Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Jan 1.
Published in final edited form as: FEMS Microbiol Lett. 2011 Oct 21;326(1):23–30. doi: 10.1111/j.1574-6968.2011.02430.x

Direct visualization of the interaction between pilin and exopolysaccharides of Myxococcus xanthus with eGFP fused PilA protein

Wei Hu a,c,†, Zhe Yang b,†, Renate Lux a, Minglei Zhao b, Jing Wang a,c, Xuesong He a, Wenyuan Shi a,b,*
PMCID: PMC3454480  NIHMSID: NIHMS334324  PMID: 22092602

Abstract

Type IV pili (TFP) and exopolysaccharides (EPS) are important components for social behaviors in Myxococcus xanthus, including gliding motility and fruiting body formation. Although specific interactions between TFP and EPS have been proposed, direct observations of these interactions under native condition have not yet been made. In this study, we found that a truncated PilA protein (PilACt) which only contains the C-terminal domain (amino acids 32-208) is sufficient for EPS binding in vitro. Furthermore, an enhanced green fluorescent protein (eGFP) and PilACt fusion protein was constructed and used to label the native EPS in M. xanthus. Under confocal laser scanning microscope, the eGFP-PilACt-bound fruiting bodies, trail structures and biofilms exhibited similar patterns as the wheat germ agglutinin lectin (WGA)-labeled EPS structures. This study showed that eGFP-PilACt fusion protein was able to efficiently label the EPS of M. xanthus and for the first time provided evidence for the direct interaction between the PilA protein and EPS under native conditions.

Keywords: Type IV Pilin, Exopolysaccharides, Biofilm, Fruiting body, Confocal laser scanning microscopy, eGFP

Introduction

Myxococcus xanthus is a Gram-negative soil bacterium with sophisticated social behaviors. Its cells can glide over solid surfaces with its two genetically distinct motility systems: adventurous (A)-motility and social (S)-motility (Hodgkin & Kaiser, 1979). When deprived of nutrients, thousands of cells migrate together to form the multi-cellular fruiting bodies (Diodati et al., 2008), which are developmental biofilms. Both type IV pili (TFP) and exopolysaccharides (EPS) play fundamental roles in these cell behaviors. TFP, composed of thousands of subunits of protein called PilA (or type IV pilin), are the molecular engines which enable S-motility (Mauriello et al., 2010). They function by extending the pili at one of the cell poles, attaching to the surfaces of the substratum or another cell and then retract to pull the cell forward (Sun et al., 2000; Clausen et al., 2009). EPS comprises the binding target for TFP in S-motility (Li et al., 2003) and forms the scaffold of M. xanthus biofilms and fruiting bodies (Shimkets, 1986; Lux et al., 2004).

The type IV pilin is highly conserved among many bacteria. The crystal structures of type IV pilins in Pseudomonas aeruginosa (PilA) and in Neisseria gonorrhoeae (PilE) (Parge et al., 1995; Hazes et al., 2000; Keizer et al., 2001; Craig et al., 2003; Craig et al., 2006) revealed a conserved secondary structure consisting of an N-terminal α-helix followed by a C-terminal globular domain. The α-helix domain is suggested to be essential for TFP assembly which forms the central core of the TFP. While the C-terminal globular domain is believed to be exposed to the outer surface of TFP and involved in the biological functions of TFP (Craig et al., 2004). In P. aeruginosa, the human epithelial cell-binding domain of the pilus has been identified in the C-terminal region of pilin (Irvin et al., 1989; Lee et al., 1989; Giltner et al., 2006). Furthermore, truncated pilin (lacking the first 28 residues) retains the overall structure and biological characteristics of the full-length pilin (Keizer et al., 2001). Considering the high sequence conservation in the N-terminal α-helix domain of pilins between P. aeruginosa and M. xanthus (Li et al., 2005), the EPS binding domain in M. xanthus pilin was suggested to reside in the C-terminal region similar to other species.

Previous studies in M. xanthus have shown that TFP sheared off from the cell surface are able to bind to purified EPS in vitro (Li et al., 2003). Addition of purified EPS to the EPS deficient mutant (ΔdifA) restored TFP retraction in this hyperpiliated strain, suggesting that EPS is able to trigger TFP retraction (Li et al., 2003). In addition, the accumulation of pilin subunits in the membrane was found to reduce the EPS levels produced on the cell surface, probably due to the titration of EPS precursors prior to assembly by the PilA monomer pool (Yang et al., 2010). In this study, by constructing and expressing a truncated M. xanthus PilA (PilACt)-eGFP fusion protein, we sought to obtain direct evidence for the specific interaction between TFP and EPS under native conditions.

Materials and Methods

Bacterial strains and growth conditions

Bacterial strains used in this study are listed in Table 1. All E. coli strains were grown at 37°C in LB (Fisher, US). Media were supplemented with ampicillin or kanamycin at 100 μg mL−1 when needed. M. xanthus cells were grown in CYE medium (Campos et al., 1978) at 32°C on a rotary shaker at 300 rpm. To cultivate biofilms of M. xanthus wild-type strain DK1622, exponentially growing cells were harvested and washed three times with MOPS buffer (Kaiser, 1979), resuspended to OD600nm = 1.0 and incubated in sealed containers at 32 °C in the dark for 24 hrs. Submerged fruiting bodies were cultivated in MMC buffer (Kuner & Kaiser, 1982). Eight-well chambered cover slides (Lab-Tek II Chamber Slide System, Nalge Nunc, US) were used in this assay as previously described (Lux et al., 2004). The cell pellets of EPS− strain SW504 (ΔdifA) were directly collected from 24-hr CYE liquid culture following 13,000 x g centrifugation for 10 min.

Table 1.

Bacterial strains, plasmids and primers used in this study

Name Relevant feature Ref. or Source
Strain
M. xanthus
 DK1622 Wild type, EPS+ (Kaiser, 1979)
 SW504 DK1622, ΔdifA, lacking EPS (Yang, et al., 1998)
E. coli
 DH5α Host for cloning (Hanahan, 1983)
 BL21 Host for protein expression NEB

Plasmid
 pET15b Protein overexpression vector Novagen
 pET47b Protein overexpression vector Novagen
 pGFPC2 A plasmid carrying the egfp gene (Thanbichler, et al., 2007)
 pMXE01 C-terminal domain sequence of the pilA gene (pilACt) cloned into pET15b at EcoRI and BamHI sites This study
 pMXE02 egfp gene cloned into pET47b at EcoRI and BamHI sites This study
 pMXE03 egfp-pilACt fusion sequence cloned into pET47b at EcoRI and BamHI sites This study

Primer Sequence (5′-3′)
 HPilA32F AATTAGGATCCTAAGCAGTCCGAGGCGAAGAC
 HPilA32R AATTAGAATTCCCAGTTACTGGGCCGCGCCG
 HGFPF AATTAGGATCCTATGGTGAGCAAGGGCGAGGA
 HGFPR AATTAGAATTCGCTTACTTGTACAGCTCGTCCA
 HGA-1 AATTAGGATCCTATGGTGAGCAAGGGCGAGGA
 HGA-2 CTTCGAGCGGGCCTTGTACAGCTCGTCCATGC
 HGA-3 GAGCTGTACAAGGCCCGCTCGAAGCAGTCCGA
 HGA-4 AATTAGAATTCCCAGTTACTGGGCCGCGCCG

Generation of expression constructs

Plasmids pMXE01, PMXE02 and pMXE03 were constructed for overexpression of the truncated PilA (PilACt), eGFP and eGFP-PilACt fusion protein, respectively (Table 1). The DNA sequence encoding the C-terminal domain (amino acids 32-208) of the mature M. xanthus PilA was PCR amplified from the genomic DNA of M. xanthus DK1622 using primers HPilA32F and HPilA32R (Table 1). The gene coding for eGFP was PCR amplified from pGFPC2 (Thanbichler et al., 2007) using primers HGFPF and HGFPR (Table 1). The DNA sequences coding for eGFP and PilACt were fused using overlapping PCR (Sambrook, 2001), and primers HGA-1, 2 3 and 4 (listed in Table 1). All three constructs have a 6xHis tag at the N-terminus of the proteins of interest to facilitate purification.

Protein expression and purification

Each protein was expressed overnight at 16 °C as previously described (Li et al., 2005), and the cells were harvested and lysed. The lysate was loaded onto a 5 mL HisTrap-HP column (GE Healthcare, US), eluted with a linear gradient from 0 to 0.5 M imidazole in elution buffer (20 mM Tris, 0.5 mM NaCl, pH 8.0), and the total volume of buffer equaled twenty column volumes. To remove the His-tag, 1/1000 volume of Turbo3C protease (2 mg mL−1 stock, Accelagen, US) was added to the pooled fractions and incubated at 4°C overnight. The digested sample was passed over a 5 mL HisTrap-HP column and the flow through was collected, containing the proteins without the His tag. Pooled proteins following His-tag removal were concentrated and loaded onto a Hiload 16/60 Superdex 200 pg column (GE Healthcare) equilibrated in SEC buffer (20 mM Tris/pH 8.0, 100 mM NaCl). Peak fractions were pooled and concentrated to 4 mg mL−1.

SDS-PAGE and Western Blot

SDS-PAGE and Western blots were performed following standard procedures (Harlow, 1988). Primary polyclonal anti-PilA antibody (Li et al., 2005) was used at a 1:10,000 dilution. Primary polyclonal anti-eGFP antibody (Fisher) was used at a 1:2,000 dilution. Anti-rabbit horseradish peroxidase-conjugated secondary antibody (Pierce) was used at a 1:10,000 dilution. Blots were developed using the Supersignal West Pico chemiluminescence reagent (Pierce). Images were obtained with the ChemiDoc XRS system (Bio-Rad, US).

Pilus Precipitation Assay

A pilus precipitation assay was performed as previously described (Li et al., 2003). Cell-surface pili/pilin were sheared off from 1010 SW504 cells by vigorous vortexing for 20 min and centrifuged for 5 min to remove the cell pellet. Protein-free EPS was isolated from DK1622 and quantified as previously described (Chang & Dworkin, 1994; Li et al., 2003). The isolated pili/pilin and purified proteins (final concentration 0.2 mg mL−1 for both) were incubated with either MOPS buffer or purified EPS (final concentration 0.5 mg mL−1) at 32°C for 1 hr. The mixtures were pelleted by centrifugation at 10,000 x g for 10 min. The supernatants were discarded, and the pellets were resuspended in 80 μL of 1% SDS followed by boiling with protein-loading dye (final concentration 1x) for SDS-PAGE and Western blotting.

Confocal laser scanning microscopy (CLSM)

A PASCAL 5 CLSM (Zeiss, Germany) equipped with a 40x oil-immersion objective (Plan-Neofluar/NA 1.3) was employed to analyze M. xanthus submerged biofilms and fruiting bodies. Excitation at 488 nm with an argon laser in combination with a 505–530 nm bandpass emission filter was used for imaging of eGFP. SYTO 82 and Alexa Fluor 546 signals were visualized using 543 nm excitation with a helium–neon laser and a 560–615 nm band-pass emission filter. 633 nm excitation with a helium-neon laser and a 650 nm longpass emission filter was used to reveal Alexa Fluor 633.

EPS and cells labeling

Submerged biofilms, fruiting bodies of wild-type DK1622 or cell pellets of SW504 (ΔdifA) were incubated with purified eGFP-PilACt at 0.15 μM for 1 hr at room temperature, and the samples were washed with 1 ml MOPS buffer 3 times. Purified eGFP protein at 0.15 μM was used as control. Carbohydrates (EPS) present in the extracellular matrix were stained with 0.15 μM Alexa 633-conjugated derivatives of the wheat germ agglutinin lectin (Alexa 633-WGA, Molecular Probes) in MOPS buffer (Lux et al., 2004) for 10 min in the dark. For excess WGA staining experiments, 1.5 μM Alexa 633-WGA was added for 1 hr in the dark. SYTO 82 (Molecular Probes) was added at 2.5 μM in the samples to stain cells when needed. The specimens were then subjected to CLSM observation immediately.

Quantitative correlations and colocalization analysis

CLSM image layers selected for analysis were converted into 8-bit monochromatic images (512×512 pixel in size), and imported to Intensity Correlation Analysis (Collins & Stanley, 2006), a plugin for ImageJ software (http://rsbweb.nih.gov/ij/). The intensity correlation analysis (ICA) plots for two channels were generated according to the software instructions, and the intensity correlation quotient (ICQ) was calculated as described previously (Li et al., 2004) in triplicate experiments.

Results and Discussion

C-terminal domain (amino acids 32-208) of PilA is sufficient for EPS binding in vitro

Binding between PilA and EPS in M. xanthus has been proposed previously (Li et al., 2003), however, direct evidence for this interaction under native condition is still lacking. In order to investigate the interaction between PilA and EPS, the M. xanthus PilA was exogenously expressed. Since full length type IV pilin was extremely difficult to overexpress reproducibly in vitro due to its poor solubility (Wu & Kaiser, 1997; Hazes et al., 2000; Keizer et al., 2001; Li et al., 2005), we constructed an overexpression plasmid pMXE01 carrying a truncated form of M. xanthus PilA (PilACt) which only contains the C-terminal domain (amino acids 32-208 of the mature pilin). After overexpressing and purifying PilACt, we obtained abundant soluble recombinant proteins with the expected size (lanes 2 and 3, Fig. 1A), which could be recognized by the anti-PilA antibody (lane 2, Fig. 1B).

Fig. 1.

Fig. 1

Construction of the truncated PilA (PilACt) and eGFP-PilACt fusion protein. (A) PilACt (lanes 2 and 3), eGFP (lanes 4 and 5) and eGFP-PilACt (lanes 6 and 7) were overexpressed and purified. E. coli lysates (noted as ‘Lysate’) as well as purified proteins (noted as ‘Purified’, 2 μg protein) were loaded onto SDS-PAGE and gel was stained coomassie blue. (B) Purified PilACt and eGFP-PilACt (100 ng protein for both) were blotted with anti-PilA polyclonal antibody. (C) Purified eGFP and eGFP-PilACt (100 ng protein for both) were blotted with anti-eGFP polyclonal antibody.

Previous studies have shown that M. xanthus pili/pilin sheared off from the cell surface are able to bind to EPS purified from wild-type cells (Li et al., 2003). Using the precipitation assay developed by Li et al (Li et al., 2003), the purified PilACt was tested for its binding to EPS. As shown in Fig. 2 (1st panel), sheared pili/pilin was precipitated by EPS, which was consistent with previous findings (Li et al., 2003). Similarly, the PilACt protein also precipitated with EPS (2nd panel, Fig. 2), indicating that the truncated form of PilA still retains the ability to bind to EPS. These results demonstrated that the C-terminal domain lacking the first 32 amino acids of the mature PilA is sufficient for EPS binding.

Fig. 2.

Fig. 2

Precipitation of different proteins by M. xanthus EPS in vitro. Sheared pili from SW504 (1st panel), purified PilACt (2nd panel), eGFP-PilACt (3rd panel) or eGFP (4th panel) proteins were incubated with EPS and precipitated by centrifugation as described in Materials and Methods. The precipitated proteins were loaded on SDS-PAGE gels and analyzed using Western blots with anti-PilA antibody (1st, 2nd and 3rd panels) or anti-eGFP antibody (4th panel). From left to right shows total protein before precipitation, precipitated with MOPS buffer and precipitated with EPS.

Construction of an eGFP-PilACt fusion protein

The PilACt was fused to the C-terminus of the enhanced green fluorescent protein (eGFP) and cloned into the vector pET47b, resulting in pMXE03 (Table 1). This eGFP-PilACt fusion protein contains both an EPS binding domain (PilACt) and a fluorescent domain (eGFP). We used eGFP because it provided brighter fluorescence compared with GFP and this protein expressed and folded well in M. xanthus. A control construct, pMXE02 that carries only the eGFP was also generated (Table 1). eGFP-PilACt and eGFP were both purified in vitro and soluble recombinant proteins with the expected sizes were obtained (lanes 4–7, Fig. 1). To confirm the structures of the recombinant proteins, Western blot analysis was conducted using anti-PilA and anti-eGFP antibodies. As expected, PilACt can be recognized by the anti-PilA antibody, eGFP can react with the anti-eGFP antibody, and the eGFP-PilACt fusion protein can be recognized by both antibodies (Fig. 1B and 1C). The fusion protein was then subjected to the precipitation assay (Li et al., 2003) to test its EPS binding ability. eGFP-PilACt exhibited strong binding to EPS (3rd panel), while eGFP alone showed little binding (4th panel), indicating that the specific binding of eGFP-PilACt to EPS in vitro was primarily due to the PilACt domain in the fusion protein (Fig. 2).

eGFP-PilACt and lectin WGA labeled similar EPS structures in M. xanthus

Next, we tested whether eGFP-PilACt could be used to efficiently label the native EPS. WGA, a lectin which binds to EPS in M. xanthus (Lux et al., 2004), was used as a positive control. M. xanthus wild-type DK1622 cells were allowed to form submerged biofilms and fruiting bodies, and labeled with purified eGFP-PilACt and Alexa 633-WGA. SYTO 82 was added to differentiate the cells from the matrix. In 24-hr submerged fruiting bodies, the cells aggregated in the dome-shaped structure for which EPS forms the scaffold (Lux et al., 2004). eGFP-PilACt and WGA were both found to label EPS in similar patterns, as evident by the colocalization of the green and red signals in the overlay image (upper panel, Fig. 3A). At the same time, slime trails connecting different fruiting bodies built up with EPS and cells were detected. eGFP-PilACt and WGA were both found to label these structures (middle panel, Fig. 3A). In MOPS buffer, where M. xanthus cells were induced to form non-developmental biofilms, EPS formed patch-like structures with cell aggregates, and eGFP-PilACt and WGA colocalized to these structures as well (bottom panel, Fig. 3A). Employing an established method for colocalization analysis (Li et al., 2004), the intensity correlation analysis (ICA) plots of individual WGA and eGFP-PilACt staining intensities (y-axis) against their respective calculated product of the differences from the mean (PDM values, x-axis) were generated. Among different staining patterns, including random, dependent and segregated (Li et al., 2004), the intensities of WGA and eGFP-PilACt labeling patterns clearly exhibited a dependent relationship in all structures (right panel, Fig. 3A). As suggested by Li et al. (Li et al., 2004), the statistical analysis of intensity correlation quotient (ICQ) values based on triplicate images was performed for a more reliable analysis. The ICQ values of the WGA/eGFP-PilACt staining pairs were 0.23 ± 0.06 (mean ± SD) in fruiting bodies, 0.21 ± 0.05 in trail structures and 0.14 ± 0.03 in biofilms, which were all in the range of 0 to 0.5 for dependent staining (Li et al., 2004) and significantly different from 0 (random staining, Student’s t test p<0.01).

Fig. 3.

Fig. 3

Labeling of native EPS of M. xanthus by eGFP-PilACt. (A) Wild-type DK1622 submerged fruiting body, trail and biofilm structures were counterstained with Alexa 633-WGA (red), eGFP-PilACt (green) and Syto 82 (blue). ICA plots (right) show the intensity correlation analysis of WGA/PilACt (red/green) staining pairs in the left images. The axes on the plots are the product of the differences from the mean (PDM) values on the x-axis and the red or green intensities on the y-axis. PDM = (red intensity mean – red intensity) × (green intensity – mean green intensity) (Li et al., 2004). (B) Cell pellets of EPS deficient strain SW504 (ΔdifA) were stained with Syto 82 (blue), Alexa 633-WGA (red) and eGFP-PilACt (green). (C) DK1622 fruiting body and biofilm structures were counterstained with Alexa 633-WGA (red) and eGFP (green). (D) DK1622 fruiting body and biofilm structures were stained with 0.15 μM eGFP-PilACt, after washing, the specimens were stained with 1.5 μM Alexa 633-WGA for 1 hour and examined under CLSM. Bars = 50 μm.

Strain SW504 (ΔdifA) is defective in EPS production due to a mutation in an EPS regulatory gene (Yang et al., 1998), and was used as an negative control in our EPS labeling assay. Since SW504 lacks the ability to form starvation biofilms or fruiting bodies, its cell pellets were directly collected from liquid culture and counterstained with Alexa 633-WGA and eGFP-PilACt. Both WGA and eGFP-PilACt failed to stain the cell pellets of SW504 (Fig. 3B),. These results demonstrated that eGFP-PilACt specifically labels the EPS structures under native conditions in both fruiting bodies and biofilms.

Consistent with the EPS precipitation results (Fig. 2), eGFP alone did not significantly label EPS structures in submerged biofilms and fruiting bodies formed by DK1622 (Fig. 3C) compared with the eGFP-PilACt (Fig. 3A). This result confirms that the PilACt domain is responsible for the EPS recognition and binding ability in the fusion protein. Thus, the similarities between patterns of eGFP-PilACt and WGA binding are indicative of direct PilACt binding to the native EPS in biofilms, trails and fruiting bodies. Interestingly, when an elevated amount of WGA (1.5 μM) was added to the fruiting bodies and biofilms pre-labeled with eGFP-PilACt, the green signals from eGFP-PilACt were reduced and dispersed (Fig. 3C). This result suggested a possible competition between eGFP-PilACt and WGA in binding with EPS. WGA is a lectin that selectively recognizes N-acetyl-glucosaminyl sugar residues (Wright, 1984), which is one of the carbohydrates identified in the M. xanthus EPS (Behmlander & Dworkin, 1994; Li et al., 2003). Previous findings also showed that GlcNAc blocks TFP retraction and chitin (polymer of GlcNAc) triggers TFP retraction (Li et al., 2003). Therefore, PilA of M. xanthus appears to recognize the GlcNAc moiety in M. xanthus EPS.

Type IV pili and EPS are both important cell surface components for many pathogenic and nonpathogenic microbial organisms (Wall & Kaiser, 1999; Sutherland, 2001), and their interactions play pivotal roles in many of biological processes, e.g. motility, development and pathogenesis (Sheth et al., 1994; Li et al., 2003). In M. xanthus, the co-precipitation of sheared pili/pilin and EPS, as well as the triggering of TFP retraction by isolated EPS, indicate specific interactions between these two cell surface components (Li et al., 2003). In this study, we confirmed that, in addition to sheared TFP, purified PilACt and eGFP-PilACt were both able to bind to EPS in vitro, and that the C-terminal domain beyond the first 32 amino acids of the mature pilin was sufficient for the binding ability. Furthermore, we demonstrated that the eGFP-PilACt fusion protein specifically labeled similar EPS structures as the WGA in starvation biofilms, trail structures and developmental fruiting bodies, which provided evidence for the direct interaction between pilin and EPS of M. xanthus under native conditions. At the same time, the eGFP tagged truncated pilin could be utilized to visualize EPS distribution in M. xanthus and the novel approach developed in this study may be applied in future studies of M. xanthus cell behaviors involving EPS and TFP.

Acknowledgments

We thank Drs. Mitch Singer and Dale Kaiser for providing bacterial strains, and Aida Kaplan and Dr. Howard Kuramitsu for editing the manuscript. This work was supported by the US National Institutes of Health Grant GM54666 (to W.S.) and the Chinese National Natural Science Foundation Grant 30870020 (to W.H.).

References

  1. Behmlander RM, Dworkin M. Biochemical and structural analyses of the extracellular matrix fibrils of Myxococcus xanthus. J Bacteriol. 1994;176:6295–6303. doi: 10.1128/jb.176.20.6295-6303.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Campos JM, Geisselsoder J, Zusman DR. Isolation of bacteriophage MX4, a generalized transducing phage for Myxococcus xanthus. J Mol Biol. 1978;119:167–178. doi: 10.1016/0022-2836(78)90431-x. [DOI] [PubMed] [Google Scholar]
  3. Chang BY, Dworkin M. Isolated fibrils rescue cohesion and development in the Dsp mutant of Myxococcus xanthus. J Bacteriol. 1994;176:7190–7196. doi: 10.1128/jb.176.23.7190-7196.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Clausen M, Jakovljevic V, Sogaard-Andersen L, Maier B. High-force generation is a conserved property of type IV pilus systems. J Bacteriol. 2009;191:4633–4638. doi: 10.1128/JB.00396-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Collins T, Stanley E. Intensity Correlation Analysis, a plugin for ImageJ. Toronto, ON, Canada: 2006. [Google Scholar]
  6. Craig L, Pique ME, Tainer JA. Type IV pilus structure and bacterial pathogenicity. Nat Rev Microbiol. 2004;2:363–378. doi: 10.1038/nrmicro885. [DOI] [PubMed] [Google Scholar]
  7. Craig L, Volkmann N, Arvai AS, Pique ME, Yeager M, Egelman EH, Tainer JA. Type IV pilus structure by cryo-electron microscopy and crystallography: implications for pilus assembly and functions. Mol Cell. 2006;23:651–662. doi: 10.1016/j.molcel.2006.07.004. [DOI] [PubMed] [Google Scholar]
  8. Craig L, Taylor RK, Pique ME, et al. Type IV pilin structure and assembly: X-ray and EM analyses of Vibrio cholerae toxin-coregulated pilus and Pseudomonas aeruginosa PAK pilin. Mol Cell. 2003;11:1139–1150. doi: 10.1016/s1097-2765(03)00170-9. [DOI] [PubMed] [Google Scholar]
  9. Diodati ME, Gill RE, Plamann L, Singer M. Initiation and early developmental events. In: Whitworth DE, editor. Myxobacteria : multicellularity and differentiation. ASM Press; Washington, DC: 2008. pp. 43–76. [Google Scholar]
  10. Giltner CL, van Schaik EJ, Audette GF, Kao D, Hodges RS, Hassett DJ, Irvin RT. The Pseudomonas aeruginosa type IV pilin receptor binding domain functions as an adhesin for both biotic and abiotic surfaces. Mol Microbiol. 2006;59:1083–1096. doi: 10.1111/j.1365-2958.2005.05002.x. [DOI] [PubMed] [Google Scholar]
  11. Hanahan D. Studies on transformation of Escherichia coli with plasmids. J Mol Biol. 1983;166:557–580. doi: 10.1016/s0022-2836(83)80284-8. [DOI] [PubMed] [Google Scholar]
  12. Harlow EL. Antibodies: a Laboratory Manual. Cold Spring Harbor Laboratory Press; NY: 1988. [Google Scholar]
  13. Hazes B, Sastry PA, Hayakawa K, Read RJ, Irvin RT. Crystal structure of Pseudomonas aeruginosa PAK pilin suggests a main-chain-dominated mode of receptor binding. J Mol Biol. 2000;299:1005–1017. doi: 10.1006/jmbi.2000.3801. [DOI] [PubMed] [Google Scholar]
  14. Hodgkin J, Kaiser D. Genetics of gliding motility in Myxococcus xanthus (Myxobacterales): two gene systems control movement. Mol Gen Genet. 1979;171:177–191. [Google Scholar]
  15. Irvin RT, Doig P, Lee KK, Sastry PA, Paranchych W, Todd T, Hodges RS. Characterization of the Pseudomonas aeruginosa pilus adhesin: confirmation that the pilin structural protein subunit contains a human epithelial cell-binding domain. Infect Immun. 1989;57:3720–3726. doi: 10.1128/iai.57.12.3720-3726.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kaiser D. Social gliding is correlated with the presence of pili in Myxococcus xanthus. Proc Natl Acad Sci U S A. 1979;76:5952–5956. doi: 10.1073/pnas.76.11.5952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Keizer DW, Slupsky CM, Kalisiak M, Campbell AP, Crump MP, Sastry PA, Hazes B, Irvin RT, Sykes BD. Structure of a pilin monomer from Pseudomonas aeruginosa: implications for the assembly of pili. J Biol Chem. 2001;276:24186–24193. doi: 10.1074/jbc.M100659200. [DOI] [PubMed] [Google Scholar]
  18. Kuner JM, Kaiser D. Fruiting body morphogenesis in submerged cultures of Myxococcus xanthus. J Bacteriol. 1982;151:458–461. doi: 10.1128/jb.151.1.458-461.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lee KK, Doig P, Irvin RT, Paranchych W, Hodges RS. Mapping the surface regions of Pseudomonas aeruginosa PAK pilin: the importance of the C-terminal region for adherence to human buccal epithelial cells. Mol Microbiol. 1989;3:1493–1499. doi: 10.1111/j.1365-2958.1989.tb00135.x. [DOI] [PubMed] [Google Scholar]
  20. Li Q, Lau A, Morris TJ, Guo L, Fordyce CB, Stanley EF. A syntaxin 1, Gα0, and N-type calcium channel complex at a presynaptic nerve terminal: analysis by quantitative immunocolocalization. J Neurosci. 2004;24:4070–4081. doi: 10.1523/JNEUROSCI.0346-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Li Y, Lux R, Pelling AE, Gimzewski JK, Shi W. Analysis of type IV pilus and its associated motility in Myxococcus xanthus using an antibody reactive with native pilin and pili. Microbiology. 2005;151:353–360. doi: 10.1099/mic.0.27614-0. [DOI] [PubMed] [Google Scholar]
  22. Li Y, Sun H, Ma X, Lu A, Lux R, Zusman D, Shi W. Extracellular polysaccharides mediate pilus retraction during social motility of Myxococcus xanthus. Proc Natl Acad Sci U S A. 2003;100:5443–5448. doi: 10.1073/pnas.0836639100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lux R, Li Y, Lu A, Shi W. Detailed three-dimensional analysis of structural features of Myxococcus xanthus fruiting bodies using confocal laser scanning microscopy. Biofilms. 2004;1:293–303. [Google Scholar]
  24. Mauriello EM, Mignot T, Yang Z, Zusman DR. Gliding motility revisited: how do the myxobacteria move without flagella. Microbiol Mol Biol Rev. 2010;74:229–249. doi: 10.1128/MMBR.00043-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Parge HE, Forest KT, Hickey MJ, Christensen DA, Getzoff ED, Tainer JA. Structure of the fibre-forming protein pilin at 2.6 Å resolution. Nature. 1995;378:32–38. doi: 10.1038/378032a0. [DOI] [PubMed] [Google Scholar]
  26. Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press; NY: 2001. [Google Scholar]
  27. Sheth HB, Lee KK, Wong WY, Srivastava G, Hindsgaul O, Hodges RS, Paranchych W, Irvin RT. The pili of Pseudomonas aeruginosa strains PAK and PAO bind specifically to the carbohydrate sequence beta GalNAc(1–4)beta-Gal found in glycosphingolipids asialo-GM1 and asialo-GM2. Mol Microbiol. 1994;11:715–723. doi: 10.1111/j.1365-2958.1994.tb00349.x. [DOI] [PubMed] [Google Scholar]
  28. Shimkets LJ. Role of cell cohesion in Myxococcus xanthus fruiting body formation. J Bacteriol. 1986;166:842–848. doi: 10.1128/jb.166.3.842-848.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Sun H, Zusman DR, Shi W. Type IV pilus of Myxococcus xanthus is a motility apparatus controlled by the frz chemosensory system. Curr Biol. 2000;10:1143–1146. doi: 10.1016/s0960-9822(00)00705-3. [DOI] [PubMed] [Google Scholar]
  30. Sutherland I. Biofilm exopolysaccharides: a strong and sticky framework. Microbiology. 2001;147:3–9. doi: 10.1099/00221287-147-1-3. [DOI] [PubMed] [Google Scholar]
  31. Thanbichler M, Iniesta AA, Shapiro L. A comprehensive set of plasmids for vanillate- and xylose-inducible gene expression in Caulobacter crescentus. Nucleic Acids Res. 2007;35:e137. doi: 10.1093/nar/gkm818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wall D, Kaiser D. Type IV pili and cell motility. Mol Microbiol. 1999;32:1–10. doi: 10.1046/j.1365-2958.1999.01339.x. [DOI] [PubMed] [Google Scholar]
  33. Wright CS. Structural comparison of the two distinct sugar binding sites in wheat germ agglutinin isolectin II. J Mol Biol. 1984;178:91–104. doi: 10.1016/0022-2836(84)90232-8. [DOI] [PubMed] [Google Scholar]
  34. Wu SS, Kaiser D. Regulation of expression of the pilA gene in Myxococcus xanthus. J Bacteriol. 1997;179:7748–7758. doi: 10.1128/jb.179.24.7748-7758.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Yang Z, Geng Y, Xu D, Kaplan HB, Shi W. A new set of chemotaxis homologues is essential for Myxococcus xanthus social motility. Mol Microbiol. 1998;30:1123–1130. doi: 10.1046/j.1365-2958.1998.01160.x. [DOI] [PubMed] [Google Scholar]
  36. Yang Z, Lux R, Hu W, Hu C, Shi W. PilA localization affects extracellular polysaccharide production and fruiting body formation in Myxococcus xanthus. Mol Microbiol. 2010;76:1500–1513. doi: 10.1111/j.1365-2958.2010.07180.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES