Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Sep 1.
Published in final edited form as: Anticancer Res. 2012 Sep;32(9):3733–3742.

Novel Vitamin D Hydroxyderivatives Inhibit Melanoma Growth and Show Differential Effects on Normal Melanocytes

ANDRZEJ T SLOMINSKI 1,2, ZORICA JANJETOVIC 1, TAE-KANG KIM 1, ADAM C WRIGHT 1, LAURA N GRESE 1, SAMUEL J RINEY 1, MINH N NGUYEN 3, ROBERT C TUCKEY 3
PMCID: PMC3458587  NIHMSID: NIHMS397013  PMID: 22993313

Abstract

Background/aims

To test the activity of novel hydroxyvitamin D3 analogs (20(OH)D3, 20,23(OH)2D and 1,20(OH)2D3) on normal and malignant melanocytes in comparison to 1,25(OH)2D3.

Materials/Methods

Human epidermal melanocytes and human and hamster melanoma cells were used to measure effects on proliferation and colony formation in monolayer and soft agar. Cell morphology and melanogenesis were also analyzed. QPCR was used to measure gene expression.

Results

Novel secosteroids inhibited proliferation and colony formation by melanoma cells in a similar fashion to 1,25(OH)2D3, having no effect on melanogenesis. These effects were accompanied by ligand-induced translocation of VDR to the nucleus. In normal melanocytes 1α-hydroxyderivatives (1,25(OH)2D3 and 1,20(OH)2D3) had stronger anti-proliferative effects than 20(OH)D3 and 20,23(OH)2D3, and inhibited dendrite formation. The cells tested expressed genes encoding VDR and enzymes that activate or inactivate vitamin D3.

Conclusion

Novel secosteroids show potent anti-melanoma activity in vitro with 20(OH)D3 and 20,23(OH)2D3 being excellent candidates for preclinical testing.

Keywords: 20-hydroxyvitamin D derivatives, melanoma, melanocytes, anti-proliferative activity

There is a significant public interest in vitamin D3 due to its wide beneficial effects in both prevention and therapy for various diseases including cancer (1, 4, 13, 23). These pleiotropic (not fully explained) effects are believed to be secondary to the action of 1,25-dihydroxyvitamin D3 (calcitriol; 1,25(OH)2D3), which is generated through sequential hydroxylation of vitamin D3 at positions C25 by CYP27A1 or CYP2R1, and C1 by CYP 27B1 (1, 4, 13, 23). Most recently we defined a previously unrecognized pathway of vitamin D metabolism, initiated by cytochrome P450scc (CYP11A1), that generates in vitro novel vitamin D hydroxyderivatives, different from the classical 1,25(OH)2D (27, 38, 42) (Figure 1). This pathway can also operate in vivo (31). The main product of CYP11A1-initiated metabolism of vitamin D3 is 20-hydroxyvitamin D3 (20(OH)D3) (11, 27). It can further be hydroxylated by CYP11A1 to 20,23-dihydroxyvitamin D3 (20,23(OH)2D3) and a number of other hydroxy-products (27, 41, 43). Both 20(OH)D3 and 20,23(OH)2D3 are biologically active, with anti-leukemic properties (30) and exhibit anti-proliferative and pro-differentiation activities in human epidermal keratinocytes (15, 16, 44), inhibiting NF-κB activity (14, 16). Importantly, 20(OH)D3 is non-toxic (non-calcemic) in rats (30) and mice (44) at doses as high as 3 μg/kg and 30 μg/kg, respectively. 20(OH)D can be hydroxylated to 1,20(OH)2D3 by CYP27B1 (32, 37) and 1,20(OH)D3 can also be produced from the 1(OH)D3 prodrug by hydroxylation at C20, mediated by P450scc (39) (Figure 1). Although 1,20(OH)D3 is biologically active, addition of the hydroxygroup in position 1α causes a partial calcemic activity (30).

Figure 1.

Figure 1

Open in a new tab

Structures and enzymatic methods of production of novel vitamin D3 hydroxy-derivatives.

Despite significant progress in understanding mechanisms defining malignant behavior of melanoma cells, there is still no therapy for metastic melanoma [reviewed in (9, 10)]. Although the use of B-RAF inhibitors leads to attenutation of the disease, it has undesirable site effects and there is a high recurrence rate due to development of resistance to BRAF inhibitors (9, 34). Other types of therapy are predominantly ineffective for metastatic melanoma (8, 9, 24). Therefore, there is a need to develop new strategies to manage this devastiting disease that has a high mortality rate.

The anti-melanoma activity of 1,25(OH)2D3 in vitro was established more than 30 years ago (5). Subsequent studies have also shown inhibitory effects of 1,25(OH)2D3 on some human melanoma lines cultured in vitro [reviewed in (6, 21, 36)]. A potential beneficial involvement of vitamin D is also indicated by the reverse correlation between serum levels of 25(OH)D or local cutaneous production of vitamin D and melanoma progression, and the markedly increased incidence of melanoma in patients having mutations in the vitamin D receptor (VDR) (reviewed in (6, 7, 21, 36)). Furthermore, recent clinicopathological studies demonstrate a decrease or loss of VDR or CYP27B1 expression during melanoma progression, with loss of either of these markers connected with an increased mortality rate (2, 3). These observations indicate that targetting VDR signaling may represent a promising strategy for malignant melanoma treatment. Therefore, we tested several melanoma lines for anti-melanoma activities of novel non-calcemic vitamin D3 derivatives derived from the action of CYP11A1. The biological activity of all these compounds was also tested on normal human epidermal melanocytes.

Materials and Methods

Materials

1,25(OH)2D3 was from Fluka Chemicals (Sigma-Aldrich, St. Louis, MO). 20(OH)D3 and 20,23(OH)2D3 were produced by the enzymatic hydroxylation of vitamin D3 catalyzed by CYP11A1, while 1,20(OH)2D3 was produced by CYP11A1-catalysed hydroxylation of 1(OH)D3, as described previously (40, 42). Products, extracted with dichloromethane, were first purified by preparative thin-layer chromatography, then further purified by reverse phase HPLC as detailed in (40, 42). The hydroxyderivatives of vitamin D3 were divided (5 μg/vial), dried and stored at –80°C until use. Stock solutions were prepared in ethanol at a concentration of 100 μM.

Cell culture

Human SKMEL-188 melanoma cells (gift from Dr Ashok Chokraborty, Yale University), established from a human metastatic melanoma, were maintained in Ham's F10 medium supplemented with glucose, L-glutamine, pyridoxine hydrochloride (Cellgrow, Manassas, VA), 5% fetal bovine serum (FBS) (Sigma, St. Louis, MO) and 1% penicillin/streptomycin/amphotericin antibiotic solution (Sigma, St. Louis, MO), as described previously (29). YUROB, YUKSI and YULAC human melanoma cells (gift of Dr. Ruth Halaban, Yale University) were cultured in Opti-MEM media supplemented with 10% serum (12). Human WM35, WM1341, WM164, WM98D and SBCE2 melanoma cells (gift of Dr Meenhard Herlyn from Wistar Intitute) and the hamster AbC1 melanoma line were cultured as described previously (22, 25). Normal humans epidermal melanocytes were established from foreskin of African-American donors following protocols described previously (32). They were grown in melanocyte MBM media supplemented with MGF (Lonza, Walkersville, MD)

Cell proliferation assays

To measure cell growth, human melanocytes (HEMn) and melanoma cells (SK Mel 188) were seeded in 25 cm2 flasks and grown until 80% confluent. Ham's F10 plus 5% charcoal-stripped FBS media was used for melanoma cells or MBM + MGF for melanocytes. The media were changed every third day and 100 nM of 1,25(OH)2D3, 20,23(OH)2D3, 1,20(OH)2D3, 20(OH)D3 or ethanol (solvent control) were added every day. After 7 days the cells were trypsinized, stained with Trypan blue, and viable cells were counted under the microscope.

Testing of DNA synthesis was carried out as described previously (17, 26). Cells were inoculated into 24-well plates at 5,000 cells/well. After overnight incubation at 37°C, the cultures were placed in serum-free media to synchronize cells at the G0/G1 phase of the cell cycle. After 24 h, vitamin D3 derivatives (100 nM) were added along with fresh media containing growth supplements and incubated for an additional 48 h. After a defined period of time, [3H]-thymidine (specific activity 88.0 Ci/mmol; Amersham Biosciences, Piscataway, NY, USA) was added to a final concentration of 0.5 μCi/mL in the medium. After 4 h of incubation at 37°C, media were discarded, cells precipitated in 10% TCA for 30 min, washed twice with 1 mL PBS and then incubated with 1 N NaOH/ 1% SDS (250 μL/well) for 30 min at 37°C. The extracts were collected in scintillation vials and 5 mL of scintillation cocktail was added. 3H-radioactivity incorporated into DNA was measured with a beta counter (Direct Beta-Counter Matrix 9600; Packard).

Colony forming assay

The assay followed standard methodology as described previously (19, 44). Briefly, cells were plated in 24-well plates at a density of 192 cells/well in medium containing 5% charcoal treated FBS, 1% antibiotic solution and vitamin D3 hydroxyderivatives at graded concentrations or vehicle control. After 10 days of culture with media changed every 3 days, the colonies were fixed with 4% paraformaldehyde and stained with 5% crystal violet. The number and size of the colonies were measured using an ARTEK counter 880 (Dynex Technologies Inc., Chantilly, VA). Colony forming units were calculated by dividing the number of colonies by the number of cells plated and then multiplying by 100.

Growth in soft agar

The tumorogenicity of human SKMEL-188 and hamster AbC1 melanoma cells was determined by their ability to form colonies in soft agar as previously described (33). Briefly, cells were detached from the flasks by trypsinization and re-suspended (~1,000 cells/well) in 250 μL medium containing 0.4% agarose and 5% charcoal-stripped serum (HyClone). Cell suspensions were placed on a 0.8% agar layer in 4×24 well plates. Compounds were added from ethanol stocks (100 μM) to final concentrations of 0.1 nM or 10 nM, in 100 μL media. Each condition was tested in quadruplicate. An ethanol solvent control (amount of ethanol equivalent to test) as well as a media-only control was included in the assay. Cells were allowed to grow at 37°C with 5% CO2 over two weeks with secosteroids in fresh media (100 μL) being added after every 72 h. Soft agar colonies were scored and stained with 0.5 mg/ml MTT reagent (Promega), 500 μL/well after two weeks. Colonies were then counted under the microscope.

Melanogenesis

Cell pigmentation was evaluated macroscopically, while tyrosinase activity (DOPA oxidase) was assayed in cell extracts as described previously (29).

VDR translocation

In order to determine VDR translocation from the cytoplasm to nucleus induced by hydroxyvitamin D3 compounds, SKMEL-188 cells were transduced with pLenti-CMV-VDR-EGFP-pgk-puro, resulting in stable expression of the VDR-EGFP fusion protein (32). The cells were incubated with hydroxyvitamin D3 derivatives for 2 h, followed by fixing with 4% paraformaldehyde and analyzed under a fluorescent microscope. The cells containing fluorescent nuclei were counted from the pictures taken from at least 6 different fields. Data are presented as a percentage of cells with fluorescent nuclei relative to the total cell number.

Quantitative PCR analysis

RNA from skin cells and tissue was isolated using an Absolutely RNA Miniprep Kit (Stratagen, USA). Reverse transcription was performed using a Transcriptor First Strand cDNA Synthesis Kit (Roche, USA). Real-time PCR was performed using cDNA and a Cyber Green Master Mix (n=3). Reactions were performed at 95°C for 5 min and then 50 cycles (95°C for 15 s, 60°C for 30 s and 72°C for 30 s). Data was collected on a Roche Light Cycler 480. The amounts were compared to a reference gene (Cyclophilin B) using a comparative CT method. Relative gene expression data were calculated using the ΔΔCt method. Changes in gene expression are presented as relative quantities using mean ΔCt (normalized target) as a difference between target gene and reference gene in the cycle of appearance in time (C). A list of primers is presented in Table I.

Table I.

Sequences of the primers used for qPCR.

Oligo Sequence
Cyclophilin B L TGTGGTGTTTGGCAAAGTTC
R GTTTATCCCGGCTGTCTGTC
CYP2R1 L AGCCTCATCCGAGCTTCC
R CCACAGTTGATATGCCTCCA
CYP11A1 L CCAGACCTGTTCCGTCTGTT
R AAAATCACGTCCCATGCAG
CYP27A1 L CAGTACGGAACGACATGGAG
R GGTACCAGTGGTGTCCTTCC
CYP27B1 L CTTGCGGACTGCTCACTG
R CGCAGACTACGTTGTTCAGG
CYP24 L CATCATGGCCATCAAAACAAT
R GCAGCTCGACTGGAGTGAC
VDR L CTTACCTGCCCCCTGCTC
R AGGGTCAGGCAGGGAAGT
Open in a new tab

Statistical analysis

Data are presented as mean±SD, and the analyzed with Student's t-test (for 2 groups) and appropriate post-hoc test (for more than 2 groups) using Prism 4.00 (GraphPad Software, San Diego). Statistically significant differences were considered when p<0.05.

Results

1,25(OH)2D3 and the novel vitamin D3 hydroxy-derivatives inhibited proliferation of normal and malignant melanocytes, with a differential effect noted for normal melanocytes (Figure 2). Specifically, 1,25(OH)2D3 and 1,20(OH)2D3 showed stronger inhibitory effects on melanocytes than 20,23(OH)2D3 and 20(OH)D3 (Figure 2A). In contrast, all compounds caused comparable inhibition of humam melanoma (SKMel-188) growth in vitro (Figure 2B). Furthermore, only 1,25(OH)2D3 and 1,20(OH)2D3, but not 20(OH)D3 and 20,23(OH)2D3, inhibited dendrite formation by normal melanocytes (Figure 2C). None of the compounds, including 1,25(OH)2D3, had a significant effect on pigmentation and tyrosinase activity in normal and malignant melanocytes (data not shown). A similar inhibitory effect of the secosteroids on DNA sysnthesis was observed in another human melanoma line, YUROB (Figure 3). Interestingly, 20(OH)D3, 20,23(OH)2D3 and 1,20(OH)2D3 caused greater inhibition than 1,25(OH)2D3 in this cell line. We also screened other human melanoma cell lines (YUKSI, YUTICA, YULAC, WM35, WM1341, WM164, WM98D and SBCE2), using the MTT assay to estimate the effects of 1,25(OH)2D3, 1,20(OH)2D3, 20(OH)D3 and 20,23(OH)2D3 on cell growth, and found that all of the compounds tested inhibited the growth of these lines in vitro (data not shown).

Figure 2.

Figure 2

Open in a new tab

Comparison of the anti-proliferative activity of the vitamin D derivatives 1,25(OH)2D3, 20(OH)D3, 20,23(OH)2D3 and 1,20(OH)2D3 between cultured normal human epidermal melanocytes (A) and human SKMel-188 melanoma cells (B). The cells were treated with the secosteroids (10–7 M) for 7 days and their numbers were counted. Data are shown as mean±SD (n=3); *p<0.05; **p<0.01; ***p<0.001. 1,25(OH)2D3 and 1,20(OH)2D3, but not 20(OH)D3 or 20,23(OH)2D3 inhibited dendrite formation (C). The differences between ethanol-treated control and treatments were analyzed by student's t-test

Figure 3.

Figure 3

Open in a new tab

Novel vitamin hydroxyderivatives inhibit DNA synthesis in human melanoma cells. YUROB cells were treated for 48 h with 1,25(OH)2D3, 20(OH)D3, 20,23(OH)2D3, or 1,20(OH)2D3 (10–7 M) and the rate of 3H-thymidine incorporation into DNA served as a measure of proliferative activity. Data are presented as mean±SD (n=4). Statistical significance was estimated using one-way ANOVA Incorporation into DNA is shown as a percentage (%) of control (ethanol-vehicle treated cells). *p<0.05 and ***p<0.001.

To better define the anti-melanoma activities of the novel secosteroids, we tested their effect on the ability to form colonies by human melanoma in monolayer (plating efficiency). We found a dose-dependent inhibitory effect for all compounds, with 1,25(OH)2D3 showing the highest potency (Figure 4). Finally, we tested the ability of the secosteroids to inhibit growth in soft agar (anchorage independent cell growth), and found that 20(OH)D3 and 20,23(OH)2D3 inhibited growth in soft agar of hamster (AbC1) (Figure 5) and human (SKMel-188) melanoma cells (Figure 6). Both of these compounds showed similar effects to those seen for 1,25(OH)2D3.

Figure 4.

Figure 4

Open in a new tab

Novel vitamin D hydroxyderivatives inhibit the ability of human melanoma cells to form colonies in monolayer (platting efficiency). SBCE2 cells were plated at a density 20 cells/cm2, grown in the presence or absence of 1,25(OH)2D3, 20,23(OH)2D3 or 1,20(OH)2D3, and after 10 days formation of colonies larger than 0.2 mm (A) or 0.5 mm (B) in diameter was determined. Data are shown as mean±SD (n = 4); statistical significance was estimated using one-way ANOVA and presented as *p<0.05, **p<0.01 and ***p<0.001. Insert shows Western blot detection of VDR in SBCE2 human melanoma cells. The whole extracts from cells were subjected to immunoblotting with anti- VDR, and anti- β-actin (internal control) as described before (3). The numbers on the left in the insert represent molecular weight in kD.

Figure 5.

Figure 5

Open in a new tab

Novel vitamin hydroxyderivatives inhibit the anchorage independent growth (ability to form colonies in soft agar) of hamster melanoma cells. AbC1 melanoma cells were plated in soft agar at 1,000 cells/well and grown in the presence or absence of 1,25(OH)2D3, 20(OH)D3 or 20,23(OH)2D3. After two weeks colonies with a diameter larger than 0.2 mm (A) or 0.5 mm (B) were counted. Data are shown as mean±SD (n=4); statistical significance was estimated using one-way ANOVA and presented as *p<0.05, **p<0.01 and ***p<0.001.

Figure 6.

Figure 6

Open in a new tab

Novel vitamin hydroxyderivatives inhibit the anchorage independent growth (ability to form colonies in soft agar) of human melanoma cells. SKMel-188 human melanoma cells were grown in soft agar in the presence or absence of 1,25(OH)2D3 (A), 20(OH)D3 (B) or 20,23(OH)2D3 (C). Panels A and B are from from the same whilke panel C for separate experiment. After two weeks colonies with a diameter larger than 0.5 mm were counted. Data are shown as mean±SD (n=4); statistical significance was estimated using one-way ANOVA and presented as *p<0.05 and **p<0.001. Insert: representative plates incubated with solvent (ethanol) or 10–7 M secosteroids.

Using the previously described melanoma line transfected via lentivirus with the VDR-GFP construct (18, 32), we found that the novel secosteroids induced translocation of VDR from the cytoplams to the nucleus (Figure 7), consistent with the action of VDR. We also screened human melanoma lines for the expression of genes encoding 25-hydroxylases (CYP27A1 and CYP2R1), 1α-hydroxylase (CYP27B1), 24-hydroxylase (CYP24), cytochrome P450scc (CYP11A1) and VDR; although all of these genes were found to be expressed, there was a considerable variation between the different melanoma lines tested (Table II).

Figure 7.

Figure 7

Open in a new tab

The effect of vitamin D3 derivatives on the translocation of VDR from the cytoplasm to the nucleus. The panel on the right shows photographs of the cells with fluorescent VDR-EGFP fusion protein in the nucleus. The left pannel shows the percentage of cells with fluorescent nuclei. Data are presented as means±SEM (n≥6). The differences between ethanol-treated control and treatment were analyzed by student's t-test: p<0.05 (*), p<0.01 (**).

Table II.

Expression of genes encoding VDR and enzymes metabolising vitamin D3.

Cell Line CYP11A1 CYP27A1 CYP27B1 CYP2R1 CYP24 VDR
WM98D 0.92±0.24 2.95±0.64 3.08±0.23 3.08±0.23 –1.71±0.32 6.55±0.62
YUROB –3.74±0.24 6.42±0.34 5.46±0.23 5.46±0.23 1.14±0.30 8.15±0.3
YULAC 1.83±0.45 10.68±0.78 4.98±0.29 4.98±0.29 1.03±0.30 5.55±0.3
WM164 9.14±0.11 8.96±0.06 16.28±0.14 19.83±0.1 11.28±0.11 3.56±0.11
WM1341 15.28±0.18 7.90±0.03 15.53±0.23 13.93±0.09 11.56±0.28 4.53±0.19
SK Mel 188 5.24±0.28 –2.51±0.36 5.24±0.28 5.24±0.28 –11±0.35 5.24±0.28
SBCE2 15.46±0.69 8.78±0.32 12.85±0.16 11.04±0.13 5.61±0.47 8.69±0.13
Open in a new tab

Real-time PCR was performed using cDNA and a Cyber Green Master Mix (n=3). The amounts were compared to a reference gene (Ciclophilin B) using a comparative CT method. Changes in gene expression are presented as a relative quantity using mean ΔCt (normalized target) as a difference between the target gene and the reference gene in the cycle of appearance in time (C). The lower the number, the higher is the expression level.

Discussion

In this study we showed for the first time that novel vitamin D3 hydroxyderivatives generated by the action of CYP11A1 display differential phenotypic effects against normal epidermal melanocytes and human and hamster melanoma lines. Thus, the classical hormonally active form of vitamin D3, 1,25(OH)2D3, and novel 1,20(OH)D3 significantly inhibited proliferation of normal epidermal melanocytes and inhibited dendrite formation. 20(OH)D3 and 20,23(OH)2D3 displayed a lower inhibitory effect on proliferation and no effect on cell morphology. This selectivity was absent in human melanoma, where all compounds inhbibited proliferation by a similar degree with no effect on cell morphology.

P450scc hydroxylates vitamin D3 (D3) in a sequential fashion: D3→20(OH)D3→20,23(OH)2D3 (31, 43). In addition, 20(OH)D3 in vitro and in vivo is hydroxylated by CYP27B1 in position 1α (the same enzyme that generates 1,25(OH)2D3) to produce 1,20(OH)2D3 (32, 37). Our previous studies have shown that addition of a hydroxyl group to C1α modifies the action of the parental 20(OH)D by producing some calcemic activity and increasing the ability to stimulate CYP24 expression (30, 32). In these studies we showed that addition of 1α-hydroxyl group increases the ability of 20(OH)D3 to modulate the phenotype of normal melanocytes in a similar way to 1,25(OH)2D3. However, proliferation of melanoma cells is inhibited in a similar manner by compounds without a 1α-hydroxyl group, which is similar to the effects described in leukemias (30) and normal keratinocytes (39).

1,25(OH)2D3 is a recognized inhibitor of melanoma proliferation acting in context-dependent fashion, making vitamin D a good candidate to treat skin cancers [reviewed in (6, 7, 36)]. Unfortunately, pharmacological use of vitamin D or its analogs is limited because of hypercalcemic effects causing secondary organ failure and possible death (35). Thus the major obstacle in using 1,25(OH)2D3 for melanoma treatment is its small therapeutic window defined by its calcemic effects. The CYP11A1-derived 20(OH)D is noncalcemic at doses as high as 3-4 μg/kg in rats (30, 32) and 30 μg/kg in mice (44). We have also observed that 20,23(OH)2D3 is non-calcemic in mice (unpublished). Our initial studies also demonstrated that 20(OH)D3 and related 20(OH)D2 show anti-proliferative activity towards the human SKMel-188 melanoma line (14, 32). In this study we extended the spectrum of melanoma lines and parameters tested and found inhibitory effects of 20(OH)D3 as well as the previously untested 20,23(OH)2D3 in 10 human melanoma lines. Using selected human melanoma cell lines we showed that both 20(OH)D3 and 20,23(OH)2D3 inhibit plating efficience as well as the ability to grow in soft agar, illustrating their anti-tumorogenic activity. We also found that 20(OH)D3 and 20,23(OH)2D3 inhibit growth of the hamster melanoma line AbC1 in soft agar with a slightly stronger effect for 20(OH)2D3. This identifies this line, as well as human lines SBCE2, SKMel-188 and YUROB, as excellent testing models for planned preclinical studies in animals. We also excluded from further testing the mouse S91 Cloudman line that did not respond or responded poorly to vitamin D3 derivatives, which is consistent with other reports on this cell line [reviewed in (36)].

The phenotypic effects of vitamin D3 are mediated trough an interaction with VDR, and the activity of vitamin D3 depends on its sequetial hydroxylations by CYP27A1 or CYP2R1, and CYP27B1 (classical activating), and CYP24 (classical inactivating) pathways (13, 23). This study showed that the novel secosteroids tested stimulate VDR translocation from the cytoplasm to the nucleus, confirming our previous finding of activation of VDR by CYP11A1-derived vitamin D analogues (18, 32). Expression of genes encoding the enzyme that metabolize vitamin D was heterogenous without a clear association with a significant modulatory effect. Since all melanoma lines tested express CYP11A1, we believe that exogenously added 20(OH)D3 enters metabolic pathways mediated by this enzyme with production of other equi-or potentially more potent compounds, including 20,23(OH)2D3. This is further rationalized by our previous finding that 20(OH)D is a relatively poor substrate for CYP27B1 (32, 37), and our demonstration that phenotypic activity of 20(OH)D2 does not require its activation in position 1α (32). The role of 25- and 24-hydroxylases on the activity of 20(OH)D3, remains to be tested.

There are conflicting reports on regulation of melanin pigmentation by 1,25(OH)2D3 [reviewed in (28, 36)]. In the present study we observed a lack of a significant effect (stimulation or inhibition) of 1,25(OH)2D3 and novel vitamin D3 analogs on melanogenesis in pure cultures of melanocytes or melanoma cells. This is in agreement with studies published by others showing lack of such an effect in cell culture (20). However, we cannot entirely exclude a role of vitmain D3 on the regulation of melanin pigmentation in vivo because 1,25(OH)2D3 and 1,20(OH)2D3 inhibited the formation of dendrites, which are involved in the transfer of melanosomes to the keratinocytes. Nevertheless, the lack of effect of 20(OH)D3 and 20,23(OH)2D3 on these functions indicate that the vitamin D derivatives without a hydroxyl group at C1α are not involved in regulation of melanin pigmentation.

In conclusion, we have shown that novel non-calcemic 20(OH)D3 and 20,23(OH)2D3 demonstrate potent anti-melanoma activity in vitro with lesser effects on normal melanocytes. Both 20(OH)D3 and 20,23(OH)2D3 are excellent candidates for preclinical testing, since they are non-calcemic and non-toxic, and they also show anti-cancer activity on leukemia, breast and liver cancers (30, 44).

Acknowledgements

This work was supported by NIH [Grant R01AR052190] and in part by [Grant 1R01AR056666-01A2], both to AS.

References

  • 1.Bikle DD. Vitamin D metabolism and function in the skin. Mol Cell Endocrinol. 2011;347:80–89. doi: 10.1016/j.mce.2011.05.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Brozyna AA, Jozwicki W, Janjetovic Z, Slominski AT. Expression of vitamin D activating enzyme 1-alpha-hydroxylase (CYP27B1) decreases during melanoma progression. Hum Pathol. 2012 doi: 10.1016/j.humpath.2012.03.031. In press. doi:10.1016/j.humpath.2012.03.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Brożyna AA, Jozwicki W, Janjetovic Z, Slominski AT. Expression of vitamin D receptor decreases during progression of pigmented skin lesions. Hum Pathol. 2011;42:618–631. doi: 10.1016/j.humpath.2010.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Carlberg C, Molnar F. Current status of vitamin D signaling and its therapeutic applications. Curr Top Med Chem. 2012;12:528–547. doi: 10.2174/156802612799436623. [DOI] [PubMed] [Google Scholar]
  • 5.Colston K, Colston MJ, Feldman D. 1,25-dihydroxyvitamin D3 and malignant melanoma: the presence of receptors and inhibition of cell growth in culture. Endocrinology. 1981;108:1083–1086. doi: 10.1210/endo-108-3-1083. [DOI] [PubMed] [Google Scholar]
  • 6.Denzer N, Vogt T, Reichrath J. Vitamin D receptor (VDR) polymorphisms and skin cancer: A systematic review. Dermatoendocrinol. 2011;3:205–210. doi: 10.4161/derm.3.3.16519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Egan KM. Vitamin D and Melanoma. Annals Epidemiol. 2009;19:455–461. doi: 10.1016/j.annepidem.2009.01.005. [DOI] [PubMed] [Google Scholar]
  • 8.Finn L, Markovic SN, Joseph RW. Therapy for metastatic melanoma: the past, present, and future. BMC Med. 2012;10:23. doi: 10.1186/1741-7015-10-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Flaherty KT. Targeting metastatic melanoma. Annu Rev Med. 2012;63:171–183. doi: 10.1146/annurev-med-050410-105655. [DOI] [PubMed] [Google Scholar]
  • 10.Flaherty KT, Hodi FS, Fisher DE. From genes to drugs: targeted strategies for melanoma. Nat Rev Cancer. 2012;12:349–361. doi: 10.1038/nrc3218. [DOI] [PubMed] [Google Scholar]
  • 11.Guryev O, Carvalho RA, Usanov S, Gilep A, Estabrook RW. A pathway for the metabolism of vitamin D3: unique hydroxylated metabolites formed during catalysis with cytochrome P450scc (CYP11A1). Proc Natl Acad Sci USA. 2003;100:14754–14759. doi: 10.1073/pnas.2336107100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Halaban R, Zhang W, Bacchiocchi A, Cheng E, Parisi F, Ariyan S, Krauthammer M, McCusker JP, Kluger Y, Sznol M. PLX4032, a selective BRAF(V600E) kinase inhibitor, activates the ERK pathway and enhances cell migration and proliferation of BRAF melanoma cells. Pigment Cell Melanoma Res. 2010;23:190–200. doi: 10.1111/j.1755-148X.2010.00685.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Holick MF. Vitamin D deficiency. N Engl J Med. 2007;357:266–281. doi: 10.1056/NEJMra070553. [DOI] [PubMed] [Google Scholar]
  • 14.Janjetovic Z, Brozyna AA, Tuckey RC, Kim TK, Nguyen MN, Jozwicki W, Pfeffer SR, Pfeffer LM, Slominski AT. High basal NF-kappaB activity in nonpigmented melanoma cells is associated with an enhanced sensitivity to vitamin D3 derivatives. Br J Cancer. 2011;105:1874–1884. doi: 10.1038/bjc.2011.458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Janjetovic Z, Tuckey RC, Nguyen MN, Thorpe EM, Jr, Slominski AT. 20,23-dihydroxyvitamin D3, novel P450scc product, stimulates differentiation and inhibits proliferation and NF-kappaB activity in human keratinocytes. J Cell Physiol. 2010;223:36–48. doi: 10.1002/jcp.21992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Janjetovic Z, Zmijewski MA, Tuckey RC, DeLeon DA, Nguyen MN, Pfeffer LM, Slominski AT. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes. PLoS One. 2009;4:e5988. doi: 10.1371/journal.pone.0005988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kim TK, Chen J, Li W, Zjawiony J, Miller D, Janjetovic Z, Tuckey RC, Slominski A. A new steroidal 5,7-diene derivative, 3beta-hydroxyandrosta-5,7-diene-17beta-carboxylic acid, shows potent anti-proliferative activity. Steroids. 2010;75:230–239. doi: 10.1016/j.steroids.2009.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kim TK, Wang J, Janjetovic Z, Chen J, Tuckey RC, Nguyen MN, Tang EK, Miller D, Li W, Slominski AT. Correlation between secosteroid-induced vitamin D receptor activity in melanoma cells and computer-modeled receptor binding strength. Mol Cell Endocrinol. 2012. In press. http://dx.doi.org/10.1016/j.mce.2012.04.001. [DOI] [PMC free article] [PubMed]
  • 19.Li W, Chen J, Janjetovic Z, Kim TK, Sweatman T, Lu Y, Zjawiony J, Tuckey RC, Miller D, Slominski A. Chemical synthesis of 20S-hydroxyvitamin D3, which shows anti-proliferative activity. Steroids. 2010;75:926–935. doi: 10.1016/j.steroids.2010.05.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mansur CP, Gordon PR, Ray S, Holick MF, Gilchrest BA. Vitamin D, its precursors, and metabolites do not affect melanization of cultured human melanocytes. J Invest Dermatol. 1988;91:16–21. doi: 10.1111/1523-1747.ep12463282. [DOI] [PubMed] [Google Scholar]
  • 21.Pinczewski J, Slominski A. The potential role of vitamin D in the progression of benign and malignant melanocytic neoplasms. Exp Dermatol. 2010;19:860–864. doi: 10.1111/j.1600-0625.2010.01169.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Pisarchik A, Slominski AT. Alternative splicing of CRH-R1 receptors in human and mouse skin: identification of new variants and their differential expression. FASEB J. 2001;15:2754–2756. doi: 10.1096/fj.01-0487fje. [DOI] [PubMed] [Google Scholar]
  • 23.Plum LA, DeLuca HF. Vitamin D, disease and therapeutic opportunities. Nat Rev Drug Discov. 2010;9:941–955. doi: 10.1038/nrd3318. [DOI] [PubMed] [Google Scholar]
  • 24.Ribas A, Hersey P, Middleton MR, Gogas H, Flaherty KT, Sondak VK, Kirkwood JM. New challenges in endpoints for drug development in advanced melanoma. Clin Cancer Res. 2012;18:336–341. doi: 10.1158/1078-0432.CCR-11-2323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Slominski A, Moellmann G, Kuklinska E, Bomirski A, Pawelek J. Positive regulation of melanin pigmentation by two key substrates of the melanogenic pathway, L-tyrosine and L-dopa. J Cell Sci. 1988;89(Pt 3):287–296. doi: 10.1242/jcs.89.3.287. [DOI] [PubMed] [Google Scholar]
  • 26.Slominski A, Semak I, Wortsman J, Zjawiony J, Li W, Zbytek B, Tuckey RC. An alternative pathway of vitamin D metabolism. Cytochrome P450scc (CYP11A1)-mediated conversion to 20-hydroxyvitamin D2 and 17,20-dihydroxyvitamin D2. FEBS J. 2006;273:2891–2901. doi: 10.1111/j.1742-4658.2006.05302.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Slominski A, Semak I, Zjawiony J, Wortsman J, Li W, Szczesniewski A, Tuckey RC. The cytochrome P450scc system opens an alternate pathway of vitamin D3 metabolism. FEBS J. 2005;272:4080–4090. doi: 10.1111/j.1742-4658.2005.04819.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Slominski A, Tobin DJ, Shibahara S, Wortsman J. Melanin Pigmentation in Mammalian Skin and Its Hormonal Regulation. Physiol Rev. 2004;84:1155–1228. doi: 10.1152/physrev.00044.2003. [DOI] [PubMed] [Google Scholar]
  • 29.Slominski A, Zbytek B, Slominski R. Inhibitors of melanogenesis increase toxicity of cyclophosphamide and lymphocytes against melanoma cells. Int J Cancer. 2009;124:1470–1477. doi: 10.1002/ijc.24005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Slominski AT, Janjetovic Z, Fuller BE, Zmijewski MA, Tuckey RC, Nguyen MN, Sweatman T, Li W, Zjawiony J, Miller D, Chen TC, Lozanski G, Holick MF. Products of vitamin D3 or 7-dehydrocholesterol metabolism by cytochrome P450scc show anti-leukemia effects, having low or absent calcemic activity. PLoS One. 2010;5:e9907. doi: 10.1371/journal.pone.0009907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Slominski AT, Kim T-K, Shehabi HZ, Semak I, Tang EKY, Nguyen MN, Benson HAE, Korik E, Janjetovic Z, Chen J, Yates CR, Postlethwaite A, Li W, Tuckey RC. In vivo evidence for a novel pathway of vitamin D3 metabolism initiated by P450scc and modified by CYP27B1. FASEB J. doi: 10.1096/fj.12-208975. doi: 10.1096/fj.12-208975.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Slominski AT, Kim TK, Janjetovic Z, Tuckey RC, Bieniek R, Yue J, Li W, Chen J, Nguyen MN, Tang EK, Miller D, Chen TC, Holick M. 20-Hydroxyvitamin D2 is a noncalcemic analog of vitamin D with potent anti-proliferative and prodifferentiation activities in normal and malignant cells. Am J Physiol Cell Physiol. 2011;300:C526–541. doi: 10.1152/ajpcell.00203.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Slominski AT, Zmijewski MA, Semak I, Sweatman T, Janjetovic Z, Li W, Zjawiony JK, Tuckey RC. Sequential metabolism of 7-dehydrocholesterol to steroidal 5,7-dienes in adrenal glands and its biological implication in the skin. PLoS One. 2009;4:e4309. doi: 10.1371/journal.pone.0004309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sosman JA, Kim KB, Schuchter L, Gonzalez R, Pavlick AC, Weber JS, McArthur GA, Hutson TE, Moschos SJ, Flaherty KT, Hersey P, Kefford R, Lawrence D, Puzanov I, Lewis KD, Amaravadi RK, Chmielowski B, Lawrence HJ, Shyr Y, Ye F, Li J, Nolop KB, Lee RJ, Joe AK, Ribas A. Survival in BRAF V600-mutant advanced melanoma treated with vemurafenib. N Engl J Med. 2012;366:707–714. doi: 10.1056/NEJMoa1112302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Spina CS, Tangpricha V, Uskokovic M, Adorinic L, Maehr H, Holick MF. Vitamin D and cancer. Anticancer Res. 2006;26:2515–2524. [PubMed] [Google Scholar]
  • 36.Szyszka P, Zmijewski MA, Slominski AT. New vitamin D analogs as potential therapeutics in melanoma. Expert Rev Anticancer Ther. 2012;12:585–599. doi: 10.1586/era.12.40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tang EK, Voo KJ, Nguyen MN, Tuckey RC. Metabolism of substrates incorporated into phospholipid vesicles by mouse 25-hydroxyvitamin D3 1alpha-hydroxylase (CYP27B1). J Steroid Biochem Mol Biol. 2010;119:171–179. doi: 10.1016/j.jsbmb.2010.02.022. [DOI] [PubMed] [Google Scholar]
  • 38.Tieu EW, Li W, Chen J, Baldisseri DM, Slominski AT, Tuckey RC. Metabolism of cholesterol, vitamin D3 and 20-hydroxyvitamin D3 incorporated into phospholipid vesicles by human CYP27A1. J Steroid Biochem Mol Biol. 2012;129:163–171. doi: 10.1016/j.jsbmb.2011.11.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Tuckey RC, Janjetovic Z, Li W, Nguyen MN, Zmijewski MA, Zjawiony J, Slominski A. Metabolism of 1alpha-hydroxyvitamin D3 by cytochrome P450scc to biologically active 1alpha,20-dihydroxyvitamin D3. J Steroid Biochem Mol Biol. 2008 doi: 10.1016/j.jsbmb.2008.10.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Tuckey RC, Janjetovic Z, Li W, Nguyen MN, Zmijewski MA, Zjawiony J, Slominski A. Metabolism of 1alpha-hydroxyvitamin D3 by cytochrome P450scc to biologically active 1alpha,20-dihydroxyvitamin D3. J Steroid Biochem Mol Biol. 2008;112:213–219. doi: 10.1016/j.jsbmb.2008.10.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Tuckey RC, Li W, Shehabi HZ, Janjetovic Z, Nguyen MN, Kim TK, Chen J, Howell DE, Benson HA, Sweatman T, Baldisseri DM, Slominski A. Production of 22-hydroxy metabolites of vitamin D3 by cytochrome p450scc (CYP11A1) and analysis of their biological activities on skin cells. Drug Metab Dispos. 2011;39:1577–1588. doi: 10.1124/dmd.111.040071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tuckey RC, Li W, Zjawiony JK, Zmijewski MA, Nguyen MN, Sweatman T, Miller D, Slominski A. Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc. FEBS J. 2008;275:2585–2596. doi: 10.1111/j.1742-4658.2008.06406.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wang J, Slominski A, Tuckey RC, Janjetovic Z, Kulkarni A, Chen J, Postlethwaite AE, Miller D, Li W. 20-hydroxyvitamin D inhibits proliferation of cancer cells with high efficacy while being non-toxic. Anticancer Res. 2012;32:739–746. [PMC free article] [PubMed] [Google Scholar]
  • 44.Zbytek B, Janjetovic Z, Tuckey RC, Zmijewski MA, Sweatman TW, Jones E, Nguyen MN, Slominski AT. 20-Hydroxyvitamin D3, a product of vitamin D3 hydroxylation by cytochrome P450scc, stimulates keratinocyte differentiation. J Invest Dermatol. 2008;128:2271–2280. doi: 10.1038/jid.2008.62. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES