The WalKR System Controls Major Staphylococcal Virulence Genes and Is Involved in Triggering the Host Inflammatory Response

Aurélia Delauné; Sarah Dubrac; Charlène Blanchet; Olivier Poupel; Ulrike Mäder; Aurélia Hiron; Aurélie Leduc; Catherine Fitting; Pierre Nicolas; Jean-Marc Cavaillon; Minou Adib-Conquy; Tarek Msadek

doi:10.1128/IAI.00195-12

. 2012 Oct;80(10):3438–3453. doi: 10.1128/IAI.00195-12

The WalKR System Controls Major Staphylococcal Virulence Genes and Is Involved in Triggering the Host Inflammatory Response

Aurélia Delauné ^a,^b, Sarah Dubrac ^a,^b, Charlène Blanchet ^c, Olivier Poupel ^a,^b, Ulrike Mäder ^d, Aurélia Hiron ^a,^b, Aurélie Leduc ^e, Catherine Fitting ^c, Pierre Nicolas ^e, Jean-Marc Cavaillon ^c, Minou Adib-Conquy ^c, Tarek Msadek ^a,^b,^✉

Editor: A Camilli

PMCID: PMC3457574 PMID: 22825451

Abstract

The WalKR two-component system is essential for the viability of Staphylococcus aureus, playing a central role in controlling cell wall metabolism. We produced a constitutively active form of WalR in S. aureus through a phosphomimetic amino acid replacement (WalR^c, D55E). The strain displayed significantly increased biofilm formation and alpha-hemolytic activity. Transcriptome analysis was used to determine the full extent of the WalKR regulon, revealing positive regulation of major virulence genes involved in host matrix interactions (efb, emp, fnbA, and fnbB), cytolysis (hlgACB, hla, and hlb), and innate immune defense evasion (scn, chp, and sbi), through activation of the SaeSR two-component system. The impact on pathogenesis of varying cell envelope dynamics was studied using a murine infection model, showing that strains producing constitutively active WalR^c are strongly diminished in their virulence due to early triggering of the host inflammatory response associated with higher levels of released peptidoglycan fragments. Indeed, neutrophil recruitment and proinflammatory cytokine production were significantly increased when the constitutively active walR^c allele was expressed, leading to enhanced bacterial clearance. Taken together, our results indicate that WalKR play an important role in virulence and eliciting the host inflammatory response by controlling autolytic activity.

INTRODUCTION

Staphylococcus aureus is highly adept at leading dual but seemingly opposing lifestyles, with the transition between the two still poorly understood. As a commensal, it asymptomatically colonizes the anterior nares of more than a third of the human population (68), and yet once it has breached epidermal or epithelial barriers, it is also a major Gram-positive pathogen, causing infections affecting practically every host organ (42). Much of the success of this remarkably versatile pathogen stems from the unique adaptive potential conferred by its sophisticated arsenal of secreted or cell envelope-associated virulence and innate immune defense evasion factors (17, 42, 53).

Host-pathogen interactions are mediated by specific interactions between pathogen-associated molecular patterns (PAMPs) such as lipoproteins or peptidoglycan (PGN) and pattern recognition receptors such as TLR2 or NOD2, leading to production of proinflammatory cytokines and chemokines recruiting immune cells to the infection site (18, 46). The importance of the bacterial cell envelope in the host inflammatory response cannot be overstated: it is the first layer of contact between the bacterium and its host, containing PGN, lipoproteins, and cell wall-associated virulence factors acting as PAMPs; it is also the first and major bacterial line of defense against external threats and is both the target of choice for antibiotic treatment and the source of many resistance pathways.

Among the 16 two-component systems (TCS) present in S. aureus (38), SaeSR and AgrCA play important roles in controlling virulence and innate immune system evasion genes (21, 48), and the WalKR system (also known as YycGF) controls cell wall metabolism and is essential for cell viability (12, 13).

In the present study, we set out to determine the full extent of the S. aureus WalKR regulon by transcriptome analysis, aiming to gain insight into the role of this system in host-pathogen interactions. Because its essential nature has hampered classical genetic analysis, previous studies have used conditional lethal mutations, with either thermosensitive alleles or inducible promoters allowing programmed depletion of the WalKR proteins (13, 44). We show here, by producing a constitutively active form of the WalR response regulator (D55E), that it controls several major staphylococcal virulence genes. The impact of WalKR activity on pathogenesis and the innate immune response was studied using a murine infection model and in human blood, showing that this system plays an important role in virulence through triggering of the host inflammatory response.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

Escherichia coli K-12 strain DH5α (Invitrogen Life Technologies) was used for cloning experiments. Staphylococcus aureus strain HG001 (25) was used for all genetic and pathogenesis studies. S. aureus strains and plasmids are listed in Table 1. E. coli was grown in Luria-Bertani medium with ampicillin (100 μg/ml) added when required. S. aureus was grown in tryptic soy broth (TSB; Difco) supplemented with erythromycin (1 μg/ml) when needed. Cadmium chloride (CdCl₂) was added at a final concentration of 0.25 μM to induce expression from the Pcad promoter. Bacterial growth was carried out in microtiter plates (100-μl culture volume) in a Synergy 2 plate reader using Gen5 microplate software (BioTek Instruments, Inc., Winooski, VT).

Table 1.

S. aureus strains and plasmids used in this study

Strain or plasmid	Description	Source, reference, or construction^a
Strains
RN4220	Restriction-deficient transformation recipient strain	36
HG001	NCTC 8325 rsbU⁺	25
ST1033	HG001/pCN51	pCN51 → HG001
ST1034	HG001/pSD3-12	pSD3-12 → HG001
ST1035	HG001/pSD3-14	pSD3-14 → HG001
ST1160	HG001 ΔsaeRS	pMAD TCS6AD → HG001
ST1161	HG001 ΔsaeRS/pCN51	pCN51 → ST1160
ST1162	HG001 ΔsaeRS/pSD3-12	pSD3-12 → ST1160
Plasmids
pCN51	Vector for CdCl₂-dependent gene expression	8
pMAD	Allelic-exchange vector	3
pSD3-12	pCN51-walR^c	This study
pSD3-14	pCN51-walR	This study
pMAD TCS6AD	pMAD-derivative allowing deletion of the saeRS genes	61

Open in a new tab

Arrows indicate plasmid introduction by electroporation.

Plasmid and mutant construction.

Oligonucleotides used in the present study were synthesized by Sigma-Proligo and are listed in Table 2. Nucleotide sequencing was carried out by Beckman Coulter Genomics. The pCN51 vector carrying the Pcad-cadC promoter module (cadmium chloride-inducible promoter and the CadC repressor gene) was used for plasmid-based gene expression in S. aureus (8). Plasmid pMAD TCS6AD (61) was kindly provided by Iñigo Lasa (University of Pamplona, Pamplona, Spain) and used to generate a markerless saeRS deletion in S. aureus strain HG001 as previously described (3). In the resulting ΔsaeRS mutant, codon 153 of the upstream saeQ gene is fused in frame to the last three codons of saeS, removing the entire coding sequence of saeR and the first 348 codons of saeS without the introduction of an antibiotic resistance gene. DNA fragments corresponding to the walR and the constitutively active walR^c allele coding sequences with their associated ribosome-binding sites were cloned under the control of the Pcad promoter in plasmid pCN51. The walR wild-type allele was generated by PCR using the OSA211/OSA214 oligonucleotides. Site-directed mutagenesis by strand overlap extension PCR (SOE-PCR) (26) was used to construct the walR^c mutant allele. Briefly, two DNA fragments with overlapping 3′ and 5′ ends were generated by PCR using oligonucleotide pairs OSA211/OSA212 and OSA213/OSA214. Oligonucleotides OSA212 and OSA213 are partly complementary, with an 18-base overlap. Oligonucleotide OSA212 has a single nucleotide mismatch with walR, introducing a T→G transversion at position 165 of the walR coding sequence, changing aspartate 55 codon GAT to a GAG glutamate codon. The DNA fragments were mixed in equal amounts and used for SOE-PCRs with the oligonucleotides OSA211 and OSA214, introducing BamHI and EcoRI sites at the 5′ and 3′ ends of the 775-bp DNA fragment (see Table 2 for the oligonucleotide sequences).

Table 2.

Oligonucleotides used in this study

Name	Description^a	Sequence (5′–3′)
OSA211	Generation of the walR^c allele and amplification of walR^c and walR	`AAAGGATCCAATAATATTAATGATTTAAG`
OSA212	Same as for OSA211	`TCACGACCAGGTAACATGATCTCTAGTAAT`
OSA213	Same as for OSA211	`CATGTTACCTGGTCGTGATGGTATGGA`
OSA214	Same as for OSA211	`CCACTGAATTCGTTTCGACCTCTACTCATG`
OSA238	sle1 PR (footprint)	`CCAATAGAGAAAGGGAATGTAAT`
OSA239	sle1 PR (footprint)	`GCACTTTAAAATCCTCCTCTTGCTTAAC`
OSA138	walR intragenic region (qRT-PCR)	`GTGTACTGTGCATACGATGGTAATGATGC`
OSA139	walR intragenic region (qRT-PCR)	`CGTTACATAGTCATCTGCACCTAGTTCTA`
OSA140	hla IR (qRT-PCR)	`GCCTGGCCTTCAGCCTTTAAGGTACAGTTG`
OSA141	hla IR (qRT-PCR)	`GGTTGAACATATTTCAGTGTATGACCAATC`
OSA161	16S rRNA IR (qRT-PCR)	`ACGTGGATAACCTACCTATAAGACTGGGAT`
OSA162	16S rRNA IR (qRT-PCR)	`TACCTTACCAACTAGCTAATGCAGCG`
OSA203	atlA IR (qRT-PCR)	`AACAGCACCAACGGATTAC`
OSA204	atlA IR (qRT-PCR)	`CATAGTCAGCATAGTTATTCATTG`
OSA218	lytM IR (qRT-PCR)	`AGCGAACAGTAATAACTACCAATG`
OSA219	lytM IR (qRT-PCR)	`CGATGCCACCAGACATACG`
OP291	spa IR (qRT-PCR)	`AAGTGCTAACCTATTGTCAGAAG`
OP292	spa IR (qRT-PCR)	`TCGTCTTTAAGGCTTTGGATG`
OP315	fnbA IR (qRT-PCR)	`ATGGCGTATCAACTGCTA`
OP316	fnbA IR (qRT-PCR)	`ACATCAACCTTATCTTCAATATCA`
OP317	splA IR (qRT-PCR)	`AGTATCAGCACATCATTCG`
OP318	splA IR (qRT-PCR)	`ACTATCGCAAGGTCTTCT`
OP321	hlgC IR (qRT-PCR)	`TGAGTCAGACATTAGGATAC`
OP322	hlgC IR (qRT-PCR)	`TTGTTGTTCTACTTCACTTAC`
OP323	snc IR (qRT-PCR)	`CTTGCCAACATCGAATGAATA`
OP324	snc IR (qRT-PCR)	`CATACATTGCTTTTAGACCTGAA`
OP325	chp IR (qRT-PCR)	`AATAGTGGTCTTCCTACAACA`
OP326	chp IR (qRT-PCR)	`CAGCAAGTGGTGTATTCAG`
OP327	saeP IR (qRT-PCR)	`CTAACAGGTACATTCAGTTCTAA`
OP328	saeP IR (qRT-PCR)	`GTAGTCAACCATTGCGATT`
OP329	saeR IR (qRT-PCR)	`AATACCATCATCAACCAGTT`
OP330	saeR IR (qRT-PCR)	`CTCAAATTCCTTAATACGCATA`
OP338	icaR IR (qRT-PCR)	`CGAAGAAAGGTATATTAGAATGT`
OP339	icaR IR (qRT-PCR)	`GCTATCTCTTTACTTAATGATTG`
OP342	fmtB IR (qRT-PCR)	`ATAATGGTGTGGATAATGG`
OP343	fmtB IR (qRT-PCR)	`ATTGCTAATGCTTCAGTT`
OSA224	sle1 IR (qRT-PCR)	`AAGTATCTGGCTCAAGTAATTCTAC`
OSA225	sle1 IR (qRT-PCR)	`TGATGGACGGCTACTATTGC`
OAD52	SAOUHSC_02855 IR (qRT-PCR)	`TTCTCAGCAGATTTCACTTATC`
OAD53	SAOUHSC_02855 IR (qRT-PCR)	`CATCTATTAGAAACAGGTTTACCG`

Open in a new tab

IR, intragenic region; PR, promoter region.

Bacterial autolysis assays.

Bacteria were grown in TSB with CdCl₂ (0.25 μM) at 37°C with aeration until an optical density at 600 nm (OD₆₀₀) of ∼1, pelleted (10 min; 5,400 × g), resuspended in phosphate-buffered saline (PBS), and incubated at 37°C with aeration. Lysis was determined as the decrease in OD₆₀₀ over time and is indicated as a percentage of the initial OD (measured OD₆₀₀/initial OD₆₀₀).

Biofilm formation assays.

Strains were grown overnight in TSB, diluted (1/1,000) in TSB with glucose (0.75%), NaCl (3.5%), and CdCl₂ (0.25 μM), and then distributed into microtiter plates (200 μl per well). After 24 h of incubation at 37°C, adherent biomass was stained with crystal violet, resuspended in ethanol-acetone (80:20), and quantified by measuring the OD₅₉₅, normalized to the OD₆₀₀ of each culture.

Total RNA extraction.

Bacteria were grown in TSB with CdCl₂ (0.25 μM) at 37°C with aeration until reaching an OD₆₀₀ of 1, pelleted (2 min, 20,800 × g), and frozen at −80°C. RNA extractions were then performed as previously described (14), followed by a DNase I treatment with the Turbo DNA-free reagent (Ambion, Austin, TX) to eliminate residual genomic DNA.

cDNA synthesis and quantitative real-time PCRs (qRT-PCR).

cDNAs were synthesized using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA), in a 20-μl reaction volume containing 1 μg of total RNA. Oligonucleotides were designed for 100- to 200-bp amplicons using Beacon Designer 4.02 software (Premier Biosoft International, Palo Alto, CA) (see Table 2). qRT-PCRs, critical threshold cycles (C_T), and n-fold changes in transcript levels were performed and determined as previously described (12) using the SsoFast EvaGreen Supermix (Bio-Rad, Hercules, CA) and normalized with respect to 16S rRNA, whose levels did not vary under our experimental conditions. All assays were performed using quadruplicate technical replicates and repeated with independent biological samples, with the results of one representative experiment shown.

Microarray experiments.

RNA sample preparation and the BaSysBio Sau T1 NimbleGen 385K array design were previously described (15). Tiling array experiments were carried out at Roche NimbleGen (Madison, WI) with 20 μg of each RNA sample, after conversion into Cy3-labeled cDNA using the BaSysBio protocol for strand-specific hybridization (51). All tiling array experiments were performed in triplicate using RNA isolated from independent cultures. For data analysis, an aggregated expression value was computed for each GenBank annotated CDS as the median log₂ intensity of probes lying entirely within the corresponding region. To control for possible cross-hybridization artifacts the sequence of each probe was BLAST-aligned against the whole chromosome sequence and probes with a SeqS value above the 1.5 cutoff were discarded (SeqS is 2 for a probe with two exact matches) (66).

Aggregated intensity values of the individual samples were normalized by median scaling using the Rosetta Resolver software (version 7.2.1; Rosetta Biosoftware). The statistical significance of differential expression was evaluated using the z-test (ArrayStat software package; GE Life Sciences). Differentially expressed genes were chosen with a ratio of ≥2 and a P value of ≤0.05 in at least two of the replicates. The complete MIAME compliant microarray data set is available at the NIH Gene Expression Omnibus (GEO) database under record number GSE29337 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=xxkjzyaasiyywvu&acc=GSE29337).

DNase I footprinting.

S. aureus WalR with a carboxy-terminal hexahistidine extension was produced and purified as previously described (13). A DNA fragment corresponding to the promoter region of sle1 (262 bp) was generated by PCR using oligonucleotides OSA238/OSA239 and Pwo polymerase (Roche) (see Table 2 for oligonucleotide sequences). Labeling of the nontemplate strand with [γ³²-P]ATP (Perkin-Elmer) was performed as previously described (11). WalR binding to radiolabeled DNA (5 × 10⁴ cpm per reaction), DNase I treatment, and electrophoresis were performed as previously described (11, 13).

Macrophage survival assays.

Murine macrophage RAW 264.7 cells were used for bacterial survival assays as previously described (58). The statistical significance of macrophage survival was evaluated using the Student unpaired t test (Microsoft Excel) with a P value below 0.05 considered significant.

Hemolytic activity assays.

Strains were grown in TSB with 0.25 μM CdCl₂ until reaching an OD₆₀₀ of 1, spotted onto Columbia horse blood agar plates (bioMérieux), and incubated for 24 h at 37°C (23).

Murine infection experiments.

Animal experiments described in the present study were conducted at the Institut Pasteur in compliance with the NIH Animal Welfare Insurance A5476-01 and French and European Union guidelines on handling of Laboratory Animals. Protocols were approved by the veterinary staff of the Institut Pasteur Animal Care and Use Committee. Male 8- to 12-week-old C57BL/6J mice were purchased from the Centre d'Elevage Roger Janvier, Le Genest-St.-Isle, France. For mortality measurements, mice were injected intraperitoneal (i.p.) with S. aureus at 10⁷ CFU/g of mouse body weight. The results were statistically analyzed by the log-rank (Mantel-Cox) test using GraphPad Prism 5.0d software (GraphPad Software, San Diego, CA), with a P value below 0.05 considered significant. For in vivo cytokine production, bacterial load and neutrophil/macrophage counts, mice were injected i.p. with 5 × 10⁶ CFU/g mouse body weight of S. aureus. At 1.5 and 3 h postinfection, mice were sacrificed, and peritoneal cavities were washed with 2 ml of saline (Fresenius Kabi). After CFU counts, peritoneal lavage fluids (PLFs) were centrifuged for 10 min at 300 × g at 4°C. Supernatants were filtered (0.22-μm pore size) using Spin X columns (CoStar; Corning Life Sciences, Lowell, MA) and kept at −20°C for cytokine assays. Cell pellets from PLFs were processed for cell counting. The results were statistically analyzed by the Mann-Whitney U signed-rank test using GraphPad Prism 5.0d software (GraphPad Software) with a P value below 0.05 considered significant.

Cell counting and flow cytometry.

Leukocytes in PLFs were resuspended in 180 μl of MACS buffer (PBS containing 0.5% fetal calf serum [FCS] and 2 mM EDTA) with 20 μl of mouse Fc block reagent (Miltenyi Biotec, Auburn, CA), incubated for 10 min at 4°C and divided in two. One-half was incubated for 30 min on ice in MACS buffer with an anti-F4/80 antibody coupled to Pacific Blue (Biolegend, San Diego, CA) and an anti-Gr1 antibody coupled to phycoerythrin (PE; Miltenyi Biotec). The other half was incubated with a rat IgG2b-Pacific Blue (Biolegend) and a rat IgG2b-PE (AbD Serotec, Düsseldorf, Germany) as isotype controls. The cells were then washed and resuspended in 300 μl of MACS buffer. The data were acquired on 30 μl of the cell suspension using a MACSQuant flow cytometer. Neutrophil and macrophage counts were determined by gating on Gr1-positive/F4/80-negative or F4/80-positive cells, respectively, using the MACSQuantify software. The results were statistically analyzed by the Mann-Whitney U signed-rank test using GraphPad Prism 5.0d software (GraphPad Software, San Diego, CA) with a P value below 0.05 considered significant.

Cytokine production in whole human blood.

Whole human blood from two healthy donors was collected by EFS Pitié-Salpétrière (Etablissement Français du Sang) using heparinized tubes. Bacteria were grown until reaching an OD₆₀₀ of ∼1, and filtered culture supernatants were incubated with 1 ml of human blood at a final ratio of 1:32 at 37°C and 5% CO₂ for 3 h. Tubes were shaken every 10 min. Plasma was isolated by centrifugation and stored at −20°C for cytokine assays.

Cytokine production assays.

Cytokine concentrations in mouse PLFs or human plasma were determined by enzyme-linked immunosorbent assay (ELISA) (DuoSet; R&D Systems, Minneapolis, MN). The results were statistically analyzed by the Mann-Whitney U signed-rank test using GraphPad Prism 5.0d software (GraphPad Software), with a P value below 0.05 considered significant.

PGN quantification in culture supernatants.

The silkworm larvae plasma test (33) was used to quantify PGN in supernatants, using the SLP-HS kit (Wako Pure Chemical Industries, Osaka, Japan). Briefly, 50 μl of culture supernatants was added to an equal volume of SLP-diluent reconstituted SLP reagent in a 96-well microtiter plate. After incubation for 1 h at 37°C, the OD₆₉₀ of the reaction was determined. The amount of PGN in samples was calculated according to a standard curve determined using the provided digested S. aureus PGN solution.

RESULTS

Constitutive activation of the WalR response regulator leads to increased autolysis, biofilm formation and hemolytic activity.

A constitutively active form of the WalR response regulator was generated through a phosphomimetic amino acid replacement by introducing a single point mutation into walR, changing codon 55 from aspartate to glutamate (see Materials and Methods). Response regulators are phosphorylated on a highly conserved aspartate residue within the receiver domain (62). WalR belongs to the OmpR subfamily of response regulators, where replacement of the phosphorylation site aspartate by glutamate often leads to constitutive activity (39, 57). The walR and walR^c (D55E) alleles were expressed from the Pcad cadmium chloride-inducible promoter using plasmid pCN51, and the resulting plasmids were introduced into S. aureus strain HG001.

Expression of walR was measured by qRT-PCR in cells carrying either the pCN51 empty vector, plasmid pSD3-14 (PcadwalR) or plasmid pSD3-12 (PcadwalR^c) harvested during exponential growth (OD₆₀₀ of ∼1). Transcription of walR or walR^c from the Pcad promoter was increased more than 150-fold compared to that of the chromosomal walR gene (Fig. 1). Transcription of the WalR-dependent autolysin genes atlA and lytM was moderately activated when the native walR gene was overexpressed but strongly increased in the walR^c strain (ca. 30-fold and 8-fold, respectively), indicating that the WalR^c response regulator is indeed constitutively active (Fig. 1).

Fig 1 — Constitutive WalR activity strongly increases expression of WalKR-regulated genes. The relative levels of *walR*, *walR*/*walR*^c, *atlA*, and *lytM* transcripts were measured by qRT-PCR during growth of the HG001 wild-type strain carrying either the pCN51 empty vector (strain ST1033), the pSD3-14 or pSD3-12 plasmids, respectively, expressing the *walR* or *walR*^c alleles from the Pcad promoter (strains ST1035 and ST1034). The expression levels were normalized using 16S rRNA as an internal standard and are indicated as the n-fold change with respect to the control strain (HG001/pCN51), expressed as means and standard deviations.

Overexpression of walR in S. aureus had no significant effect on the growth rate, whereas the strain with the walR^c allele consistently displayed a biphasic growth profile (Fig. 2A). Indeed, growth was temporarily arrested toward the end of the exponential phase, resuming after a short period of partial cell lysis to reach a density similar to that of the control strain (Fig. 2A). We verified that the capacity to resume growth was not due to loss of the walR^c expression plasmid or a suppressor mutation by verifying that all cells grown to stationary phase in the absence of erythromycin retained the pCN51 control plasmid or the pSD3-12 plasmid. In addition, multiple independent transformation experiments introducing the walR^c expression plasmid into either the HG001 or RN4220 strains systematically led to a biphasic growth profile. We also performed multiple growth/dilution cycles, showing that walR^c cells grown to stationary phase retained a biphasic growth profile when exiting from the exponential phase, indicating that they had undergone a transient adaptation and had not accumulated compensatory mutations allowing them to grow when WalR^c is produced (data not shown). This suggests that sustained constitutive WalR activity only becomes detrimental once cells enter stationary phase and that the bacteria are able to transiently adapt. This appears to be due to the inability of the chromosomally encoded WalK kinase to dephosphorylate the WalR^c response regulator (see Discussion and Fig. S1 in the supplemental material).

Fig 2 — Expression of the constitutive *walR*^c allele leads to increased autolysis and enhanced biofilm formation. (A) Growth curves of *S. aureus* HG001 derivatives carrying the pCN51 empty vector (strain ST1033, ○), the pSD3-14 plasmid with the wild-type *walR* gene (strain ST1035, □), or the pSD3-12 plasmid with the *walR*^c allele (strain ST1034, ■). Bacteria were grown in TSB plus 0.25 μM CdCl₂. (B) Strains carrying the pCN51 empty vector (ST1033; ○) or the pSD3-12 *walR*^c expression plasmid (ST1034; ■) were grown until reaching an OD₆₀₀ of 1. Cells were resuspended in PBS and incubated at 37°C under aeration. Autolysis was measured as the decline of OD₆₀₀ over time, indicated as a percentage of the initial OD. (C) Biofilm assays were performed in microtiter plates after growth at 37°C for 24 h (strain ST1033 [A] and strain ST1034 [B]). Adherent biomass was quantified, normalized to the OD₆₀₀ of each cell culture, and is represented as the n-fold variation compared to the control strain. Experiments were carried out in quadruplicate, and standard deviations are indicated.

Since the WalKR system controls autolysin gene expression, we tested the effect of WalR^c on autolysis: cells were grown in TSB, resuspended in PBS, and incubated at 37°C. The ODs of nongrowing cells were monitored over time, showing that the control strain had a very low autolysis rate, with >80% intact cells after 2.5 h (Fig. 2B). In contrast, the walR^c strain was highly autolytic under these nongrowing conditions with less than 20% of the cells remaining intact (Fig. 2B). WalKR positively controls biofilm formation (12) and, as shown in Fig. 2C, walR^c expression led to a much more robust biofilm, with a 7-fold increase in adherent biomass. The increased autolysis and enhanced biofilm formation of cells expressing walR^c are both consistent with the constitutive activation of WalR in this strain.

Expression profiling of the WalR regulon.

Global expression changes were compared between the control ST1033 strain (HG001/pCN51) and strain ST1034 expressing the walR^c allele (HG001/pSD3-12) using the BaSysBio Sau T1 chip, a NimbleGen tiling array covering both strands of the S. aureus NCTC 8325 genome (see Materials and Methods). Since the walR^c strain has a biphasic growth curve (Fig. 2A), we isolated RNA from culture samples at time points just before the transient cessation of growth (an OD₆₀₀ of ∼1), when the profile was identical to that of the control strain. We verified by scanning electron micrographs and by measuring DNA concentrations in culture supernatants that at this time point there was no lysis of the walR^c strain (data not shown). A total of 165 genes were found to be differentially expressed in the walR^c strain, with changes that were ≥2-fold and P values of ≤0.05 (z-test). Expression levels were increased for 108 genes and lowered for 57, with more than 80 of unknown function (Tables 3 and 4). The most strongly downregulated genes in the walR^c strain were spa and icaR, respectively, encoding staphylococcal protein A and the repressor of the icaADBC biofilm matrix biosynthesis operon (Table 4).

Table 3.

WalR^c-activated genes regulated upon walR^c expression

Functional category	NCTC 8325 ORF^a	Gene	Fold change^b	qRT-PCR confirmation (source or reference)	Description or predicted function
Cell wall metabolism	00248	lytM	3.9	12, 13	Glycyl-glycyl endopeptidase
	00427	sle1	4.1	This study	N-Acetylmuramoyl-l-alanine amidase
	00671		4.0	12	CHAP domain-containing protein
	00773		2.6	12	CHAP domain-containing protein
	00994	atlA	3.5	12	Bifunctional autolysin
	00998	fmtA	2.0		Autolysis and methicillin resistance-related protein
	02404	fmtB	3.3	This study	Methicillin resistance determinant FmtB protein
	02571	ssaA	2.9	12, 13	CHAP domain-containing protein
	02576		10.0	12	CHAP domain-containing protein
	02855		7.2	This study	CHAP domain-containing protein
	02883		3.2	12	CHAP domain-containing protein
Regulatory pathways	00020	walR	8.4	This study	Response regulator
	00314		2.0		MarR family transcriptional regulator
	00714^*	saeS	3.3		Sensor histidine kinase
	00715^*	saeR	4.8	This study	Response regulator
	00716^*	saeQ	5.2		Hypothetical protein
	00717^*	saeP	7.1	This study	Hypothetical protein
	01045		2.0		XRE transcriptional regulator family
	01685	hrcA	2.2		Heat-inducible transcription repressor
	03027		2.2		PadR transcriptional regulator family
Host interaction	00192^*	coa	7.1		Staphylocoagulase precursor
	00813		3.1		Secreted von Willebrand factor-binding protein
	00814		4.4		Secreted von Willebrand factor-binding protein
	00816^*	emp	2.3		Extracellular matrix and plasma binding protein
	01110		5.9		Fibrinogen-binding-related protein
	01114^*	efb	7.3		Fibrinogen-binding protein
	01121^*	hla	9.9	This study	Alpha-hemolysin precursor
	01935^*	splF	7.2		Serine protease
	01936^*	splE	7.7		Serine protease
	01938^*	splD	6.9		Serine protease
	01939^*	splC	8.1		Serine protease
	01941^*	splB	11.3		Serine protease
	01942^*	splA	10.4	This study	Serine protease
	02161		8.9		MHC class II analog protein
	02163^*	hlb	12.1		Truncated beta-hemolysin
	02167^*	snc	4.8	This study	Complement inhibitor SCIN
	02169^*	chp	16.5	This study	Chemotaxis-inhibiting protein CHIPS
	02243		11.4		Leukocidin/hemolysin family protein
	02706^*	sbi	11.7		Immunoglobulin G-binding protein
	02708^*	hlgA	2.6		Gamma-hemolysin component A
	02709^*	hlgC	23.5	This study	Gamma-hemolysin component C
	02710^*	hlgB	16.4		Gamma-hemolysin component B
	02802^*	fnbB	4.1		Fibronectin binding protein B
	02803^*	fnbA	4.3	This study	Fibronectin-binding protein A
Stress response	00503		2.2		UvrB/UvrC motif-containing protein
	00507	radA	2.7		DNA repair protein
	00912	clpB	2.6		ATPase unit of an ATP-dependent Clp protease
	01682	dnaJ	2.3		Chaperone protein
	01684	grpE	2.3		Heat shock protein
	02111		2.2		DNA polymerase IV
Transport	00060		2.1		Putative Na⁺/P_i-cotransporter protein
	00143		2.1		Putative transporter protein
	00420		2.2		Putative sodium-dependent transporter
	01046		2.3		Spermidine/putrescine ABC transporter
	01746		2.5		Bifunctional translocase subunit SecD/SecF
	01972	prsA	2.0		Putative export protein
	01991		2.6		Amino acid ABC transporter, permease
Metabolism	00300		5.0		Lipase precursor
	00897		3.4		Glycerophosphoryl diester phosphodiesterase
	01166	pyrB	3.1		Aspartate carbamoyltransferase catalytic subunit
	01168	pyrC	3.4		Dihydroorotase
	01169	carA	3.4		Carbamoyl phosphate synthase small subunit
	01170	carB	3.4		Carbamoyl phosphate synthase large subunit
	01171	pyrF	3.8		Orotidine 5-phosphate decarboxylase
	01172	pyrE	3.1		Orotate phosphoribosyltransferase
	01451	ilvA1	3.2		Threonine dehydratase
Other	00188	pflA	2.0		Pyruvate formate-lyase 1 activating enzyme, putative
	00399	set	2.9		Superantigen-like protein
	00429		3.0		Putative Mut/NUDIX family protein
	01681	prmA	2.0		Ribosomal protein L11 methyltransferase
	01992		3.1		Phosphotransferase domain-containing protein
Unknown function	00144		2.4		Hypothetical protein
	00182		2.4		Hypothetical protein
	00191		6.5		Hypothetical protein
	00303		2.2		Hypothetical protein
	00354		3.0		Putative enterotoxin
	00401		2.4		Hypothetical protein
	00430		3.1		Hypothetical protein
	00508		2.3		Hypothetical protein
	00561		5.9		Hypothetical protein
	00704		3.0		Hypothetical protein
	01101		2.8		Hypothetical protein
	01112		3.9		Hypothetical protein
	01113		2.9		Hypothetical protein
	01115		10.2		Hypothetical protein
	01221		2.6		Hypothetical protein
	01450		2.3		Putative amino acid permease
	01721		2.0		Hypothetical protein
	01733		2.3		Hypothetical protein
	01760		3.8		Hypothetical protein
	01761		6.0		Hypothetical protein
	01895		2.1		Hypothetical protein
	01917		5.2		Hypothetical protein
	01918		2.3		Hypothetical protein
	01919		2.4		Hypothetical protein
	01944		2.1		Hypothetical protein
	02109		2.8		Hypothetical protein
	02112		5.8		Hypothetical protein
	02164		3.1		Hypothetical protein
	02165		2.1		Hypothetical protein
	02241		10.2		Hypothetical protein
	02257		5.6		Hypothetical protein
	02266		2.0		Hypothetical protein
	02445		3.7		Hypothetical protein
	02611		3.5		Hypothetical protein
	02657		2.3		Hypothetical protein
	02702		3.5		Hypothetical protein
	02872		13.8		Hypothetical protein

Open in a new tab

*, Genes known or predicted to be controlled by the SaeSR TCS. Gene names correspond to the annotation of the S. aureus NCTC 8325 genome sequence SAOUHSC_ (20).

Fold change was determined as the ratio of the signal values between strain HG001 expressing walR^c and the control stran carrying the empty vector pCN51.

Table 4.

WalR^c-repressed genes regulated upon walR^c expression

Functional category	NCTC 8325 ORF	Gene^a	Fold change^b	qRT-PCR confirmation (source or reference)	Description or predicted function
Regulatory pathways	00070	sarS	0.395		Staphylococcal accessory regulator-like protein
	02799	sarT	0.455		Staphylococcal accessory regulator T
	03001	icaR	0.288	This study	ica operon transcriptional regulator
Host interaction	00069	spa	0.120	This study	Protein A
Stress response	02862	clpC	0.434		ATP-dependent Clp protease
Transport	00556		0.438		Proline/betaine transporter, putative
	02444		0.378		Glycine/betaine transporter, putative
	02753		0.435		ABC transporter, permease protein, putative
	02754		0.389		ABC transporter, ATP-binding protein, putative
Metabolism	02403		0.443		Mannitol-1-phosphate 5-dehydrogenase
	02468		0.488		Acetolactate synthase, putative
	02830		0.399		d-Lactate dehydrogenase
Phage-related proteins	00624		0.492		Integrase/recombinase, putative
	02083		0.497		Bacteriophage l54a, Cro-related protein
Unknown function	00065		0.461		Conserved hypothetical protein
	00094		0.130		Conserved hypothetical protein
	00134		0.386		Conserved hypothetical protein
	00285		0.436		Conserved hypothetical protein
	00356		0.248		Conserved hypothetical protein
	00428		0.352		Conserved hypothetical protein
	00431		0.476		Conserved hypothetical protein
	00553		0.491		Conserved hypothetical protein
	00617		0.325		Conserved hypothetical protein
	00619		0.327		Conserved hypothetical protein
	00674		0.447		Conserved hypothetical protein
	00689		0.455		Conserved hypothetical protein
	00690		0.437		Conserved hypothetical protein
	00712		0.469		Conserved hypothetical protein
	00736		0.429		Conserved hypothetical protein
	00820		0.470		Conserved hypothetical protein
	00821		0.458		Conserved hypothetical protein
	00831		0.429		Conserved hypothetical protein
	00977		0.450		Conserved hypothetical protein
	01024		0.450		Hypothetical protein
	01027		0.492		Conserved hypothetical protein
	01264		0.460		Conserved hypothetical protein
	01815		0.438		Conserved hypothetical protein
	02013		0.444		Conserved hypothetical protein
	02244		0.488		Conserved hypothetical protein
	02320		0.483		Conserved hypothetical protein
	02338		0.453		Conserved hypothetical protein
	02387		0.360		Conserved hypothetical protein
	02572		0.447		Conserved hypothetical protein
	02774		0.433		Conserved hypothetical protein
	02798		0.473		Conserved hypothetical protein
	02842		0.466		Conserved hypothetical protein
	02881		0.480		Conserved hypothetical protein
	02882		0.439		Conserved hypothetical protein
	02899		0.464		Conserved hypothetical protein
	02900		0.440		Conserved hypothetical protein
	02908		0.413		Conserved hypothetical protein
	02925		0.375		Conserved hypothetical protein
	02930		0.466		Conserved hypothetical protein
	02931		0.492		Conserved hypothetical protein
	02936		0.439		Conserved hypothetical protein
	02994		0.396		Conserved hypothetical protein
	03032		0.482		Conserved hypothetical protein

Open in a new tab

Gene names correspond to the annotation of the S. aureus NCTC 8325 genome sequence SAOUHSC_ (20).

Fold change was determined as the ratio of the signal values between strain HG001 expressing walR^c and the control strain carrying the empty vector pCN51.

WalR^c-dependent lowered expression was confirmed by qRT-PCR for both of these genes. As shown in Fig. 3, in contrast to strongly lowered spa expression (100-fold), icaR was only moderately repressed by the WalR^c regulator (2- to 3-fold), which is apparently not sufficient to derepress icaADBC transcription since it did not vary significantly, as shown by the transcriptome analysis (Fig. 3 and Tables 3 and 4).

Characterization of novel WalKR regulon cell wall metabolism genes.

WalKR positively control the expression of nine genes involved in cell wall degradation (12), all of which, except for isaA and sceD, showed increased expression levels in the walR^c strain (Table 3). Four additional genes known or likely to be involved in cell wall metabolism were also upregulated: sle1, encoding a CHAP-domain amidase, fmtA, fmtB, and SAOUHSC_02855 (Table 3).

As shown by qRT-PCR in Fig. 4A, expression of sle1 is increased more than 15-fold in the walR^c strain. The sle1 upstream DNA region does not contain an exact match to the WalR binding site (5′-TGTWAH N5 TGTWAH-3′) but has two direct repeats with single mismatches to the consensus operator sequence, located between positions −103 to −119 and positions −203 to −219 from the translation initiation codon (Fig. 4C). As shown by DNase I footprinting assays, WalR bound specifically to this region, protecting two areas extending from positions −95 to −126 and from positions −196 to −220, encompassing the two repeats and confirming they are bona fide WalR binding sites (Fig. 4B and C).

The SAOUHSC_02855 gene encodes a potential CHAP domain amidase. As shown in Fig. 4A, expression of SAOUHSC_02855 is activated ∼15-fold by WalR^c, and a potential WalR binding site is located between positions −97 and −113 upstream from the translation start site (see Fig. 4C), suggesting it may also be directly activated by WalR.

fmtA and fmtB encode proteins thought to confer high levels of methicillin resistance (16, 34, 35). Both genes were upregulated in the walR^c strain: fmtB expression increased more than 10-fold using qRT-PCR, whereas fmtA transcription was 2-fold higher.

This brings to 13 the total number of cell wall metabolism genes shown to be controlled by WalKR in S. aureus.

The WalKR system controls major staphylococcal virulence genes, including the SaeSR regulon.

As shown in Table 3, 24 major virulence genes are upregulated by WalR^c, encoding host matrix interaction and degradation proteins (efb, emp, fnbA, fnbB, and spl operon), cytolytic toxins (hlgACB, hla, and hlb) and innate immune response evasion molecules (snc, chp, and sbi).

The alpha-, beta-, and gamma-hemolysin genes were among those showing the highest increase in expression in the walR^c strain (Table 3). We therefore compared hemolytic activities of the parental HG001 strain, carrying the empty pCN51 expression vector, and strain ST1034 expressing the walR^c allele (HG001/pSD3-12). The S. aureus HG001 strain background used in the present study is derived from strain NCTC 8325, and as such carries the ϕ13 prophage inserted intragenically at an att site within the hlb beta-toxin gene, rendering the cells beta-hemolysin negative (20, 25). As shown in Fig. 5, the walR^c strain displayed strongly increased alpha-hemolytic activity, in agreement with the higher hla expression seen in the transcriptome analysis (Table 3), whereas delta-hemolysis (clear halo surrounding the bacterial colony) was identical to that of the control strain (Fig. 5).

Fig 5 — WalR^c enhances *S. aureus* hemolytic activity. *S. aureus* strains carrying either the pCN51 empty vector or the pSD3-12 *walR*^c expression plasmid were grown until reaching an OD₆₀₀ of 1. Then, 20 μl of each culture was spotted onto Columbia horse blood agar plates, followed by incubation at 37°C. The clear thin halo surrounding bacteria corresponds to delta-hemolysin activity, whereas the larger cloudy halo is due to alpha-hemolysin activity.

Expression of the sae operon was significantly increased in the walR^c strain (Table 3). The last two genes of the operon, saeR and saeS, encode a TCS playing a major role in virulence gene expression (41, 59). We confirmed by qRT-PCR that expression of the first gene, saeP, was increased >7-fold in the walR^c strain (Table 5). Our transcriptome analysis reveals considerable overlap between the WalKR and SaeSR regulons (Tables 3 and 4) with at least 13 genes or operons in common: saePQRS, coa, emp, efb, hla, splA-F, hlb, snc, chp, sbi, hlgACB, and fnbAB, as well as fmtB, for which SaeSR-dependent regulation was suggested due to the presence of an SaeR binding site (60).

Table 5.

WalKR-dependent regulation of virulence genes occurs through SaeSR

Gene	Mean expression ratio ± SD
Gene	walR^c/WT strain ratio	ΔsaeRS walR^c/ΔsaeRS strain ratio
walR	76.64 ± 9.01	57.69 ± 7.86
saeR	3.97 ± 0.44	ND^a
saeP	7.73 ± 0.93	1.29 ± 0.11
fnbA	14.82 ± 1.89	1.13 ± 0.09
hla	9.38 ± 1.16	1.83 ± 0.01
hlgC	16.34 ± 3.19	0.95 ± 0.03
chp	9.92 ± 1.30	2.93 ± 0.41
snc	20.53 ± 1.16	1.88 ± 0.08
splA	24.59 ± 1.76	1.23 ± 0.12
fmtB	10.78 ± 1.80	1.05 ± 0.10
sbi	4.66 ± 0.19	1.08 ± 0.11

Open in a new tab

ND, not determined.

To verify whether activation of these genes by WalR^c was dependent on the SaeSR system, we constructed a ΔsaeRS mutant. As shown in Table 5, we confirmed upregulation by WalR^c for each of the 10 genes we tested by qRT-PCR and showed that in every case the ΔsaeRS mutation was epistatic to the walR^c allele, suggesting that regulation by WalR may be indirect, acting through SaeSR. This result also shows that fmtB is indeed controlled by SaeSR (Table 5). In order to rule out the possibility of secondary mutations that may affect the SaeSR system, we carried out six independent transformation experiments, introducing the pSD3-12 plasmid, allowing walR^c expression into either the HG001 strain or the HG001 ΔsaeRS mutant. As shown in Fig. S2 in the supplemental material, expression of the constitutive walR^c allele reproducibly leads to increased SaeSR-dependent fnbA expression in each case.

SaeSR positively autoregulate their own synthesis by activating transcription from the P1 sae operon promoter, upstream from saeP (19, 30). As shown in Table 5, WalR^c-dependent activation of saeP expression was also lost in the ΔsaeRS mutant, suggesting that WalKR control of the SaeSR regulon likely occurs indirectly, via activation of the Sae signal transduction pathway. Indeed, we could not identify a likely WalR binding site in the sae operon upstream region.

Constitutive activation of WalR strongly diminishes S. aureus virulence.

As shown above, constitutively active WalR leads to increased expression of several virulence genes. Given its essential nature, the impact of the WalKR TCS on S. aureus pathogenesis had not been previously tested. We therefore examined the effect of WalR^c production on virulence in a murine sepsis model, by infecting C57BL/6J mice intraperitoneally with strains ST1033 or ST1034. As shown in Fig. 6A, ca. 80% of the mice infected with the control strain died within 24 h of infection, whereas the WalR^c-producing strain led to significantly increased survival rates with only 20% mortality at 7 days postinfection.

Fig 6 — Constitutive WalR activity promotes bacterial clearance and host survival in a murine sepsis model. (A) Kaplan-Meier survival curves of mice inoculated i.p. with 10⁷ CFU/g mouse body weight of either the control ST1033 strain (▲) or the ST1034 WalR^c-producing strain (■). A total of 22 mice were used in each group in three independent experiments and survival was monitored over a 7-day period. ***, P < 0.001 (compared to control strain as determined by log-rank [Mantel-Cox] test). (B) *S. aureus* burden was measured in peritoneal lavage fluids at 1.5 h and 3 h postinfection (i.p.) with 5 × 10⁶ CFU/g mouse body weight. The data (means ± the standard error of the mean [SEM]) are representative of three independent experiments of five mice/group (n = 15). Gray bars, ST1033 (HG001/pCN51) control strain; black bars, ST1034 WalR^c-producing strain (HG001/pSD3-14). ***, P < 0.0005 (compared to control strain as determined by Mann-Whitney U test).

WalR^c activates the expression of several major virulence genes and yet leads to lowered S. aureus pathogenesis in vivo. We quantified the i.p. bacterial load of infected mice at 1.5 and 3 h postinfection. As shown in Fig. 6B, the CFU counts for the two strains in PLF were comparable to the amount injected and not significantly different at the early time point, indicating that there was no significant lysis of the walR^c strain and that the two strains had not begun to multiply. However, at 3 h postinfection the bacterial load for the control strain was ∼15-fold higher than that of the walR^c strain, which remained the same as the earlier time point. This suggests that decreased virulence of the walR^c strain results from enhanced clearance and/or bacterial growth control by the host.

WalR activation enhances triggering of the host innate immune inflammatory response.

In order to determine the mechanisms involved in enhanced clearance of the walR^c strain, we measured the amounts of professional phagocytes after infection. As shown in Fig. 7A, there were no major differences in the numbers of peritoneal macrophages, whereas neutrophil recruitment at the earlier time point (1.5 h) was significantly increased in mice infected with the WalR^c-producing strain.

Fig 7 — Constitutive WalR activity leads to increased neutrophil recruitment and enhanced cytokine production during the early phases of infection. (A) Peritoneal lavage fluids were collected at 1.5 h and 3 h postinfection (i.p.) with 5 × 10⁶ CFU/g mouse body weight. Macrophage and neutrophil counts were determined by flow cytometry. The data (means ± the SEM) are representative of three independent experiments with five mice/group (n = 15). Gray bars, ST1033 (HG001/pCN51) control strain; black bars, ST1034 WalR^c-producing strain (HG001/pSD3-14). *, P < 0.05 compared to control strain as determined by Mann-Whitney U test. (B) Cytokine production was measured by ELISA in peritoneal lavage fluids collected at 1.5 h and 3 h postinfection (i.p.) with 5 × 10⁶ CFU/g mouse body weight. The data (means ± the SEM) are representative of three independent experiments with five mice/group (n = 15). Gray bars, ST1033 (HG001/pCN51) control strain; black bars, ST1034 WalR^c-producing strain (HG001/pSD3-14). *, P < 0.05; **, P < 0.01 (compared to control strain as determined by Mann-Whitney U test).

To measure the impact of WalR^c on the host innate immune response, the production of pro- or anti-inflammatory cytokines (tumor necrosis factor alpha, interleukin-6 [IL-6], IL-1-β, and IL-10) and of the KC chemokine was measured in the PLF of infected mice. As shown in Fig. 7B, the cytokine levels were all significantly increased 1.5 h after infection with the walR^c strain ST1034.

The KC murine chemokine acts as a potent chemoattractant for neutrophil recruitment (40). Increased KC levels 1.5 h after infection with the walR^c strain could therefore explain the observed rise in neutrophil recruitment (Fig. 7A). Taken together, these results strongly suggest that enhanced clearance of the walR^c strain by the host is due to WalR^c-dependent earlier and increased triggering of the innate immune system inflammatory response.

Constitutive WalR activity strongly lowers intracellular persistence of S. aureus in macrophages.

We tested whether WalR^c production affected bacterial survival within RAW 264.7 murine macrophages. Internalization rates for the control and walR^c strains were identical (80 to 90%) at a multiplicity of infection (MOI) of 5. As shown in Fig. 8, clearance of the walR^c strain was much faster than for the control strain. Indeed, after 48 h, whereas CFU counts of surviving internalized bacteria were lowered ∼50-fold for the control strain, they decreased by more than 3 orders of magnitude for the WalR^c-producing strain (Fig. 8). This indicates that constitutive WalR activity renders cells much more sensitive to macrophage-related defenses and stress conditions.

Fig 8 — The *S. aureus walR*^c strain is strongly lowered in macrophage survival. RAW264.7 macrophages were infected with the HG001 strain carrying either the pCN51 empty vector (gray bars) or the pSD3-12 *walR*^c expression plasmid (black bars). Viable intracellular bacteria were quantified at the time of internalization (T0), 24 and 48 h after infection. A representative experiment (out of 3) is shown performed in triplicate (means ± the SD). *, P < 0.05; **, P < 0.00005 (as determined by using the Student t test).

Increased amounts of PGN in S. aureus walR^c culture supernatants elicit inflammatory cytokine production in human blood.

The SaeSR TCS, which is activated in the WalR^c-producing strain (Tables 3 to 5), controls the production of virulence factors and immune evasion molecules, and plays a key role in inducing a proinflammatory cytokine response (64, 65). As shown above, the cytokine levels are significantly increased during infection with the walR^c strain (Fig. 7B). To determine whether this is directly due to increased WalR activity or a result of SaeSR activation, we tested the effect of S. aureus culture supernatants on cytokine release in whole human blood. As shown in Fig. 9A, proinflammatory cytokine levels were strongly increased in the presence of supernatants from the walR^c strain compared to the control strain (more than 40- and 3-fold, respectively). Supernatants from the ΔsaeRS mutant strain carrying the walR^c expression plasmid led to the same increased titers, indicating that triggering of proinflammatory cytokine release by WalR^c is not dependent on the SaeSR TCS but is likely due to a direct effect of constitutively active WalR (Fig. 9B).

WalKR control PGN degradation in S. aureus (12), suggesting that the walR^c strain may release increased amounts of PGN fragments. As shown in Fig. 9C, the PGN levels were 3- to 5-fold higher in culture supernatants of the WT and ΔsaeRS strains expressing the walR^c allele, indicating that WalKR-dependent PGN release is likely responsible for the increased proinflammatory cytokine production. Taken together, our results suggest that WalKR play an important role in virulence and that constitutive activation of WalR leads to increased PGN release and early triggering of the host inflammatory response, resulting in enhanced bacterial clearance and lowered virulence.

DISCUSSION

The WalKR two-component system is essential for S. aureus cell viability and controls major autolysin genes involved in cell wall degradation (12, 13). In the present study we generated a constitutively active form of the WalR response regulator, through a phosphomimetic amino acid replacement at the phosphorylation site (D55E). Phosphorylation of TCS response regulators is in most cases a sine qua non requirement for their activity (27, 29), and it is well known that response regulator overproduction in vivo leads to their constitutive activation due to phosphorylation by other phosphate donors such as acetyl phosphate or aspecific kinase activity within the cell (32, 67). As shown here, overexpression of the walR^c allele in S. aureus led to increased autolysis, biofilm formation, and hemolytic activity, as well as strongly enhanced transcription of known WalR-regulon genes (Fig. 1, 2, and 5).

However, when the native WalR response regulator was overproduced under the same conditions, all of these phenotypes were much less pronounced, with only a moderate effect on WalR-dependent gene expression (Fig. 1 and data not shown). This is likely due to endogenous phosphatase activity of the chromosomally encoded WalK kinase, suggesting it acts to shut off WalR activity, preventing deregulated WalR regulon expression as cells enter stationary phase. Many histidine kinases are known to also act as phosphoprotein phosphatases, catalyzing the dephosphorylation of the cognate response regulator, and it was previously reported that increased expression of TCS regulon genes could only be seen when the response regulator was overexpressed in the absence of its kinase (50). Indeed, based on structure and mathematical modeling analyses, WalK has been classified as a so-called “bifunctional sensor,” i.e., with both kinase and phosphatase activities (2), and its phosphatase activity has been shown to involve its cytoplasmic PAS domain in Streptococcus pneumoniae (22). Accordingly, the strain overproducing native WalR did not display a biphasic growth profile at the end of the exponential phase, in contrast to the walR^c strain where WalK phosphatase activity would be ineffective in shutting off constitutive WalR^c activity (Fig. 2A).

To test this hypothesis, we overproduced the native WalR response regulator in strain ST1017, a derivative of strain HG001 where the chromosomal walRK operon is under the control of the IPTG (isopropyl-β-d-thiogalactopyranoside)-inducible Pspac promoter and thus unable to grow in the absence of inducer. The strain overproducing the native WalR response regulator was able to grow in the absence of IPTG, albeit with a biphasic growth profile as observed for strains producing WalR^c (see Fig. S1 in the supplemental material). Indeed, in the absence of IPTG, the chromosomally encoded WalK kinase is not produced and WalR activity will not be shut off as cells enter stationary phase, in agreement with our hypothesis. However, when the same strain was grown in the presence of IPTG, the biphasic growth profile was corrected, as the chromosomally encoded WalK kinase was produced and WalR activity appropriately shut off. Accordingly, WalR overproduction led to a 20-fold increase in sle1 expression in the absence of IPTG, whereas in the presence of IPTG this overexpression was abolished (see Fig. S1 in the supplemental material). Taken together, our results indicate that WalK acts as a WalR phosphoprotein phosphatase upon entry into stationary phase in order to shut off WalR activity and that the biphasic growth profile is due to transient adaptation of the cells to elevated WalR activity during the stationary phase.

Expression profiling of a strain producing the constitutively active form of WalR showed that the transcription of 108 genes was increased, while that of 57 was lowered (Tables 3 and 4). We previously identified 31 S. aureus genes preceded by potential WalR binding sites as likely WalR regulon members (13). Of these, seven had increased expression in the walR^c strain (SAOUHSC_00060, lytM, ssaA, SAOUHSC_00671, SAOUHSC_00773, SAOUHSC_02576, and SAOUHSC_02883), whereas two were repressed (SAOUHSC_00094 and SAOUHSC_00617). This suggests that for the remaining predicted regulon genes the positions of the potential binding sites may not be optimal for transcription activation/repression or that additional regulatory controls prevent their expression under the conditions used.

We confirmed WalR-dependent regulation for 19 of the positively regulated genes by qRT-PCR (indicated in Table 3), including two that encode CHAP-domain amidases: sle1, playing a crucial role in S. aureus daughter cell separation (24, 31), and SAOUHSC_02855. Two recent studies reported expression profiling of clinical S. aureus strains with missense mutations in walK or walR leading to a VISA (vancomycin-intermediate Staphylococcus aureus) phenotype; however, there was no indication as to whether these mutations led to a gain or loss of function, and very few if any of the known WalR-dependent genes displayed any changes in expression, making it difficult to compare the data (28, 56). Furthermore, in our genetic background, the walR^c strain showed no difference in vancomycin MIC compared to the control strain, indicating that constitutively active WalR does not lead to a VISA phenotype (data not shown).

As shown in Tables 3 and 4, WalR acts mainly as a positive regulator of transcription, since most of the repression factors are fairly low. Expression of spa, encoding the staphylococcal protein A immunoglobulin-binding protein (47), is strongly lowered in the walR^c strain, but this repression is likely indirect since we could not identify a WalR binding site within the upstream region. Indeed, expression of sarS and sarT is also lowered in the walR^c strain, and SarT is known to positively control SarS production, which in turn activates spa transcription (9, 54). WalR^c-dependent repression of sarT could therefore explain the lowered expression of both sarS and spa.

Several accessory regulators (SarA, SarS, SarT, SarR, and Rot) and at least four two-component systems (AgrCA, ArlSR, SaeSR, and SrrAB) are known to interact in controlling S. aureus virulence gene expression (48). As shown in Fig. 10, the walR^c transcriptome analysis revealed unsuspected links between WalKR and SaeSR: expression of the saePQRS operon is increased in the walR^c strain, as well as that of several SaeSR regulon genes involved in host matrix interactions, cytotoxicity and innate immune defense evasion (Table 3). Although many of these immune defense evasion genes encode molecules that are only active against human innate immune defenses, such as Staphylococcus complement inhibitor (SCIN) or chemotaxis inhibitory protein (CHIPS) (10, 17, 52), and therefore do not play a role in the murine model used here, others, such as sbi (second binding protein of immunoglobulin) (69), are also functional in mice (4).

WalR controls these genes indirectly through the SaeSR TCS (Fig. 10), since they are not preceded by WalR binding sites and a ΔsaeRS mutation prevented WalR^c-dependent activation (Table 5). Positive control of SaeSR regulon genes by WalR^c could conceivably result either from direct activation by WalR of sae operon transcription, leading to higher levels of the TCS proteins, or through increased activity of the SaeSR system through a WalR^c-generated signal. SaeSR positively autoregulate their own synthesis, by activating transcription from the P1 saePQRS operon promoter upstream from saeP (19, 30, 43, 49, 60). However, transcription from this promoter is not required for SaeSR regulon expression (30). Indeed, a second promoter, P3, located within the upstream saeQ gene, is constitutively expressed at a low basal level and sufficient to drive expression of the two downstream saeRS genes (30). These results suggest that constitutive activation of WalR generates a signal leading to stimulation of the SaeSR TCS and a corresponding increase in SaeSR regulon expression (Fig. 10). Although the signals to which the WalK histidine kinase responds have yet to be elucidated, the SaeSR system is known to be activated by the presence of β-lactam antibiotics (37) and human α-defensin (19). Whereas WalK is a membrane-bound kinase with two amino-terminal transmembrane domains separated by a large extracellular loop (149 amino acods), SaeS has only nine amino acids separating the two transmembrane segments (1) and belongs to the so-called “intramembrane-sensing kinase” family (45), which is thought to respond to membrane damage. In the highly virulent S. aureus Newman strain, the SaeS kinase is constitutively activated, due to a missense mutation changing a single amino acid (L18P) within the first transmembrane helix (1, 5), which could in part explain its increased pathogenicity. Accordingly, when we introduced the walR^c expression plasmid into the Newman strain, we saw no increased expression of hla, hlg, or saeP compared to the control strain carrying the empty vector pCN51, indicating that since the SaeSR system is already constitutively active in this genetic background, increased WalR activity has no further effect on SaeSR-dependent regulation (data not shown).

Inflammation is a normal and essential response to infection (46). Strains producing constitutively active WalR are strongly diminished in their virulence (Fig. 6) due to early triggering of the host inflammatory response. Indeed, neutrophil recruitment and cytokine levels were significantly increased early after infection when the walR^c allele was expressed, resulting in enhanced bacterial clearance (Fig. 7). Survival in macrophages was also significantly lower for the walR^c strain (Fig. 8). The timing of neutrophil recruitment, which occurs earlier during infection with bacteria expressing walR^c, is known to be a crucial factor in murine resistance to S. aureus infections (63).

Constitutive WalR activity in the host leads to activation of the SaeSR TCS (Fig. 10), which is required in turn for virulence (41), innate immune response evasion (64), and proinflammatory cytokine production during S. aureus infections (65). However, WalR^c-dependent early triggering of the host inflammatory response is independent from its effect on SaeSR and instead due to its role in controlling autolytic enzyme production. Indeed, supernatants from WalR^c cultures contained increased amounts of PGN, promoting inflammatory cytokine secretion in whole human blood, even in the absence of SaeSR (Fig. 9). Cell wall degradation has been shown to play an important part in the host inflammatory response to S. aureus infections, through proinflammatory cytokine production and inflammasome activation (55).

The transition of S. aureus from a commensal lifestyle to that of an invasive pathogen remains poorly understood, although the AgrCA TCS plays a key role (48). Two recent reports have shown that expression of the walRK operon and activation of the WalKR TCS are increased in S. aureus during nasal colonization (6, 7). WalR does not autoregulate its own synthesis since there is no WalR binding site present and, although increased walR transcription was detected in the transcriptome analysis due to the multicopy pSD3-12 walR^c plasmid, expression levels of the chromosomal walKHIJ operon genes did not vary (Table 3). This implies that expression of the walRK operon is controlled by an as-yet-undetermined regulatory process and that WalKR may respond to signals that may be related to nasal colonization conditions.

We show here that constitutive activation of WalR triggers an early and enhanced host inflammatory response leading to rapid bacterial clearance and lowered virulence, suggesting that the precise fine-tuning of WalKR activity may be critical in the switch between S. aureus commensal and pathogenic lifestyles.

Supplementary Material

Supplemental material

supp_80_10_3438__index.html^{(1.1KB, html)}

ACKNOWLEDGMENTS

We are grateful to Hanne Jarmer (Technical University of Denmark) for the tiling array design and to Iñigo Lasa (University of Pamplona) for kindly providing the pMAD TCS6AD plasmid, allowing construction of the ΔsaeRS mutant.

This study was supported by research funds from the European Commission (StaphDynamics [LHSM-CT-2006-019064] and BaSysBio [LSHG-CT-2006-037469] grants), the Centre National de la Recherche Scientifique (CNRS ERL3526), the Agence Nationale de la Recherche (ANR GrabIron and NaBab), and the Institut Pasteur (PTR 336).

A.D. received Ph.D. support from the BaSysBio program and a Young Scientist Fellowship from the Conseil Pasteur-Weizmann. C.B. received a postdoctoral fellowship from the Institut Pasteur (PTR 336).

Footnotes

Published ahead of print 23 July 2012

Supplemental material for this article may be found at http://iai.asm.org/.

REFERENCES

1. Adhikari RP, Novick RP. 2008. Regulatory organization of the staphylococcal sae locus. Microbiology 154:949–959 [DOI] [PubMed] [Google Scholar]
2. Alves R, Savageau MA. 2003. Comparative analysis of prototype two-component systems with either bifunctional or monofunctional sensors: differences in molecular structure and physiological function. Mol. Microbiol. 48:25–51 [DOI] [PubMed] [Google Scholar]
3. Arnaud M, Chastanet A, Debarbouille M. 2004. New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl. Environ. Microbiol. 70:6887–6891 [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Atkins KL, et al. 2008. S. aureus IgG-binding proteins SpA and Sbi: host specificity and mechanisms of immune complex formation. Mol. Immunol. 45:1600–1611 [DOI] [PubMed] [Google Scholar]
5. Baba T, Bae T, Schneewind O, Takeuchi F, Hiramatsu K. 2008. Genome sequence of Staphylococcus aureus strain Newman and comparative analysis of staphylococcal genomes: polymorphism and evolution of two major pathogenicity islands. J. Bacteriol. 190:300–310 [DOI] [PMC free article] [PubMed] [Google Scholar]
6. Burian M, et al. 2010. Temporal expression of adhesion factors and activity of global regulators during establishment of Staphylococcus aureus nasal colonization. J. Infect. Dis. 201:1414–1421 [DOI] [PubMed] [Google Scholar]
7. Burian M, Wolz C, Görke C. 2010. Regulatory adaptation of Staphylococcus aureus during nasal colonization of humans. PLoS One 5:e10040 doi:10.1371/journal.pone.0010040 [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Charpentier E, et al. 2004. Novel cassette-based shuttle vector system for gram-positive bacteria. Appl. Environ. Microbiol. 70:6076–6085 [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Cheung AL, Schmidt K, Bateman B, Manna AC. 2001. SarS, a SarA homolog repressible by agr, is an activator of protein A synthesis in Staphylococcus aureus. Infect. Immun. 69:2448–2455 [DOI] [PMC free article] [PubMed] [Google Scholar]
10. de Haas CJ, et al. 2004. Chemotaxis inhibitory protein of Staphylococcus aureus, a bacterial anti-inflammatory agent. J. Exp. Med. 199:687–695 [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Derré I, Rapoport G, Msadek T. 1999. CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in Gram-positive bacteria. Mol. Microbiol. 31:117–132 [DOI] [PubMed] [Google Scholar]
12. Dubrac S, Boneca IG, Poupel O, Msadek T. 2007. New insights into the WalK/WalR (YycG/YycF) essential signal transduction pathway reveal a major role in controlling cell wall metabolism and biofilm formation in Staphylococcus aureus. J. Bacteriol. 189:8257–8269 [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Dubrac S, Msadek T. 2004. Identification of genes controlled by the essential YycG/YycF two-component system of Staphylococcus aureus. J. Bacteriol. 186:1175–1181 [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Even S, et al. 2006. Global control of cysteine metabolism by CymR in Bacillus subtilis. J. Bacteriol. 188:2184–2197 [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Falord M, Mader U, Hiron A, Debarbouille M, Msadek T. 2011. Investigation of the Staphylococcus aureus GraSR regulon reveals novel links to virulence, stress response and cell wall signal transduction pathways. PLoS One 6:e21323 doi:10.1371/journal.pone.0021323 [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Fan X, et al. 2007. Diversity of penicillin-binding proteins: resistance factor FmtA of Staphylococcus aureus. J. Biol. Chem. 282:35143–35152 [DOI] [PubMed] [Google Scholar]
17. Foster TJ. 2005. Immune evasion by staphylococci. Nat. Rev. Microbiol. 3:948–958 [DOI] [PubMed] [Google Scholar]
18. Fournier B, Philpott DJ. 2005. Recognition of Staphylococcus aureus by the innate immune system. Clin. Microbiol. Rev. 18:521–540 [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Geiger T, Görke C, Mainiero M, Kraus D, Wolz C. 2008. The virulence regulator Sae of Staphylococcus aureus: promoter activities and response to phagocytosis-related signals. J. Bacteriol. 190:3419–3428 [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Gillaspy AF, et al. 2006. The Staphylococcus aureus NCTC 8325 genome, p 381–412 In Fischetti VA, et al. (ed), Gram-positive pathogens, 2nd ed ASM Press, Washington, DC [Google Scholar]
21. Giraudo AT, Calzolari A, Cataldi AA, Bogni C, Nagel R. 1999. The sae locus of Staphylococcus aureus encodes a two-component regulatory system. FEMS Microbiol. Lett. 177:15–22 [DOI] [PubMed] [Google Scholar]
22. Gutu AD, Wayne KJ, Sham LT, Winkler ME. 2010. Kinetic characterization of the WalRKSpn (VicRK) two-component system of Streptococcus pneumoniae: dependence of WalKSpn (VicK) phosphatase activity on its PAS domain. J. Bacteriol. 192:2346–2358 [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Haque RU, Baldwin JN. 1964. Types of hemolysins produced by Staphylococcus aureus, as determined by the replica plating technique. J. Bacteriol. 88:1442–1447 [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Heilmann C, Hartleib J, Hussain MS, Peters G. 2005. The multifunctional Staphylococcus aureus autolysin aaa mediates adherence to immobilized fibrinogen and fibronectin. Infect. Immun. 73:4793–4802 [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Herbert S, et al. 2010. Repair of global regulators in Staphylococcus aureus 8325 and comparative analysis with other clinical isolates. Infect. Immun. 78:2877–2889 [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59 [DOI] [PubMed] [Google Scholar]
27. Hoch JA, Silhavy TJ. (ed). 1995. Two-component signal transduction. ASM Press, Washington, DC [Google Scholar]
28. Howden BP, et al. 2011. Evolution of multidrug resistance during Staphylococcus aureus infection involves mutation of the essential two component regulator WalKR. PLoS Pathog. 7:e1002359 doi:10.1371/journal.ppat.1002359 [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Inouye M, Dutta R. (ed). 2003. Histidine kinases in signal transduction. Academic Press, Inc, San Diego, CA [Google Scholar]
30. Jeong DW, et al. 2011. Identification of P3 promoter and distinct roles of the two promoters of the SaeRS two-component system in Staphylococcus aureus. J. Bacteriol. 193:4672–4684 [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Kajimura J, et al. 2005. Identification and molecular characterization of an N-acetylmuramyl-l-alanine amidase Sle1 involved in cell separation of Staphylococcus aureus. Mol. Microbiol. 58:1087–1101 [DOI] [PubMed] [Google Scholar]
32. Kobayashi K, et al. 2001. Comprehensive DNA microarray analysis of Bacillus subtilis two-component regulatory systems. J. Bacteriol. 183:7365–7370 [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Kobayashi T, Tani T, Yokota T, Kodama M. 2000. Detection of peptidoglycan in human plasma using the silkworm larvae plasma test. FEMS Immunol. Med. Microbiol. 28:49–53 [DOI] [PubMed] [Google Scholar]
34. Komatsuzawa H, Ohta K, Labischinski H, Sugai M, Suginaka H. 1999. Characterization of fmtA, a gene that modulates the expression of methicillin resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 43:2121–2125 [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Komatsuzawa H, et al. 2000. Tn551-mediated insertional inactivation of the fmtB gene encoding a cell wall-associated protein abolishes methicillin resistance in Staphylococcus aureus. J. Antimicrob. Chemother. 45:421–431 [DOI] [PubMed] [Google Scholar]
36. Kreiswirth BN, et al. 1983. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305:709–712 [DOI] [PubMed] [Google Scholar]
37. Kuroda H, Kuroda M, Cui L, Hiramatsu K. 2007. Subinhibitory concentrations of beta-lactam induce haemolytic activity in Staphylococcus aureus through the SaeRS two-component system. FEMS Microbiol. Lett. 268:98–105 [DOI] [PubMed] [Google Scholar]
38. Kuroda M, et al. 2001. Whole genome sequencing of methicillin-resistant Staphylococcus aureus. Lancet 357:1225–1240 [DOI] [PubMed] [Google Scholar]
39. Lan CY, Igo MM. 1998. Differential expression of the OmpF and OmpC porin proteins in Escherichia coli K-12 depends upon the level of active OmpR. J. Bacteriol. 180:171–174 [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Lee J, et al. 1995. Chemokine binding and activities mediated by the mouse IL-8 receptor. J. Immunol. 155:2158–2164 [PubMed] [Google Scholar]
41. Liang X, et al. 2006. Inactivation of a two-component signal transduction system, SaeRS, eliminates adherence and attenuates virulence of Staphylococcus aureus. Infect. Immun. 74:4655–4665 [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Lowy FD. 1998. Staphylococcus aureus infections. N. Engl. J. Med. 339:520–532 [DOI] [PubMed] [Google Scholar]
43. Mainiero M, et al. 2010. Differential target gene activation by the Staphylococcus aureus two-component system saeRS. J. Bacteriol. 192:613–623 [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Martin PK, Li T, Sun D, Biek DP, Schmid MB. 1999. Role in cell permeability of an essential two-component system in Staphylococcus aureus. J. Bacteriol. 181:3666–3673 [DOI] [PMC free article] [PubMed] [Google Scholar]
45. Mascher T. 2006. Intramembrane-sensing histidine kinases: a new family of cell envelope stress sensors in Firmicutes bacteria. FEMS Microbiol. Lett. 264:133–144 [DOI] [PubMed] [Google Scholar]
46. Mogensen TH. 2009. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin. Microbiol. Rev. 22:240–273 [DOI] [PMC free article] [PubMed] [Google Scholar]
47. Moks T, et al. 1986. Staphylococcal protein A consists of five IgG-binding domains. Eur. J. Biochem. 156:637–643 [DOI] [PubMed] [Google Scholar]
48. Novick RP. 2003. Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol. Microbiol. 48:1429–1449 [DOI] [PubMed] [Google Scholar]
49. Nygaard TK, et al. 2010. SaeR binds a consensus sequence within virulence gene promoters to advance USA300 pathogenesis. J. Infect. Dis. 201:241–254 [DOI] [PMC free article] [PubMed] [Google Scholar]
50. Ogura M, Yamaguchi H, Yoshida K, Fujita Y, Tanaka T. 2001. DNA microarray analysis of Bacillus subtilis DegU, ComA, and PhoP regulons: an approach to comprehensive analysis of B. subtilis two-component regulatory systems. Nucleic Acids Res. 29:3804–3813 [DOI] [PMC free article] [PubMed] [Google Scholar]
51. Rasmussen S, Nielsen HB, Jarmer H. 2009. The transcriptionally active regions in the genome of Bacillus subtilis. Mol. Microbiol. 73:1043–1057 [DOI] [PMC free article] [PubMed] [Google Scholar]
52. Rooijakkers SH, et al. 2005. Immune evasion by a staphylococcal complement inhibitor that acts on C3 convertases. Nat. Immunol. 6:920–927 [DOI] [PubMed] [Google Scholar]
53. Rooijakkers SH, van Kessel KP, van Strijp JA. 2005. Staphylococcal innate immune evasion. Trends Microbiol. 13:596–601 [DOI] [PubMed] [Google Scholar]
54. Schmidt KA, Manna AC, Cheung AL. 2003. SarT influences sarS expression in Staphylococcus aureus. Infect. Immun. 71:5139–5148 [DOI] [PMC free article] [PubMed] [Google Scholar]
55. Shimada T, et al. 2010. Staphylococcus aureus evades lysozyme-based peptidoglycan digestion that links phagocytosis, inflammasome activation, and IL-1β secretion. Cell Host Microbe 7:38–49 [DOI] [PMC free article] [PubMed] [Google Scholar]
56. Shoji M, et al. 2011. walK and clpP mutations confer reduced vancomycin susceptibility in Staphylococcus aureus. Antimicrob. Agents Chemother. 55:3870–3881 [DOI] [PMC free article] [PubMed] [Google Scholar]
57. Smith JG, et al. 2004. A search for amino acid substitutions that universally activate response regulators. Mol. Microbiol. 51:887–901 [DOI] [PubMed] [Google Scholar]
58. Soutourina O, Dubrac S, Poupel O, Msadek T, Martin-Verstraete I. 2010. The pleiotropic CymR regulator of Staphylococcus aureus plays an important role in virulence and stress response. PLoS Pathog. 6:e1000894 doi:10.1371/journal.ppat.1000894 [DOI] [PMC free article] [PubMed] [Google Scholar]
59. Steinhuber A, Görke C, Bayer MG, Doring G, Wolz C. 2003. Molecular architecture of the regulatory locus sae of Staphylococcus aureus and its impact on expression of virulence factors. J. Bacteriol. 185:6278–6286 [DOI] [PMC free article] [PubMed] [Google Scholar]
60. Sun F, et al. 2010. In the Staphylococcus aureus two-component system sae, the response regulator SaeR binds to a direct repeat sequence and DNA binding requires phosphorylation by the sensor kinase SaeS. J. Bacteriol. 192:2111–2127 [DOI] [PMC free article] [PubMed] [Google Scholar]
61. Toledo-Arana A, et al. 2005. Staphylococcus aureus develops an alternative, ica-independent biofilm in the absence of the arlRS two-component system. J. Bacteriol. 187:5318–5329 [DOI] [PMC free article] [PubMed] [Google Scholar]
62. Volz K. 1995. Structural and functional conservation in response regulators, p 53–64 In Hoch JA, Silhavy TJ. (ed), Two-component signal transduction. ASM Press, Washington, DC [Google Scholar]
63. von Kockritz-Blickwede M, et al. 2008. Immunological mechanisms underlying the genetic predisposition to severe Staphylococcus aureus infection in the mouse model. Am. J. Pathol. 173:1657–1668 [DOI] [PMC free article] [PubMed] [Google Scholar]
64. Voyich JM, et al. 2009. The SaeR/S gene regulatory system is essential for innate immune evasion by Staphylococcus aureus. J. Infect. Dis. 199:1698–1706 [DOI] [PMC free article] [PubMed] [Google Scholar]
65. Watkins RL, Pallister KB, Voyich JM. 2011. The SaeR/S gene regulatory system induces a proinflammatory cytokine response during Staphylococcus aureus infection. PLoS One 6:e19939 doi:10.1371/journal.pone.0019939 [DOI] [PMC free article] [PubMed] [Google Scholar]
66. Wei H, et al. 2008. A study of the relationships between oligonucleotide properties and hybridization signal intensities from NimbleGen microarray datasets. Nucleic Acids Res. 36:2926–2938 [DOI] [PMC free article] [PubMed] [Google Scholar]
67. Weinrauch Y, Penchev R, Dubnau E, Smith I, Dubnau D. 1990. A Bacillus subtilis regulatory gene product for genetic competence and sporulation resembles sensor protein members of the bacterial two-component signal-transduction systems. Genes Dev. 4:860–872 [DOI] [PubMed] [Google Scholar]
68. Wertheim HF, et al. 2005. The role of nasal carriage in Staphylococcus aureus infections. Lancet Infect. Dis. 5:751–762 [DOI] [PubMed] [Google Scholar]
69. Zhang L, Jacobsson K, Vasi J, Lindberg M, Frykberg L. 1998. A second IgG-binding protein in Staphylococcus aureus. Microbiology 144:985–991 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

supp_80_10_3438__index.html^{(1.1KB, html)}

IAI.00195-12_zii999099821so1.pdf^{(204.6KB, pdf)}

[B1] 1. Adhikari RP, Novick RP. 2008. Regulatory organization of the staphylococcal sae locus. Microbiology 154:949–959 [DOI] [PubMed] [Google Scholar]

[B2] 2. Alves R, Savageau MA. 2003. Comparative analysis of prototype two-component systems with either bifunctional or monofunctional sensors: differences in molecular structure and physiological function. Mol. Microbiol. 48:25–51 [DOI] [PubMed] [Google Scholar]

[B3] 3. Arnaud M, Chastanet A, Debarbouille M. 2004. New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl. Environ. Microbiol. 70:6887–6891 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4. Atkins KL, et al. 2008. S. aureus IgG-binding proteins SpA and Sbi: host specificity and mechanisms of immune complex formation. Mol. Immunol. 45:1600–1611 [DOI] [PubMed] [Google Scholar]

[B5] 5. Baba T, Bae T, Schneewind O, Takeuchi F, Hiramatsu K. 2008. Genome sequence of Staphylococcus aureus strain Newman and comparative analysis of staphylococcal genomes: polymorphism and evolution of two major pathogenicity islands. J. Bacteriol. 190:300–310 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] 6. Burian M, et al. 2010. Temporal expression of adhesion factors and activity of global regulators during establishment of Staphylococcus aureus nasal colonization. J. Infect. Dis. 201:1414–1421 [DOI] [PubMed] [Google Scholar]

[B7] 7. Burian M, Wolz C, Görke C. 2010. Regulatory adaptation of Staphylococcus aureus during nasal colonization of humans. PLoS One 5:e10040 doi:10.1371/journal.pone.0010040 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8. Charpentier E, et al. 2004. Novel cassette-based shuttle vector system for gram-positive bacteria. Appl. Environ. Microbiol. 70:6076–6085 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 9. Cheung AL, Schmidt K, Bateman B, Manna AC. 2001. SarS, a SarA homolog repressible by agr, is an activator of protein A synthesis in Staphylococcus aureus. Infect. Immun. 69:2448–2455 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10. de Haas CJ, et al. 2004. Chemotaxis inhibitory protein of Staphylococcus aureus, a bacterial anti-inflammatory agent. J. Exp. Med. 199:687–695 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B11] 11. Derré I, Rapoport G, Msadek T. 1999. CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in Gram-positive bacteria. Mol. Microbiol. 31:117–132 [DOI] [PubMed] [Google Scholar]

[B12] 12. Dubrac S, Boneca IG, Poupel O, Msadek T. 2007. New insights into the WalK/WalR (YycG/YycF) essential signal transduction pathway reveal a major role in controlling cell wall metabolism and biofilm formation in Staphylococcus aureus. J. Bacteriol. 189:8257–8269 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13. Dubrac S, Msadek T. 2004. Identification of genes controlled by the essential YycG/YycF two-component system of Staphylococcus aureus. J. Bacteriol. 186:1175–1181 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14. Even S, et al. 2006. Global control of cysteine metabolism by CymR in Bacillus subtilis. J. Bacteriol. 188:2184–2197 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15. Falord M, Mader U, Hiron A, Debarbouille M, Msadek T. 2011. Investigation of the Staphylococcus aureus GraSR regulon reveals novel links to virulence, stress response and cell wall signal transduction pathways. PLoS One 6:e21323 doi:10.1371/journal.pone.0021323 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B16] 16. Fan X, et al. 2007. Diversity of penicillin-binding proteins: resistance factor FmtA of Staphylococcus aureus. J. Biol. Chem. 282:35143–35152 [DOI] [PubMed] [Google Scholar]

[B17] 17. Foster TJ. 2005. Immune evasion by staphylococci. Nat. Rev. Microbiol. 3:948–958 [DOI] [PubMed] [Google Scholar]

[B18] 18. Fournier B, Philpott DJ. 2005. Recognition of Staphylococcus aureus by the innate immune system. Clin. Microbiol. Rev. 18:521–540 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B19] 19. Geiger T, Görke C, Mainiero M, Kraus D, Wolz C. 2008. The virulence regulator Sae of Staphylococcus aureus: promoter activities and response to phagocytosis-related signals. J. Bacteriol. 190:3419–3428 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B20] 20. Gillaspy AF, et al. 2006. The Staphylococcus aureus NCTC 8325 genome, p 381–412 In Fischetti VA, et al. (ed), Gram-positive pathogens, 2nd ed ASM Press, Washington, DC [Google Scholar]

[B21] 21. Giraudo AT, Calzolari A, Cataldi AA, Bogni C, Nagel R. 1999. The sae locus of Staphylococcus aureus encodes a two-component regulatory system. FEMS Microbiol. Lett. 177:15–22 [DOI] [PubMed] [Google Scholar]

[B22] 22. Gutu AD, Wayne KJ, Sham LT, Winkler ME. 2010. Kinetic characterization of the WalRKSpn (VicRK) two-component system of Streptococcus pneumoniae: dependence of WalKSpn (VicK) phosphatase activity on its PAS domain. J. Bacteriol. 192:2346–2358 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23. Haque RU, Baldwin JN. 1964. Types of hemolysins produced by Staphylococcus aureus, as determined by the replica plating technique. J. Bacteriol. 88:1442–1447 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24. Heilmann C, Hartleib J, Hussain MS, Peters G. 2005. The multifunctional Staphylococcus aureus autolysin aaa mediates adherence to immobilized fibrinogen and fibronectin. Infect. Immun. 73:4793–4802 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] 25. Herbert S, et al. 2010. Repair of global regulators in Staphylococcus aureus 8325 and comparative analysis with other clinical isolates. Infect. Immun. 78:2877–2889 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59 [DOI] [PubMed] [Google Scholar]

[B27] 27. Hoch JA, Silhavy TJ. (ed). 1995. Two-component signal transduction. ASM Press, Washington, DC [Google Scholar]

[B28] 28. Howden BP, et al. 2011. Evolution of multidrug resistance during Staphylococcus aureus infection involves mutation of the essential two component regulator WalKR. PLoS Pathog. 7:e1002359 doi:10.1371/journal.ppat.1002359 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] 29. Inouye M, Dutta R. (ed). 2003. Histidine kinases in signal transduction. Academic Press, Inc, San Diego, CA [Google Scholar]

[B30] 30. Jeong DW, et al. 2011. Identification of P3 promoter and distinct roles of the two promoters of the SaeRS two-component system in Staphylococcus aureus. J. Bacteriol. 193:4672–4684 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31. Kajimura J, et al. 2005. Identification and molecular characterization of an N-acetylmuramyl-l-alanine amidase Sle1 involved in cell separation of Staphylococcus aureus. Mol. Microbiol. 58:1087–1101 [DOI] [PubMed] [Google Scholar]

[B32] 32. Kobayashi K, et al. 2001. Comprehensive DNA microarray analysis of Bacillus subtilis two-component regulatory systems. J. Bacteriol. 183:7365–7370 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33. Kobayashi T, Tani T, Yokota T, Kodama M. 2000. Detection of peptidoglycan in human plasma using the silkworm larvae plasma test. FEMS Immunol. Med. Microbiol. 28:49–53 [DOI] [PubMed] [Google Scholar]

[B34] 34. Komatsuzawa H, Ohta K, Labischinski H, Sugai M, Suginaka H. 1999. Characterization of fmtA, a gene that modulates the expression of methicillin resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 43:2121–2125 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35. Komatsuzawa H, et al. 2000. Tn551-mediated insertional inactivation of the fmtB gene encoding a cell wall-associated protein abolishes methicillin resistance in Staphylococcus aureus. J. Antimicrob. Chemother. 45:421–431 [DOI] [PubMed] [Google Scholar]

[B36] 36. Kreiswirth BN, et al. 1983. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305:709–712 [DOI] [PubMed] [Google Scholar]

[B37] 37. Kuroda H, Kuroda M, Cui L, Hiramatsu K. 2007. Subinhibitory concentrations of beta-lactam induce haemolytic activity in Staphylococcus aureus through the SaeRS two-component system. FEMS Microbiol. Lett. 268:98–105 [DOI] [PubMed] [Google Scholar]

[B38] 38. Kuroda M, et al. 2001. Whole genome sequencing of methicillin-resistant Staphylococcus aureus. Lancet 357:1225–1240 [DOI] [PubMed] [Google Scholar]

[B39] 39. Lan CY, Igo MM. 1998. Differential expression of the OmpF and OmpC porin proteins in Escherichia coli K-12 depends upon the level of active OmpR. J. Bacteriol. 180:171–174 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 40. Lee J, et al. 1995. Chemokine binding and activities mediated by the mouse IL-8 receptor. J. Immunol. 155:2158–2164 [PubMed] [Google Scholar]

[B41] 41. Liang X, et al. 2006. Inactivation of a two-component signal transduction system, SaeRS, eliminates adherence and attenuates virulence of Staphylococcus aureus. Infect. Immun. 74:4655–4665 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] 42. Lowy FD. 1998. Staphylococcus aureus infections. N. Engl. J. Med. 339:520–532 [DOI] [PubMed] [Google Scholar]

[B43] 43. Mainiero M, et al. 2010. Differential target gene activation by the Staphylococcus aureus two-component system saeRS. J. Bacteriol. 192:613–623 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44. Martin PK, Li T, Sun D, Biek DP, Schmid MB. 1999. Role in cell permeability of an essential two-component system in Staphylococcus aureus. J. Bacteriol. 181:3666–3673 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B45] 45. Mascher T. 2006. Intramembrane-sensing histidine kinases: a new family of cell envelope stress sensors in Firmicutes bacteria. FEMS Microbiol. Lett. 264:133–144 [DOI] [PubMed] [Google Scholar]

[B46] 46. Mogensen TH. 2009. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin. Microbiol. Rev. 22:240–273 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 47. Moks T, et al. 1986. Staphylococcal protein A consists of five IgG-binding domains. Eur. J. Biochem. 156:637–643 [DOI] [PubMed] [Google Scholar]

[B48] 48. Novick RP. 2003. Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol. Microbiol. 48:1429–1449 [DOI] [PubMed] [Google Scholar]

[B49] 49. Nygaard TK, et al. 2010. SaeR binds a consensus sequence within virulence gene promoters to advance USA300 pathogenesis. J. Infect. Dis. 201:241–254 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B50] 50. Ogura M, Yamaguchi H, Yoshida K, Fujita Y, Tanaka T. 2001. DNA microarray analysis of Bacillus subtilis DegU, ComA, and PhoP regulons: an approach to comprehensive analysis of B. subtilis two-component regulatory systems. Nucleic Acids Res. 29:3804–3813 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B51] 51. Rasmussen S, Nielsen HB, Jarmer H. 2009. The transcriptionally active regions in the genome of Bacillus subtilis. Mol. Microbiol. 73:1043–1057 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B52] 52. Rooijakkers SH, et al. 2005. Immune evasion by a staphylococcal complement inhibitor that acts on C3 convertases. Nat. Immunol. 6:920–927 [DOI] [PubMed] [Google Scholar]

[B53] 53. Rooijakkers SH, van Kessel KP, van Strijp JA. 2005. Staphylococcal innate immune evasion. Trends Microbiol. 13:596–601 [DOI] [PubMed] [Google Scholar]

[B54] 54. Schmidt KA, Manna AC, Cheung AL. 2003. SarT influences sarS expression in Staphylococcus aureus. Infect. Immun. 71:5139–5148 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B55] 55. Shimada T, et al. 2010. Staphylococcus aureus evades lysozyme-based peptidoglycan digestion that links phagocytosis, inflammasome activation, and IL-1β secretion. Cell Host Microbe 7:38–49 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B56] 56. Shoji M, et al. 2011. walK and clpP mutations confer reduced vancomycin susceptibility in Staphylococcus aureus. Antimicrob. Agents Chemother. 55:3870–3881 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B57] 57. Smith JG, et al. 2004. A search for amino acid substitutions that universally activate response regulators. Mol. Microbiol. 51:887–901 [DOI] [PubMed] [Google Scholar]

[B58] 58. Soutourina O, Dubrac S, Poupel O, Msadek T, Martin-Verstraete I. 2010. The pleiotropic CymR regulator of Staphylococcus aureus plays an important role in virulence and stress response. PLoS Pathog. 6:e1000894 doi:10.1371/journal.ppat.1000894 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B59] 59. Steinhuber A, Görke C, Bayer MG, Doring G, Wolz C. 2003. Molecular architecture of the regulatory locus sae of Staphylococcus aureus and its impact on expression of virulence factors. J. Bacteriol. 185:6278–6286 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] 60. Sun F, et al. 2010. In the Staphylococcus aureus two-component system sae, the response regulator SaeR binds to a direct repeat sequence and DNA binding requires phosphorylation by the sensor kinase SaeS. J. Bacteriol. 192:2111–2127 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B61] 61. Toledo-Arana A, et al. 2005. Staphylococcus aureus develops an alternative, ica-independent biofilm in the absence of the arlRS two-component system. J. Bacteriol. 187:5318–5329 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B62] 62. Volz K. 1995. Structural and functional conservation in response regulators, p 53–64 In Hoch JA, Silhavy TJ. (ed), Two-component signal transduction. ASM Press, Washington, DC [Google Scholar]

[B63] 63. von Kockritz-Blickwede M, et al. 2008. Immunological mechanisms underlying the genetic predisposition to severe Staphylococcus aureus infection in the mouse model. Am. J. Pathol. 173:1657–1668 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B64] 64. Voyich JM, et al. 2009. The SaeR/S gene regulatory system is essential for innate immune evasion by Staphylococcus aureus. J. Infect. Dis. 199:1698–1706 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B65] 65. Watkins RL, Pallister KB, Voyich JM. 2011. The SaeR/S gene regulatory system induces a proinflammatory cytokine response during Staphylococcus aureus infection. PLoS One 6:e19939 doi:10.1371/journal.pone.0019939 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B66] 66. Wei H, et al. 2008. A study of the relationships between oligonucleotide properties and hybridization signal intensities from NimbleGen microarray datasets. Nucleic Acids Res. 36:2926–2938 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B67] 67. Weinrauch Y, Penchev R, Dubnau E, Smith I, Dubnau D. 1990. A Bacillus subtilis regulatory gene product for genetic competence and sporulation resembles sensor protein members of the bacterial two-component signal-transduction systems. Genes Dev. 4:860–872 [DOI] [PubMed] [Google Scholar]

[B68] 68. Wertheim HF, et al. 2005. The role of nasal carriage in Staphylococcus aureus infections. Lancet Infect. Dis. 5:751–762 [DOI] [PubMed] [Google Scholar]

[B69] 69. Zhang L, Jacobsson K, Vasi J, Lindberg M, Frykberg L. 1998. A second IgG-binding protein in Staphylococcus aureus. Microbiology 144:985–991 [DOI] [PubMed] [Google Scholar]

PERMALINK

The WalKR System Controls Major Staphylococcal Virulence Genes and Is Involved in Triggering the Host Inflammatory Response

Aurélia Delauné

Sarah Dubrac

Charlène Blanchet

Olivier Poupel

Ulrike Mäder

Aurélia Hiron

Aurélie Leduc

Catherine Fitting

Pierre Nicolas

Jean-Marc Cavaillon

Minou Adib-Conquy

Tarek Msadek

Roles

Abstract

INTRODUCTION

MATERIALS AND METHODS

Bacterial strains and growth conditions.

Table 1.

Plasmid and mutant construction.

Table 2.

Bacterial autolysis assays.

Biofilm formation assays.

Total RNA extraction.

cDNA synthesis and quantitative real-time PCRs (qRT-PCR).

Microarray experiments.

DNase I footprinting.

Macrophage survival assays.

Hemolytic activity assays.

Murine infection experiments.

Cell counting and flow cytometry.

Cytokine production in whole human blood.

Cytokine production assays.

PGN quantification in culture supernatants.

RESULTS

Constitutive activation of the WalR response regulator leads to increased autolysis, biofilm formation and hemolytic activity.

Fig 1.

Fig 2.

Expression profiling of the WalR regulon.

Table 3.

Table 4.

Fig 3.

Characterization of novel WalKR regulon cell wall metabolism genes.

Fig 4.

The WalKR system controls major staphylococcal virulence genes, including the SaeSR regulon.

Fig 5.

Table 5.

Constitutive activation of WalR strongly diminishes S. aureus virulence.

Fig 6.

WalR activation enhances triggering of the host innate immune inflammatory response.

Fig 7.

Constitutive WalR activity strongly lowers intracellular persistence of S. aureus in macrophages.

Fig 8.

Increased amounts of PGN in S. aureus walRc culture supernatants elicit inflammatory cytokine production in human blood.

Fig 9.

DISCUSSION

Fig 10.

Supplementary Material

ACKNOWLEDGMENTS

Footnotes

REFERENCES

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

Increased amounts of PGN in S. aureus walR^c culture supernatants elicit inflammatory cytokine production in human blood.