Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2012 Oct;86(19):10896–10897. doi: 10.1128/JVI.01749-12

Complete Genome Sequence Analysis of a Recent Chicken Anemia Virus Isolate and Comparison with a Chicken Anemia Virus Isolate from Human Fecal Samples in China

Xinheng Zhang a, Qingmei Xie a,✉, Jun Ji a, Shuang Chang b, Jun Liu a, Feng Chen a, Jingyun Ma a, Yingzuo Bee a
PMCID: PMC3457313  PMID: 22966189

Abstract

A new isolate of chicken anemia virus (CAV) was designated GD-1-12. GD-1-12 was isolated from a 12-day-old commercial broiler in Guangdong province, China, in 2012. The GD-1-12 CAV caused high mortality, severe anemia, thymic atrophy, and subcutaneous hemorrhage in commercial broilers. Here, we report the complete genome sequence of GD-1-12 CAV and comparison with the complete genome sequence of another CAV that was isolated from human fecal samples in China (GenBank accession no. JQ690762). The genomes of the two CAV isolates shared high homology, although a deletion was identified by comparison. The findings from this study provide additional insights into the molecular characteristics of the CAV genomes and should advance knowledge for continuous monitoring and, perhaps, preventing the spread of the virus in chickens as well as in humans.

GENOME ANNOUNCEMENT

Chicken anemia virus (CAV) belongs to the Gyrovirus genus in the Circoviridae family. CAV is a nonenveloped, icosahedral virus with a negative-sense, single-stranded circular DNA genome of about 2,298 to 2,319 nucleotides (nt) in length. The CAV genome contains three partially overlapping reading frames that encode three viral proteins, VP1, VP2, and VP3, respectively (1–4, 6, 10). A new strain of CAV, designated GD-1-12, was isolated from a 12-day-old commercial broiler in Guangdong province, China, in 2012. GD-1-12 CAV caused increasing mortality, severe anemia, lymphoid atrophy, pale bone marrows, and subcutaneous hemorrhage in commercial broilers. The whole genome of the GD-1-12 isolate was amplified and cloned into the pMD19-T vector (TaKaRa Bio Inc., Japan) followed by sequencing three times using an ABI 3730 Sanger-based genetic analyzer (Carlsbad, CA). The DNA sequences were assembled using DNAStar (version 7; Madison, WI). Multiple-sequence alignment was performed with Clustal X (BioEdit version 7). A phylogenetic tree was constructed for genome sequences using the MEGA 5.1 program (9).

The complete genome sequence of the GD-1-12 isolate was 2,298 nt long, very close to the genome size (2,316 nt) of the CAV isolate from human fecal samples (accession no. JQ690762). Sequence identities between the genome of the GD-1-12 isolate and the genomes of 74 reported CAV isolates from GenBank ranged from 94.0 to 98.9%, 98.8 to 99.8%, and 98.9 to 100% for VP1, VP2, and VP3, respectively. The sequence identities between the GD-1-12 isolate and the isolate from human fecal samples were 97.0%, 99.4%, and 99.7% for VP1, VP2, and VP3, respectively. Despite the high homology, the GD-1-12 isolate's genome at position 183 has a 21-nt deletion (TCCGTACAGGGGGGTACGTCA) in comparison with the genome (accession no. JQ690762) of the CAV isolate from human fecal samples. It is unclear if the 21-nt deletion is related to host specificity or pathogenicity. Phylogenetic analysis showed that the GD-1-12 isolate and the isolate from the human fecal samples were both clustered into genotype group A (5). Further comparison showed that motif 394 in VP1 of the GD-1-12 isolate was glutamine (Q), suggesting that the GD-1-12 isolate is highly pathogenic, as is the isolate from the human fecal samples (10). The hypervariable region (positions 139 to 144) in VP1 differed between the GD-1-12 isolate and the isolate from the human fecal samples. The peptide sequences were QSQAAQ and KSQAAE for the former and latter isolates, respectively. The difference in the hypervariable region suggests that the GD-1-12 isolate may differ from the CAV isolate from the human fecal samples in spread speed (7). Our data indicated that the CAV isolated from the human fecal samples in China was highly likely to have originated from chickens, which is in good agreement with reports by Sauvage et al. (8). We believe that the ability of CAV to spread to humans may have to be fully investigated wherever feasible.

Nucleotide sequence accession number.

The complete genome sequence of GD-1-12 CAV was submitted to GenBank and was assigned the accession number JX260426.

ACKNOWLEDGMENTS

This work was supported by a grant (2009B020201008) from Guangdong Momentously Scientific and Technological Project and a grant (2010B090301019) from Strategic Cooperation Project of Guangdong Province and Chinese Academy.

REFERENCES

  • 1. Alexandersen S, Carpenter S. 1991. Characterization of variable regions in the envelope and S3 open reading frame of equine infectious anemia virus. J. Virol. 65:4255–4262 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Claessens JA, Schrier CC, Mockett AP, Jagt EH, Sondermeijer PJ. 1991. Molecular cloning and sequence analysis of the genome of chicken anaemia agent. J. Gen. Virol. 72:2003–2006 [DOI] [PubMed] [Google Scholar]
  • 3. Craig MI, et al. 2009. Molecular characterization of chicken infectious anemia virus circulating in Argentina during 2007. Avian Dis. 53:331–335 [DOI] [PubMed] [Google Scholar]
  • 4. Crowther RA, Berriman JA, Curran WL, Allan GM, Todd D. 2003. Comparison of the structures of three circoviruses: chicken anemia virus, porcine circovirus type 2, and beak and feather disease virus. J. Virol. 77:13036–13041 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Eltahir YM, Qian K, Jin W, Wang P, Qin A. 2011. Molecular epidemiology of chicken anemia virus in commercial farms in China. Virol. J. 8:145 doi:10.1186/1743-422X-8-145 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Kim HR, Kwon YK, Bae YC, Oem JK, Lee OS. 2010. Molecular characterization of chicken infectious anemia viruses detected from breeder and broiler chickens in South Korea. Poult. Sci. 89:2426–2431 [DOI] [PubMed] [Google Scholar]
  • 7. Renshaw RW, et al. 1996. A hypervariable region in VP1 of chicken infectious anemia virus mediates rate of spread and cell tropism in tissue culture. J. Virol. 70:8872–8878 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Sauvage V, et al. 2011. Identification of the first human gyrovirus, a virus related to chicken anemia virus. J. Virol. 85:7948–7950 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Tamura K, et al. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28:2731–2739 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Yamaguchi S, et al. 2001. Identification of a genetic determinant of pathogenicity in chicken anaemia virus. J. Gen. Virol. 82:1233–1238 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES