Abstract
Poultry farming may introduce pathogens into the environment and food chains. High concentrations of chicken/turkey parvoviruses were detected in chicken stools and slaughterhouse and downstream urban wastewaters by applying new PCR-based specific detection and quantification techniques. Our results confirm that chicken/turkey parvoviruses may be useful viral indicators of poultry fecal contamination.
TEXT
Animal populations can serve as reservoirs for human pathogens and may facilitate transmission of those crossing the species barrier. Therefore, the origin of animal fecal contamination must be identified and tracked to monitor water quality, assess potential health risks, and determine optimal remediation strategies. In particular, poultry farming is an industry that produces a large volume of different by-products occasionally used as manure to fertilize crops, which can introduce pathogens into the surrounding environment and into the food chain (1, 5, 8). However, until recently, there had been little effort to develop suitable techniques to characterize the origin of avian fecal contamination (2, 13, 17).
Bacterial fecal indicators often fail to predict the presence of pathogenic microorganisms in water and food (7). Thus, viruses have emerged as a promising tool to increase water quality standards, due to their high host specificity and stability in different environments (9, 11, 14, 20, 21).
The high levels of prevalence of parvovirus in chickens (ChPV) and turkeys (TuPV) in different countries (3, 18, 19, 23, 24) and the high level of stability of animal parvovirus (15, 22) have been described. Here, the potential role of ChPV/TuPV as a new tool for microbial source tracking was evaluated by developing nested and also quantitative PCR-based assays for the detection and quantification of ChPV/TuPV in environmental samples.
All sequences available in GenBank for ChPV and TuPV were aligned, and two nested PCR (nPCR) assays, targeting the nonstructural and VP1/VP2 regions, and a quantitative PCR (qPCR), targeting the VP1/VP2 regions, were optimized (Table 1).
Table 1.
Oligonucleotide primers used for the detection and quantification of chicken/turkey parvoviruses
| Primers | Genome regiona | Positionb | Amplification reaction | Amplicon size (bp) | Annealing temp (°C) | Sequence (5′–3′) |
|---|---|---|---|---|---|---|
| Par1 | NS | 661–682 | First | 412 | 53 | GGTACAAGATATGCTAGATTTG |
| Par2 | 1053–1073 | CGGATGGCTAAATTATCATCT | ||||
| Par3 | 718–739 | Nested | 325 | 53 | CCATCGCAGGAATTAACTCCAG | |
| Par4 | 1022–1043 | GTGTCAACATCTCCATGTATTG | ||||
| VP-Par1 | VP1/VP2 | 3119–3140 | First | 373 | 56 | TGGAATTGTGATACTATATGGG |
| VP-Par2 | 3473–3492 | TCYTGATCTGCAAATATTTG | ||||
| VP-Par3 | 3173–3196 | Nested | 249 | 64 | CATTGTGTCTGTCTWATGCGTGAC | |
| VP-Par4 | 3405–3422 | GTTTTCTGGATGACTTGCA | ||||
| Q-PaV-F | VP1/VP2 | 3326–3345 | qPCR | 81 | 60 | AGTCCACGAGATTGGCAACA |
| Q-PaV-R | 3388–3407 | GCAGGTTAAAGATTTTCACG | ||||
| Q-PaV-Pr | 3356–3378 | 6FAM-AATTATTCGAGATGGCGCCCACG-BHQ1 |
NS, nonstructural protein 1; VP1, virion protein 1; VP2, virion protein 2.
The sequence positions are with reference to accession number GU214706 from GenBank.
A total of 30 chicken fecal pools were collected from different farms in Catalonia (coastal Northeast Spain), the Basque Country (Northern Spain), Patras (Greece), and Budapest (Hungary) between February and December 2010. Three turkey, 2 partridge, and 7 hen pooled fecal samples collected from farms in Catalonia were also tested. All samples were collected from the ground and distributed into sterile 50-ml polyethylene containers that were kept at 4°C for less than 24 h prior to the analysis. Viral particles were concentrated from 250 mg of fecal material that was homogenized by vortexing with 2.5 ml of phosphate-buffered saline (PBS) during 2 min and centrifuged at 3,000 × g for 15 min, after which the supernatant was recovered and kept at −80°C until the nucleic acid extraction was performed.
The presence of ChPV/TuPV was also evaluated in chicken slaughterhouse raw and effluent wastewater samples (5 samples of each) and in raw and treated urban sewage (9 and 5 samples, respectively), as well as in biosolids (4 samples) from a sewage treatment plant (STP) located downstream from the slaughterhouse to prove a potential route of dissemination of these viruses into the environment. Also, 11 raw sewage samples from an STP from an area with no poultry industry were analyzed.
Viral particles were concentrated as described in previous studies (4). Nucleic acids from all viral concentrates were extracted by using the QIAmp viral RNA kit (QIAgen, Inc.) using the QIAcube automated platform.
nPCR assays based on the NS region were performed in 50-μl reaction mixtures containing 1× Gold buffer, 50 mM MgCl2, 25 mM each deoxynucleoside triphosphate, 10 μM each primer (Table 1), 2 U of AmpliTaq Gold polymerase (Applied Biosystems, Inc.), and 10 μl of DNA sample. For the nested amplification, 49-μl reaction mixtures were prepared identically and 1 μl of the first-round PCR product was added. nPCR assays targeting the VP1/VP2 regions were prepared in the same way except that all primers were used at a concentration of 25 μM (Table 1).
qPCR amplifications were performed in a 25-μl reaction mixture containing 10 μl of DNA sample and 15 μl of TaqMan environmental PCR master mix (Applied Biosystems, Foster City, CA), 0.3 μM forward primer, 0.9 μM reverse primer, and 0.25 μM fluorogenic probe (Table 1). qPCR standards were generated and used as previously described (10, 12). In our assays, the average R2 value was 0.996 ± 0.003, and the slope values ranged between −3.164 and −3.417 (mean value, −3.297). The estimated mean efficiency of the assay was 97.4%.
The specificity of the assays was studied by testing a wide selection of samples: 3 raw porcine and 3 bovine slaughterhouse sewage samples, 9 pooled duck fecal samples of Anas platirhyncos and 8 of Cairina moschata, 14 seagull samples of Larus michahellis and 11 of Larus audouinii, 2 feline parvovirus attenuated vaccines (Felocell 4 [Pfizer] and PureVax RcPch FelV), 1 canine parvovirus attenuated vaccine (Eurican CHPPI2-LR), and porcine parvovirus viral particles obtained by cell culturing. Raw hospital sewage samples containing exclusively human fecal/urine contamination and serum samples containing human parvovirus B19 were also tested. None of the samples tested provided amplification with any of the assays developed.
ChPV/TuPV were detected in 73% of pooled chicken stool samples from the different geographical areas tested, with a mean value of 9.07 × 108 genome copies (GC)/g. No differences in the percentages of positive samples attributable to the number of animals represented in the pooled samples or to the geographic origin were observed. The viruses were also detected in turkey and partridge feces. All chicken slaughterhouse raw wastewater samples and 80% of slaughterhouse treated wastewater tested positive. The mean concentration of the virus in raw wastewater obtained from the slaughterhouse was 4.63 × 105 GC/ml. Forty-four percent of downstream raw urban sewage samples and 75% of the biosolids produced in this STP tested positive, with mean values of 2.65 × 102 GC/ml and 1.29 × 105 GC/g, respectively. Interestingly, none of the samples collected in a STP in an area that was not identified as receiving effluent from the poultry industry tested positive by the assays developed here (Tables 2 and 3).
Table 2.
Detection of chicken/turkey parvoviruses in avian feces and in environmental samples by nPCR of the NS region
| Source of sample | No. of positive samples/total no. of samples | % positive |
|---|---|---|
| Chicken feces | 22/30 | 73 |
| Catalonia | 8/10 | 80 |
| Basque Country | 2/7 | 29 |
| Greece | 6/7 | 86 |
| Hungary | 6/6 | 100 |
| Hen feces | 5/7 | 72 |
| Turkey feces | 3/3 | 100 |
| Partridge feces | 1/2 | 50 |
| Duck feces | 0/17 | 0 |
| Seagull feces | 0/25 | 0 |
| Chicken slaughterhouse raw wastewater | 5/5 | 100 |
| Chicken slaughterhouse treated wastewater | 4/5 | 40 |
| Urban raw wastewater with poultry industry affluents | 4/9 | 44 |
| Urban raw wastewater without poultry industry affluents | 0/11 | 0 |
| Urban treated wastewater | 0/5 | 0 |
| Urban biosolids | 3/4 | 7 |
Table 3.
Quantification of chicken/turkey parvoviruses in different types of environmental samples
| Type of sample | No. of samples | % positive | Mean value | Range |
|---|---|---|---|---|
| Chicken feces | 21 | 81 | 9.07 × 108 GC/g | 1.97 × 102–1.07 × 1010 GC/g |
| Slaughterhouse raw wastewater | 3 | 100 | 4.63 × 105 GC/ml | 1.90 × 105–8.14 × 105 GC/ml |
| Urban raw wastewater | 2 | 50 | 2.65 × 102 GC/ml | 2.65 × 102 GC/ml |
| Urban biosolids | 2 | 100 | 1.29 × 105 GC/g | 1.07 × 105–1.51 × 105 GC/g |
Nucleotide sequences were obtained from VP1/VP2 nPCR assay amplicons and compared to sequences already available in GenBank (6). Intrasample variability ranging from 96.4 to 100% was observed by cloning one of the amplicons obtained and studying the sequences of 9 clones.
Phylogenetic analysis showed that the sequence grouping could not be associated with geographical origin or sample type. All sequences studied were similar to previously reported sequences, with similarity values ranging between 85 and 100% (Table 4).
Table 4.
Typification and diversity of the chicken/turkey parvovirus strains identified by sequencing the amplicons obtained from the analyzed samples
| Sample (GenBank accession no.) | Type of sample | Geographic origin | Genomic regiona | % similarity to indicated virusb (geographic origin) |
|---|---|---|---|---|
| CT-Par1 (JX434399) | Turkey feces | Catalonia | NS | 97, TuPV 1078 (USA) |
| CT-Par2 (JX434400) | Chicken feces | Catalonia | NS | 95, TuPV 260 (USA) |
| CT-Par3 (JX434401) | Chicken feces | Catalonia | NS | 95, TuPV 260 (USA) |
| CT-Par4 (JX434402) | Chicken feces | Catalonia | NS | 95, TuPV 260 (USA) |
| CT-Par5 (JX434403) | Slaughterhouse sewage | Catalonia | NS | 97, TuPV 260 (USA); 96, ChPV ABU-P1 (Hungary) |
| CT-Par6 (JX434404) | Slaughterhouse sewage | Catalonia | NS | 96, TuPV 260 (USA); 96, ChPV ABU-P1 (Hungary) |
| CT-Par7 (JX434405) | Slaughterhouse sewage | Catalonia | NS | 98, ChPVABU-P1 (Hungary); 97, TuPV 260 (USA) |
| CT-Par8 (JX434406) | Slaughterhouse sewage | Catalonia | NS | 94, TuPV 260 (USA); 93, ChPV ABU-P1 (Hungary) |
| CT-Par9 (JX434407) | Urban sewage | Catalonia | NS | 97, ChPVABU-P1 (Hungary); 97, TuPV 260 (USA) |
| CT-Par10 (JX434408) | Urban sewage | Catalonia | NS | 98, ChPVABU-P1 (Hungary); 97, TuPV 260 (USA) |
| CT-Par11 (JX434409) | Urban sewage | Catalonia | NS | 98, ChPVABU-P1 (Hungary); 97, TuPV 260 (USA) |
| CT-Par12 (JX434410) | Chicken feces | Hungary | NS | 94, TuPV 260 (USA); 94, ChPV ABU-P1 (Hungary) |
| CT-Par13 (JX434411) | Chicken feces | Hungary | NS | 93, TuPV 260 (USA); 92, ChPV ABU-P1 (Hungary) |
| CT-Par14 (JX434412) | Chicken feces | Hungary | NS | 94, TuPV 260 (USA); 93, ChPV ABU-P1 (Hungary) |
| CT-Par1 (JX434386) | Turkey feces | Catalonia | V1/VP2 | 98, TuPV 1078 (USA) |
| CT-Par7 (JX434387) | Chicken feces | Catalonia | VP1/VP2 | 97, TuPV 260 (USA); 97, ChPV ABU-P1 (Hungary) |
| CT-Par8 (JX434388) | Chicken feces | Catalonia | VP1/VP2 | 95, TuPV 260 (USA); 95, ChPV ABU-P1 (Hungary) |
| CT-Par9 (JX434389) | Chicken feces | Catalonia | VP1/VP2 | 94, TuPV 260 (USA); 94, ChPV ABU-P1 (Hungary) |
| CT-Par10 (JX434390) | Chicken feces | Catalonia | VP1/VP2 | 95, TuPV 260 (USA); 95, ChPV ABU-P1 (Hungary) |
| CT-Par11 (JX434391) | Chicken feces | Catalonia | VP1/VP2 | 95, TuPV 260 (USA); 95, ChPV ABU-P1 (Hungary) |
| CT-Par12 (JX434392) | Slaughterhouse sewage | Catalonia | VP1/VP2 | 98, ChPVABU-P1 (Hungary) |
| CT-Par14 (JX434393) | Slaughterhouse sewage | Catalonia | VP1/VP2 | 99, ChPV ABU-P1 (Hungary) |
| CT-Par15 (JX434394) | Chicken feces | Basque Country | VP1/VP2 | 99, ChPV ABU-P1 (Hungary) |
| CT-Par16 (JX434395) | Chicken feces | Basque Country | VP1/VP2 | 99, ChPV ABU-P1 (Hungary) |
| CT-Par17 (JX434396) | Chicken feces | Greece | VP1/VP2 | 99, ChPV ABU-P1 (Hungary) |
| CT-Par18 (JX434397) | Chicken feces | Greece | VP1/VP2 | 99, ChPV ABU-P1 (Hungary) |
| CT-Par19 (JX434398) | Chicken feces | Hungary | VP1/VP2 | 100, ChPV ABU-P1 (Hungary) |
NS, nonstructural protein; VP1, virion protein 1; VP2, virion protein 2.
ChPVABU-P1, chicken parvovirus ABU-P1 (GenBank accession number GU214704.1); TuPV 260, turkey parvovirus 260 (GU214706.1); TuPV 1078, turkey parvovirus 1078 (GU214705.1).
The assays designed here have proved to be useful for the specific detection and quantification of poultry fecal contamination, for evaluating their dissemination within the environment, and for discriminating poultry pollution from many other sources of fecal contamination potentially present in urban wastewater. Further studies for determining the presence of ChPV/TuPV in environmental samples susceptible of receiving poultry contamination via polluted water or as a consequence of the application of polluted biosolids may be conducted by applying the tools developed here.
ACKNOWLEDGMENTS
The research described in the manuscript was supported by the Ministry of Education and Science of the Spanish government (AGL2008-05275-C03-01) and a collaborative European project coordinated by David Kay and Peter Wyn-Jones from the University of Aberystwyth, United Kingdom (VIROCLIME, contract no. 243923). During the development of this study, Anna Carratalà was supported by a fellowship from the Spanish Ministry of Science.
We are thankful to Elisabet Arantegui, Núria Vidal, and Anna Bofill for their assistance in the sampling of sewage from hospitals and to Marta Cerdà for her assistance in the sampling of seagull feces. We thank Juan Bécares and Marina Rodriguez for providing seagull and duck fecal samples and Susana Guix and Annika Allard for providing porcine parvovirus and parvovirus-positive human serum samples, respectively. We are also grateful to Eva Torrecillas and Fernando Cabello for their help in the sampling of urban wastewater. Finally, we thank the Serveis Científico-Tècnics of the University of Barcelona for their efficient sequencing services and the Agència Catalana de l'Aigua (ACA) for kindly providing wastewater samples from one of their wastewater treatment facilities.
Footnotes
Published ahead of print 17 August 2012
REFERENCES
- 1. Altekruse SF, Cohen ML, Swerdlow DL. 1997. Emerging foodborne diseases. Emerg. Infect. Dis. 3:285–293 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Baker-Austin C, Rangdale R, Lowther J, Lees DN. 2010. Application of mitochondrial DNA analysis for microbial source tracking purposes in shellfish harvesting waters. Water Sci. Technol. 61:1–7 [DOI] [PubMed] [Google Scholar]
- 3. Bidin M, Lojkić I, Bidin Z, Tiljar M, Majnarić D. 2011. Identification and phylogenetic diversity of parvovirus circulating in commercial chicken and turkey flocks in Croatia. Avian Dis. 55:693–696 [DOI] [PubMed] [Google Scholar]
- 4. Bofill-Mas S, et al. 2006. Quantification and stability of human adenoviruses and polyomavirus JCPyV in wastewater matrices. Appl. Environ. Microbiol. 72:7894–7896 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Carter MJ. 2005. Enterically infecting viruses: pathogenicity, transmission and significance for food and waterborne infection. J. Appl. Microbiol. 98:1354–1380 [DOI] [PubMed] [Google Scholar]
- 6. Day JM, Zsak L. 2010. Determination and analysis of the full-length chicken parvovirus genome. Virology 399:59–64 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Gerba CP, Goyal SM, LaBelle RL, Cech I, Bodgan GF. 1979. Failure of indicator bacteria to reflect the occurrence of enteroviruses in marine waters. Am. J. Public Health 69:1116–1119 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Guan Y, et al. 2000. H9N2 influenza viruses possessing H5N1-like internal genomes continue to circulate in poultry in southeastern China. J. Virol. 74:9372–9380 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Hernroth BE, Conden-Hansson AC, Rehnstam-Holm AS, Girones R, Allard AK. 2002. Environmental factors influencing human viral pathogens and their potential indicator organisms in the blue mussel, Mytilus edulis: the first Scandinavian report. Appl. Environ. Microbiol. 68:4523–4533 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Hundesa A, et al. 2010. Development of a quantitative PCR assay for the quantitation of bovine polyomavirus as a microbial source-tracking tool. J. Virol. Methods 163:385–389 [DOI] [PubMed] [Google Scholar]
- 11. Hundesa A, Maluquer de Motes C, Bofill-Mas S, Albinana-Gimenez N, Girones R. 2006. Identification of human and animal adenoviruses and polyomaviruses for determination of sources of fecal contamination in the environment. Appl. Environ. Microbiol. 72:7886–7893 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Hundesa A, et al. 2009. Development of a qPCR assay for the quantification of porcine adenoviruses as an MST tool for swine fecal contamination in the environment. J. Virol. Methods 158:130–135 [DOI] [PubMed] [Google Scholar]
- 13. Layton BA, Walters SP, Lam LH, Boehm AB. 2010. Enterococcus species distribution among human and animal hosts using multiplex PCR. J. Appl. Microbiol. 109:539–547 [DOI] [PubMed] [Google Scholar]
- 14. Maluquer de Motes C, Clemente-Casares P, Hundesa A, Martin M, Girones R. 2004. Detection of bovine and porcine adenoviruses for tracing the source of fecal contamination. Appl. Environ. Microbiol. 70:1448–1454 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Mani B, et al. 2007. Molecular mechanism underlying B19 virus inactivation and comparison to other parvoviruses. Transfusion 47:1765–1774 [DOI] [PubMed] [Google Scholar]
- 16. Reference deleted.
- 17. Muniesa M, Payan A, Moce-Llivina L, Blanch AR, Jofre J. 2009. Differential persistence of F-specific RNA phage subgroups hinders their use as single tracers for faecal source tracking in surface water. Water Res. 43:1559–1564 [DOI] [PubMed] [Google Scholar]
- 18. Palade EA, et al. 2011. High prevalence of turkey parvovirus in turkey flocks from Hungary experiencing enteric disease syndromes. Avian Dis. 55:468–475 [DOI] [PubMed] [Google Scholar]
- 19. Palade EA, et al. 2011. Naturally occurring parvoviral infection in Hungarian broiler flocks. Avian Pathol. 40:191–197 [DOI] [PubMed] [Google Scholar]
- 20. Pina S, Puig M, Lucena F, Jofre J, Girones R. 1998. Viral pollution in the environment and in shellfish: human adenovirus detection by PCR as an index of human viruses. Appl. Environ. Microbiol. 64:3376–3382 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Rzezutka A, Cook N. 2004. Survival of human enteric viruses in the environment and food. FEMS Microbiol. Rev. 28:441–453 [DOI] [PubMed] [Google Scholar]
- 22. Sauerbrei A, Wutzler P. 2009. Testing thermal resistance of viruses. Arch. Virol. 154:115–119 [DOI] [PubMed] [Google Scholar]
- 23. Tarasiuk K, Wozniakowski G, Samorek-Salamonowicz E. 2012. Occurrence of chicken parvovirus infection in Poland. Open Virol. J. 6:7–11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Zsak L, Strother KO, Day JM. 2009. Development of a polymerase chain reaction procedure for detection of chicken and turkey parvoviruses. Avian Dis. 53:83–88 [DOI] [PubMed] [Google Scholar]