindicates 0.05 < p < 0.10 between the indicated group and the “no infection wk 0” group.

Cytokine multiplex assay

Hind paw skin tissue was quickly collected after sacrificing each animal and processed as described previously (33) for the determination of cytokine levels via FlowCytomix multiplex assay. Briefly, skin from the left and right hind paw of each animal was pooled and lysed in lysis buffer (PBS supplemented with 1 mM Na2EDTA, 1% BSA (Sigma), and protease inhibitor cocktail (Sigma)). The supernatants were collected after centrifugation (10,000 g at 4°C for 15 min) and stored at −80°C until analysis. The FlowCytomix multiplex assay was performed with the mouse FlowCytomix base kit and mouse FlowCytomix Simplex sets for IL-1β, IL-6, TNFα, IL-12 p70, and IFNγ (eBioscience, San Diego, CA) following the manufacturers' protocols with an Accuri C6 flow cytometer (Accuri Cytometers Inc., Ann Arbor MI). All cytokine levels were normalized based on the protein concentration of each sample, which was determined by the BCA protein assay (Pierce-Thermo Scientific, Rockford, IL). The following formula was utilized: normalized level of a particular cytokine within a particular sample (pg/mg protein) = cytokine concentration obtained from the multiplex assay (pg/ml) / protein concentration obtained from the BCA assay (mg/ml). Based on our preliminary experiment, a minimum of six animals per group were needed for the statistical analysis of protein levels of cytokines. Eight animals per group were used in the experiment for testing the effects of LP-BM5 (Figure 5).

Figure 5. LP-BM5-induced increases of cytokine levels in the hind paw skin of B6 mice.

Figure 5

Open in a new tab

Adult B6 mice were randomly assigned to LP-BM5 infection and no-infection groups. The protein levels of IL-6 (A), IFNγ (B), and IL-1β (C) were measured via FlowCytomix multiplex assay in time course studies (for each animal, hind paw skin tissue from the left and right sides were pooled together prior to the measurement; n = 8 for all). Two-way ANOVA was performed for each data set with “infection” and “time” as factors. *indicates p < 0.05 between the infected group and the non-infected group at the indicated time. #indicates p < 0.05 between the indicated group and the “no infection wk 0” group. $indicates p < 0.05 between the indicated infected group and the “no infection wk 0” group and all other infected groups.

Statistical analyses

All statistical analyses were performed with raw data using SigmaStat 3.5 software (Systat Software, Inc.). When different animals were measured at different time points, appropriate analyses of variance (ANOVA) (one-way or two way ANOVA; details in the figure legends) with treatment and/or time as factors were performed, followed by Student-Newman-Keuls (SNK) Post hoc analysis (all graphs except Figure 1A–B and 6A). When data regarding the left and right sides of the same animal were obtained, a paired t-test was used to determine the effects of “side” prior to the evaluation of the effects of the various treatments (Figure 2C–D and 7A–B). When the same animals were repeatedly measured for their responses on both the left and right sides at different time points, two-way RM ANOVA (use side and time as factors) was performed to determine the effects of “side” over “time” prior to the evaluation of the effects of the various treatments over time via two-way RM ANOVA (Figure 1A–B). In Figure 6A, since no differences in mechanical sensitivities were observed between the left and right hind paws in Figure 1A, average responses from the left and right paws were calculated and analyzed via twoway RM ANOVA to determine the effects of “treatment” over “time. All data are presented as mean ± SEM, and p < 0.05 was considered statistically significant.

Results

LP-BM5 infection-induced hind paw sensory hypersensitivity

To determine if LP-BM5 infection would induce behavioral signs of peripheral neuropathy in adult B6 mice chronically infected with LP-BM5, we examined the hind paw sensitivity to both mechanical and heat stimulation via the Up-down test (using von Frey filaments) and the Hargreaves test, respectively. To avoid interference between the two behavioral tests, separate groups of animals were used for the two tests. All animals were baseline tested before infection and weekly after infection for 12 weeks p.i.. Both the left and right hind paws were tested at each time point. No significant differences were found between the left and right hind paws in either of the sensory tests regardless of the infection (For mechanical sensitivity: p = 0.771, and for heat sensitivity: p = 0.591), whereas infected mice displayed mechanical and heat hypersensitivity compared to non-infected mice starting at week 6 and lasting to week 12 p.i. (For both sensory sensitivity tests: p < 0.001) (Figure 1). No significant hind limb paralysis or weakness was observed in any of the infected mice. We did notice an adaptation in the animal's response to heat stimulation over time. This can be seen more clearly in the non-infected group (Figure 1B).

The development of splenomegaly and hypergammaglobulinemia, hallmark manifestations of MAIDS, were examined in separate mice in parallel. Figure 1C–E summarizes the time course of the development of MAIDS. MAIDS disease can be readily detected as early as week 2 p.i. by any one of the parameters used, i.e., at any selected time point after infection, there were significant differences between the infected and non-infected groups in all the parameters examined (p < 0.001) (Figure 1C–E). In addition, the development of MAIDS was confirmed in the mice tested for the behavioral sensitivities at week 12 p.i. (data not shown). Thus, the LP-BM5-induced behavioral hypersensitivity manifests after the LP-BM5-induced immunodeficiency is well developed.

LP-BM5 infection-induced loss of peripheral nerve fibers

To evaluate the pathological changes after LP-BM5 infection, hind paw foot pad tissue from both infected and non-infected B6 mice was collected at various times p.i., and the IENF density was examined via immunohistochemistry. The density of the hind paw IENFs was determined with an Ab against a pan-axonal marker, PGP9.5, as previously described (32, 33) (Figure 2A and C). Although no side differences were found in any of the groups (p = 0.534), we did observe significant age-related effects in non-infected controls (p < 0.05). The number of PGP9.5+ IENFs was significantly reduced at 2 weeks post-infection (p < 0.001) and then gradually recovered to levels similar to that of non-infected age-matched controls (Figure 2A and C). The LP-BM5-induced reduction of PGP9.5+ IENFs at week 2 p.i. did not appear to be due to a loss of PGP9.5 expression because a similar reduction was observed when nerve fibers were identified by an Ab against GAP43 (data not shown), a neuronal membrane protein involved in axonal growth, regeneration, and remodulation that has been shown to be expressed by the majority of skin IENFs (35, 36). Further, it is known that skin IENFs consist of mainly sensory nerve fibers, including both peptidergic (CGRP+) and non-peptidergic (CGRP−) fibers. Thus, we examined the density of CGRP+ IENFs (Figure 2B and D). Similarly, no side difference was found in any of the groups (p = 0.058). LP-BM5-induced reductions in CGRP+ fibers were detected at weeks 2 (p < 0.001) and 4 p.i. (p < 0.05), although these reductions were not accompanied by significant age-related changes (Figure 2B and D).

Viral loads in various tissues post-LP-BM5 infection

To determine the viral loads in peripheral neuropathy-related tissues, BM5def and BM5eco gag (one of the viral genes that encodes the group-specific viral core proteins) RNA expression levels were measured in spinal cords, lumbar DRG, and the hind paw skin of infected B6 mice via qRT-PCR. Splenic mRNA levels were also measured for comparison purposes. In the spleen, lumbar spinal cord, and lumbar DRG, viral RNA levels, especially BM5def gag levels, showed significant increases 2 weeks p.i. and reached maximal levels 4 weeks p.i. (p < 0.001) (Figure 3A–B and E–H). Alternatively, in the paw skin, viral RNA levels started to increase 4 weeks p.i. and reached maximal levels at 6 weeks p.i. (p < 0.05) (Figure 3C–D). Further, no significant differences in viral RNA were detected between the different segments of the spinal cord (cervical, thoracic and lumbar), between the left and right hind paws, or between left and right lumbar DRG (data not shown). At any given time p.i., the levels of viral RNA were as follows: spleen > paw skin ≥ DRG > spinal cord. In all, these data indicate that local viral infection is established early during the development of peripheral neuropathy.

Changes of cytokine levels in various tissues post-LP-BM5 infection

Previous studies have indicated that several cytokines, IL-1β, IL-6, TNFα, IFNγ, and IL-12, were critical for the development of LP-BM5-induced immunodeficiency and/or CNS deficits (13–17). Thus, to assess the involvement of these cytokines in the development of peripheral neuropathy, the levels of these cytokines were determined over a time course in lumbar spinal cords and lumbar DRG by qRT-PCR and in the hind paw skin by FlowCytomix multiplex assay. Due to the lack of side differences and the limited amount of tissue that could be collected from each animal, the left and right DRG and the left and right paw skin were pooled before processing for cytokine measurement. In the lumbar spinal cord, the only infection-induced changes detected were IL-12p40 mRNA levels (p < 0.05), which trended upwards over time p.i. (Figure 4A). Interestingly, the mRNA levels of IL-6 and IFNγ significantly increased with time in both infected and non-infected mice (for both cytokines, p < 0.001; data not shown), whereas no significant changes in the mRNA levels of IL-1β and TNFα were observed (data not shown). In the DRG, the mRNA levels of both IL-1β and IFNγ started to increase as early as 2 weeks p.i. and remained elevated until 12 weeks p.i. (p < 0.001) (Figure 4B–C). However, no significant changes in the mRNA levels of IL-6, TNFα, and IL-12p40 p.i. were detected (data not shown). In the hind paw skin, TNFγ was not detectable at the protein level in most animals. No changes in the levels of IL-12p70 were detected. All other cytokines measured via FlowCytomix multiplex assay showed transient increases p.i.. Specifically, LP-BM5 induced a significant elevation of IL-6 at week 2 p.i. (p < 0.01) that was followed by a significant elevation of IFNγ at week 4 p.i. (p < 0.01). Meanwhile, IL-1β levels appeared to be elevated for a longer time period (from week 4 to week 10 p.i. (p < 0.01)) (Figure 5). These data indicate that tissue-specific cytokine responses are associated with LP-BM5 infection and provide temporal associations between the changes of selected cytokines and the development of peripheral neuropathy.

Effects of AZT treatment on LP-BM5-induced responses

It has been shown that the anti-retroviral agent AZT can significantly reverse LP-BM5-induced immunodeficiency and CNS deficits (10, 18, 37). To evaluate the effects of AZT on LP-BM5-induced peripheral neuropathy, AZT was administered via drinking water (0.2 mg/ml) from day 0 (day of infection) to week 12 p.i.. Mechanical sensitivity was determined prior to infection and weekly up to 12 weeks p.i.. AZT did not significantly affect the mechanical sensitivities of uninfected animals but significantly prevented LP-BM5-induced mechanical hypersensitivities (p < 0.001) (Figure 6A; since no differences in mechanical sensitivities were observed between the left and right hind paws, average responses from the left and right paws were calculated and presented). The features of MAIDS (as described in Figure 1; Figure 6B–D), the viral loads in various tissues (Figure 6E–H), and the expression of selected cytokines in the lumbar spinal cord and DRG (Figure 6I–K) were determined at 12 weeks p.i. upon the completion of behavioral testing. AZT treatment was able to significantly reduce LP-BM5-induced increases in spleen weight, serum IgM and IgG2a, and the viral load in all the tissues examined (for all parameters, p < 0.001) (Figure 6B–H). The same AZT treatment also completely reversed the LP-BM5-induced elevation of selected cytokines in the lumbar spinal cord and DRG (for all parameters, p < 0.05) (Figure 6I–K). In addition, AZT did not induce significant changes in all the parameters measured in uninfected animals (Figure 6A–K).

In a separate experiment, hind paw skin tissue was collected from AZT ± LP-BM5-treated mice 2 weeks p.i., and the density of PGP9.5+ and CGRP+ IENFs were determined as described in Figure 2. Similar to the previous results, no side differences were found in the numbers of both PGP9.5+ (p = 0.374) and CGRP+ IENFs (p = 0.089) (Figure 7A–B). AZT completely reversed the LP-BM5-induced reduction of the density of both PGP9.5+ (p < 0.01) and CGRP+ (p < 0.05) IENFs whereas AZT alone did not induce significant changes in IENF density (Figure 7). In all, these data indicate that AZT can prevent LP-BM5-induced peripheral neuropathy.

Discussion

Although it is the most common neurological disorder associated with HIV infection, HIV-associated peripheral neuropathy is still poorly understood. One notable reason for this is the lack of an appropriate model that can be used to investigate the underlying mechanisms of HIV-associated neuropathy. Many studies have been carried out in vitro by the co-culturing of DRG cells with either the intact virus or various viral components. Ultimately, the findings that result from such studies require further validation in an in vivo system. In vivo, feline immunodeficiency virus (FIV) and SIV have been used as model systems to study HIV-associated peripheral neuropathy (38–41). Although the SIV model is considered to be one of the most appropriate models for HIV infection in human, its usage is significantly hampered by cost and the lack of species-specific reagents. Rodent models of HIV DSP have been generated by either injecting HIV gp120 (either perineurally into the sciatic nerve or intrathecally) (42–45) or by the expression of HIV gp120 in the nervous system of mice (32). However, these rodent models are established without the natural progression of a systemic viral infection and strongly rely on the assumption that HIV gp120 is the major viral protein involved in HIV DSP. In our current study, we tested LP-BM5 infection as a potential model system for the study of HIV DSP. We demonstrated that besides developing an immunodeficiency syndrome, B6 mice infected with LP-BM5 also displayed both behavioral (sensory hypersensitivity) and pathological (decrease in IEFN density) changes similar to those found in HIV DSP. Many of these cytokines, such as IL-1β, IFNγ, and TNFα, are known to be associated with the development of HIV DSP (46–50). Our results indicate that these cytokines may also be involved in the development of LP-BM5-induced peripheral neuropathy. We believe that despite certain differences between LP-BM5 and HIV, this rodent LP-BM5 infection system, which is a small animal model in which the development of peripheral neuropathy is associated with natural infection-induced immunodeficiency, will complement the current in vitro and in vivo model systems and can be used to investigate certain types of HIV-associated peripheral neuropathy, including HIV DSP. Due to it being difficult, if not impossible, to obtain human samples from various tissues (including DRG and spinal cord) from patients at various disease stages (including prior treatment vs. on-going treatment), this model can be particularly useful in the investigation of cytokine network responses, the interactions between the peripheral and central nervous systems, the dynamic changes of the sensory pathway, and drug responses associated with HIV DSP. In fact, the LP-BM5 model was found to be the “most suitable for the rapid and cost effective initial screening of drugs, drug combinations” in a comprehensive review on commonly used in vivo HIV/AIDS models (20).

Changes in several cytokines, particularly proinflammatory cytokines, have been observed in patients with HIV-associated peripheral neuropathy (49, 50), and it has been suggested that proinflammatory cytokines are involved in the pathogenesis of HIV-associated peripheral neuropathy. The upregulation of selected cytokines has also been observed in animal models of HIV DSP (51). However, the specific roles of these cytokines in the development of HIV-associated peripheral neuropathy are still unclear and are often simply summarized as promoting neuroinflammation. In the current study, we observed tissue-specific changes in selected cytokines that occurred along with the development of LP-BM5-induced peripheral neuropathy (i.e., a gradual increase in IL-12p40 in the lumbar spinal cord, the persistent elevation of IL-1β and IFNγ in lumbar DRG, and the transient increase of IL-6, IFNγ, and IL-1β in the paw skin). Data suggest an association between infection-induced cytokine responses and the development of peripheral neuropathy. In particular, further investigation is necessary to delineate the role of specific cytokines in particular tissues/organs in the LP-BM5-induced behavioral and pathological changes. Further, other relevant cytokines/chemokines can also be investigated in the future. In addition, co-localization studies using immunohistological techniques will help to identify the source(s) of each cytokine involved and targeted treatment strategies could be developed accordingly in the future. Currently, although changes in certain cytokines have been identified in humans with sensory neuropathy (49, 50), the tissue-specific cytokine expression data from human patients are very limited and often affected by the anti-viral treatment. We believe that our investigation with LP-BM5 model will help to determine the role of individual cytokines and cytokine networks in the development of HIV-associated peripheral neuropathy.

Paradoxically, patients with HIV-associated peripheral neuropathy often present with enhanced neuroinflammation/immune activation and systemic immunodeficiency simultaneously. There is a clear association between the diagnosis of AIDS/low CD4 count and the development of HIV-associated peripheral neuropathy (3, 52, 53). Whether the development of peripheral neuropathy is directly dependent on viral-induced immunodeficiency has not been investigated in detail. Our results indicate that the development of behavioral hypersensitivity is closely associated with the development of MAIDS-related features, whereas the reduction of IENF density is transient and does not worsen with increased MAIDS severity. However, both of these peripheral neuropathy-related changes are dependent on LP-BM5 infection as AZT treatment effectively reduced the viral loads in all tissues examined and reversed these changes simultaneously. These data suggest that peripheral neuropathy-related features may be differentially dependent on the development of immunodeficiency. This may help to understand the differences in the various types of HIV-associated peripheral neuropathy (2). Further, in patients with HIV-associated peripheral neuropathy, IENF density was found to be inversely correlated with neuropathic pain, and this correlation seemed to be stable over time (i.e., the fiber density did not recover) (6), which is somewhat different from what we have observed in LP-BM5 infected mice. However, careful examination of the underlying mechanisms that lead to the recovery in IENF density in LP-BM5 infected mice may help in the development of novel treatments for HIV-associated peripheral neuropathy.

In this current study, we focused on the hind paw because the development of HIV-associated peripheral neuropathy often starts in the lower limbs in humans. However, we cannot exclude pathological changes in the fore paws of infected animals. To further evaluate this animal model, we have started to examine the behavioral and histological changes in the fore paws of LP-BM5 infected animal.

In summary, we believe that the LP-BM5 infection model can aid the investigation of HIV infection-associated peripheral neuropathy, particularly HIV DSP, and can be used in the evaluation of various drugs in the alleviation of this chronic neurological condition.

Acknowledgments

The authors would like to thank Dr. William Green and his laboratory from the Geisel School of Medicine at Dartmouth for their help with establishing LP-BM5 stocks in Dr. Cao's laboratory and technical assistance in viral RNA qRT-PCR and Ab ELISAs and Dr. Frank Rice (Albany Medical College) for providing the GAP43 Ab and helping with the examination of IENF density. We also appreciate the technical help with the Hargreaves test from Dr. Ed Bilsky's laboratory (University of New England) and the sequences for IFNγ qRT-PCR provided by Dr. Paul Massa (SUNY Upstate Medical University).

Abbreviations

B6

C57BL/6

DRG

dorsal root ganglia

DSP

Distal symmetrical polyneuropathy

FIV

Feline immunodeficiency virus

IENF

intraepidermal nerve fiber

p.i.

Post-infection

Footnotes

1This work was supported by National Institutes of Health (NIH) National Institute of Neurological Disorders and Stroke (NINDS) Exploratory/Developmental grant 5R21NS066130 (Cao)

References

  • 1.Cornblath DR, Hoke A. Recent advances in HIV neuropathy. Curr Opin Neurol. 2006;19:446–450. doi: 10.1097/01.wco.0000245366.59446.57. [DOI] [PubMed] [Google Scholar]
  • 2.Pardo CA, McArthur JC, Griffin JW. HIV neuropathy: insights in the pathology of HIV peripheral nerve disease. J Peripher Nerv Syst. 2001;6:21–27. doi: 10.1046/j.1529-8027.2001.006001021.x. [DOI] [PubMed] [Google Scholar]
  • 3.So YT, Holtzman DM, Abrams DI, Olney RK. Peripheral neuropathy associated with acquired immunodeficiency syndrome. Prevalence and clinical features from a population-based survey. Arch Neurol. 1988;45:945–948. doi: 10.1001/archneur.1988.00520330023005. [DOI] [PubMed] [Google Scholar]
  • 4.Pettersen JA, Jones G, Worthington C, Krentz HB, Keppler OT, Hoke A, Gill MJ, Power C. Sensory neuropathy in human immunodeficiency virus/acquired immunodeficiency syndrome patients: protease inhibitor-mediated neurotoxicity. Ann Neurol. 2006;59:816–824. doi: 10.1002/ana.20816. [DOI] [PubMed] [Google Scholar]
  • 5.Jensen TS, Baron R, Haanpää M, Kalso E, Loeser JD, Rice ASC, Treede R-D. A new definition of neuropathic pain. Pain. 2011;152:2204–2205. doi: 10.1016/j.pain.2011.06.017. [DOI] [PubMed] [Google Scholar]
  • 6.Polydefkis M, Yiannoutsos CT, Cohen BA, Hollander H, Schifitto G, Clifford DB, Simpson DM, Katzenstein D, Shriver S, Hauer P, Brown A, Haidich AB, Moo L, McArthur JC. Reduced intraepidermal nerve fiber density in HIV-associated sensory neuropathy. Neurology. 2002;58:115–119. doi: 10.1212/wnl.58.1.115. [DOI] [PubMed] [Google Scholar]
  • 7.Latarjet R, Duplan JF. Experiment and discussion on leukaemogenesis by cell-free extracts of radiation-induced leukaemia in mice. Int J Radiat Biol. 1962;5:339–344. doi: 10.1080/09553006214550911. [DOI] [PubMed] [Google Scholar]
  • 8.Chattopadhyay SK, Morse HC, Makino M, Ruscetti SK, Hartley JW. Defective Virus is Associated with Induction of Murine Retrovirus-Induced Immunodeficiency Syndrome. Proceedings of the National Academy of Sciences. 1989;86:3862–3866. doi: 10.1073/pnas.86.10.3862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Jolicoeur P. Murine acquired immunodeficiency syndrome (MAIDS): an animal model to study the AIDS pathogenesis. FASEB J. 1991;5:2398–2405. doi: 10.1096/fasebj.5.10.2065888. [DOI] [PubMed] [Google Scholar]
  • 10.Sei Y, Kustova Y, Li Y, Morse HC, 3rd, Skolnick P, Basile AS. The encephalopathy associated with murine acquired immunodeficiency syndrome. Ann N Y Acad Sci. 1998;840:822–834. doi: 10.1111/j.1749-6632.1998.tb09620.x. [DOI] [PubMed] [Google Scholar]
  • 11.Sei Y, Arora PK, Skolnick P, Paul IA. Spatial learning impairment in a murine model of AIDS. FASEB J. 1992;6:3008–3013. doi: 10.1096/fasebj.6.11.1644264. [DOI] [PubMed] [Google Scholar]
  • 12.Kustova Y, Espey MG, Sung EG, Morse D, Sei Y, Basile AS. Evidence of neuronal degeneration in C57B1/6 mice infected with the LP-BM5 leukemia retrovirus mixture. Mol Chem Neuropathol. 1998;35:39–59. doi: 10.1007/BF02815115. [DOI] [PubMed] [Google Scholar]
  • 13.Chen GJ, Watson RR. Modulation of tumor necrosis factor and gamma interferon production by cocaine and morphine in aging mice infected with LP-BM5, a murine retrovirus. J Leukoc Biol. 1991;50:349–355. doi: 10.1002/jlb.50.4.349. [DOI] [PubMed] [Google Scholar]
  • 14.Cheung SC, Chattopadhyay SK, Morse HC, 3rd, Pitha PM. Expression of defective virus and cytokine genes in murine AIDS. J Virol. 1991;65:823–828. doi: 10.1128/jvi.65.2.823-828.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Morawetz RA, Giese NA, Gabriele L, Rothman P, Horak I, Ozato K, Morse HC., 3rd Relationship of cytokines and cytokine signaling to immunodeficiency disorders in the mouse. Braz J Med Biol Res. 1998;31:61–67. doi: 10.1590/s0100-879x1998000100008. [DOI] [PubMed] [Google Scholar]
  • 16.Iida R, Saito K, Yamada K, Basile AS, Sekikawa K, Takemura M, Fujii H, Wada H, Seishima M, Nabeshima T. Suppression of neurocognitive damage in LP-BM5-infected mice with a targeted deletion of the TNF-alpha gene. FASEB J. 2000;14:1023–1031. doi: 10.1096/fasebj.14.7.1023. [DOI] [PubMed] [Google Scholar]
  • 17.Koustova E, Sei Y, McCarty T, Espey MG, Ming R, Morse HC, 3rd, Basile AS. Accelerated development of neurochemical and behavioral deficits in LP-BM5 infected mice with targeted deletions of the IFN-gamma gene. J Neuroimmunol. 2000;108:112–121. doi: 10.1016/s0165-5728(00)00258-7. [DOI] [PubMed] [Google Scholar]
  • 18.Eiseman JL, Yetter RA, Fredrickson TN, Shapiro SG, MacAuley C, Bilello JA. Effect of 3'azidothymidine administered in drinking water or by continuous infusion on the development of MAIDS. Antiviral Res. 1991;16:307–326. doi: 10.1016/0166-3542(91)90046-t. [DOI] [PubMed] [Google Scholar]
  • 19.Magnani M, Casabianca A, Fraternale A, Brandi G, Chiarantini L, Benatti U, Scarfi S, Millo E, De Flora A. Inhibition of murine AIDS by a new azidothymidine homodinucleotide. J Acquir Immune Defic Syndr Hum Retrovirol. 1998;17:189–195. doi: 10.1097/00042560-199803010-00001. [DOI] [PubMed] [Google Scholar]
  • 20.P. Dias AS, Bester MJ, Britz RF, Apostolides Z. Animal Models Used for the Evaluation of Antiretroviral Therapies. Current HIV Research. 2006;4:431–446. doi: 10.2174/157016206778560045. [DOI] [PubMed] [Google Scholar]
  • 21.Arenas-Pinto A, Bhaskaran K, Dunn D, Weller IV. The risk of developing peripheral neuropathy induced by nucleoside reverse transcriptase inhibitors decreases over time: evidence from the Delta trial. Antivir Ther. 2008;13:289–295. [PubMed] [Google Scholar]
  • 22.Keswani SC, Chander B, Hasan C, Griffin JW, McArthur JC, Hoke A. FK506 is neuroprotective in a model of antiretroviral toxic neuropathy. Ann Neurol. 2003;53:57–64. doi: 10.1002/ana.10401. [DOI] [PubMed] [Google Scholar]
  • 23.Simpson DM, Tagliati M. Nucleoside analogue-associated peripheral neuropathy in human immunodeficiency virus infection. J Acquir Immune Defic Syndr Hum Retrovirol. 1995;9:153–161. [PubMed] [Google Scholar]
  • 24.Klinken SP, Fredrickson TN, Hartley JW, Yetter RA, Morse H. C. d. Evolution of B cell lineage lymphomas in mice with a retrovirus-induced immunodeficiency syndrome, MAIDS. J Immunol. 1988;140:1123–1131. [PubMed] [Google Scholar]
  • 25.Green KA, Noelle RJ, Durell BG, Green WR. Characterization of the CD154-positive and CD40-positive cellular subsets required for pathogenesis in retrovirus-induced murine immunodeficiency. J Virol. 2001;75:3581–3589. doi: 10.1128/JVI.75.8.3581-3589.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Rowe WP, Pugh WE, Hartley JW. Plaque assay techniques for murine leukemia viruses. Virology. 1970;42:1136–1139. doi: 10.1016/0042-6822(70)90362-4. [DOI] [PubMed] [Google Scholar]
  • 27.Li W, Green WR. The role of CD4 T cells in the pathogenesis of murine AIDS. J Virol. 2006;80:5777–5789. doi: 10.1128/JVI.02711-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Cao L, DeLeo JA. CNS-infiltrating CD4+ T lymphocytes contribute to murine spinal nerve transection-induced neuropathic pain. Eur J Immunol. 2008;38:448–458. doi: 10.1002/eji.200737485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods. 1994;53:55–63. doi: 10.1016/0165-0270(94)90144-9. [DOI] [PubMed] [Google Scholar]
  • 30.Cook WJ, Green KA, Obar JJ, Green WR. Quantitative analysis of LP-BM5 murine leukemia retrovirus RNA using real-time RT-PCR. J Virol Methods. 2003;108:49–58. doi: 10.1016/s0166-0934(02)00256-2. [DOI] [PubMed] [Google Scholar]
  • 31.Giese NA, Giese T, Morse HC., 3rd Murine AIDS is an antigen-driven disease: requirements for major histocompatibility complex class II expression and CD4+ T cells. J. Virol. 1994;68:5819–5824. doi: 10.1128/jvi.68.9.5819-5824.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Keswani SC, Jack C, Zhou C, Hoke A. Establishment of a rodent model of HIV-associated sensory neuropathy. J Neurosci. 2006;26:10299–10304. doi: 10.1523/JNEUROSCI.3135-06.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Cao L, Palmer CD, Malon JT, De Leo JA. Critical role of microglial CD40 in the maintenance of mechanical hypersensitivity in a murine model of neuropathic pain. Eur J Immunol. 2009;39:3562–3569. doi: 10.1002/eji.200939657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Christophi GP, Hudson CA, Panos M, Gruber RC, Massa PT. Modulation of macrophage infiltration and inflammatory activity by the phosphatase SHP-1 in virus-induced demyelinating disease. J Virol. 2009;83:522–539. doi: 10.1128/JVI.01210-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Cheng C, Guo GF, Martinez JA, Singh V, Zochodne DW. Dynamic plasticity of axons within a cutaneous milieu. J Neurosci. 2010;30:14735–14744. doi: 10.1523/JNEUROSCI.2919-10.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Fantini F, Johansson O. Expression of growth-associated protein 43 and nerve growth factor receptor in human skin: a comparative immunohistochemical investigation. J Invest Dermatol. 1992;99:734–742. doi: 10.1111/1523-1747.ep12614465. [DOI] [PubMed] [Google Scholar]
  • 37.Fraternale A, Casabianca A, Rossi L, Chiarantini L, Brandi G, Aluigi G, Schiavano GF, Magnani M. Inhibition of murine AIDS by combination of AZT and dideoxycytidine 5'-triphosphate. J Acquir Immune Defic Syndr Hum Retrovirol. 1996;12:164–173. doi: 10.1097/00042560-199606010-00010. [DOI] [PubMed] [Google Scholar]
  • 38.Burdo TH, Orzechowski K, Knight HL, Miller AD, Williams K. Dorsal Root Ganglia Damage in SIV-Infected Rhesus Macaques: An Animal Model of HIV-Induced Sensory Neuropathy. Am J Pathol. 2012;180:1362–1369. doi: 10.1016/j.ajpath.2011.12.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Kennedy JM, Hoke A, Zhu Y, Johnston JB, van Marle G, Silva C, Zochodne DW, Power C. Peripheral neuropathy in lentivirus infection: evidence of inflammation and axonal injury. AIDS. 2004;18:1241–1250. doi: 10.1097/00002030-200406180-00002. [DOI] [PubMed] [Google Scholar]
  • 40.Laast VA, Pardo CA, Tarwater PM, Queen SE, Reinhart TA, Ghosh M, Adams RJ, Zink MC, Mankowski JL. Pathogenesis of simian immunodeficiency virus-induced alterations in macaque trigeminal ganglia. J Neuropathol Exp Neurol. 2007;66:26–34. doi: 10.1097/nen.0b013e31802c398d. [DOI] [PubMed] [Google Scholar]
  • 41.Zhu Y, Antony JM, Martinez JA, Glerum DM, Brussee V, Hoke A, Zochodne D, Power C. Didanosine causes sensory neuropathy in an HIV/AIDS animal model: impaired mitochondrial and neurotrophic factor gene expression. Brain. 2007;130:2011–2023. doi: 10.1093/brain/awm148. [DOI] [PubMed] [Google Scholar]
  • 42.Wallace VC, Blackbeard J, Pheby T, Segerdahl AR, Davies M, Hasnie F, Hall S, McMahon SB, Rice AS. Pharmacological, behavioural and mechanistic analysis of HIV-1 gp120 induced painful neuropathy. Pain. 2007;133:47–63. doi: 10.1016/j.pain.2007.02.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Herzberg U, Sagen J. Peripheral nerve exposure to HIV viral envelope protein gp120 induces neuropathic pain and spinal gliosis. J Neuroimmunol. 2001;116:29–39. doi: 10.1016/s0165-5728(01)00288-0. [DOI] [PubMed] [Google Scholar]
  • 44.Milligan ED, Mehmert KK, Hinde JL, Harvey LO, Martin D, Tracey KJ, Maier SF, Watkins LR. Thermal hyperalgesia and mechanical allodynia produced by intrathecal administration of the human immunodeficiency virus-1 (HIV-1) envelope glycoprotein, gp120. Brain Res. 2000;861:105–116. doi: 10.1016/s0006-8993(00)02050-3. [DOI] [PubMed] [Google Scholar]
  • 45.Minami T, Matsumura S, Mabuchi T, Kobayashi T, Sugimoto Y, Ushikubi F, Ichikawa A, Narumiya S, Ito S. Functional evidence for interaction between prostaglandin EP3 and [kappa]-opioid receptor pathways in tactile pain induced by human immunodeficiency virus type-1 (HIV-1) glycoprotein gp120. Neuropharmacology. 2003;45:96–105. doi: 10.1016/s0028-3908(03)00133-3. [DOI] [PubMed] [Google Scholar]
  • 46.Cherry CL, Rosenow A, Affandi JS, McArthur JC, Wesselingh SL, Price P. Cytokine genotype suggests a role for inflammation in nucleoside analog-associated sensory neuropathy (NRTI-SN) and predicts an individual's NRTI-SN risk. AIDS Res Hum Retroviruses. 2008;24:117–123. doi: 10.1089/aid.2007.0168. [DOI] [PubMed] [Google Scholar]
  • 47.Chew CS, Cherry CL, Imran D, Yunihastuti E, Kamarulzaman A, Varna S, Ismail R, Phipps M, Aghafar Z, Gut I, Price P. Tumour necrosis factor haplotypes associated with sensory neuropathy in Asian and Caucasian human immunodeficiency virus patients. Tissue Antigens. 2011;77:126–130. doi: 10.1111/j.1399-0039.2010.01570.x. [DOI] [PubMed] [Google Scholar]
  • 48.Keswani SC, Polley M, Pardo CA, Griffin JW, McArthur JC, Hoke A. Schwann cell chemokine receptors mediate HIV-1 gp120 toxicity to sensory neurons. Ann Neurol. 2003;54:287–296. doi: 10.1002/ana.10645. [DOI] [PubMed] [Google Scholar]
  • 49.Wesselingh SL, Glass J, McArthur JC, Griffin JW, Griffin DE. Cytokine dysregulation in HIV-associated neurological disease. Adv Neuroimmunol. 1994;4:199–206. doi: 10.1016/s0960-5428(06)80258-5. [DOI] [PubMed] [Google Scholar]
  • 50.Yoshioka M, Bradley WG, Shapshak P, Nagano I, Stewart RV, Xin KQ, Srivastava AK, Nakamura S. Role of immune activation and cytokine expression in HIV-1-associated neurologic diseases. Adv Neuroimmunol. 1995;5:335–358. doi: 10.1016/0960-5428(95)00012-q. [DOI] [PubMed] [Google Scholar]
  • 51.Zheng W, Ouyang H, Zheng X, Liu S, Mata M, Fink DJ, Hao S. Glial TNFalpha in the spinal cord regulates neuropathic pain induced by HIV gp120 application in rats. Mol Pain. 2011;7:40. doi: 10.1186/1744-8069-7-40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Schifitto G, McDermott MP, McArthur JC, Marder K, Sacktor N, Epstein L, Kieburtz K. Incidence of and risk factors for HIV-associated distal sensory polyneuropathy. Neurology. 2002;58:1764–1768. doi: 10.1212/wnl.58.12.1764. [DOI] [PubMed] [Google Scholar]
  • 53.Simpson DM. Selected peripheral neuropathies associated with human immunodeficiency virus infection and antiretroviral therapy. J Neurovirol. 2002;8(Suppl 2):33–41. doi: 10.1080/13550280290167939. [DOI] [PubMed] [Google Scholar]

RESOURCES