Abstract
Background
The DNA demethylating agent 5-aza-2′-deoxycytidine (5-aza-CdR) incorporates into DNA and decreases DNA methylation, sparking interest in its use as a potential therapeutic agent. We aimed to determine the effects of maternal 5-aza-CdR treatment on embryo implantation in the mouse and to evaluate whether these effects are associated with decreased levels of DNA methyltransferases (Dnmts) and three genes (estrogen receptor α [Esr1], progesterone receptor [Pgr], and homeobox A10 [Hoxa10]) that are vital for control of endometrial changes during implantation.
Methods and Principal Findings
Mice treated with 5-aza-CdR had a dose-dependent decrease in number of implantation sites, with defected endometrial decidualization and stromal cell proliferation. Western blot analysis on pseudo-pregnant day 3 (PD3) showed that 0.1 mg/kg 5-aza-CdR significantly repressed Dnmt3a protein level, and 0.5 mg/kg 5-aza-CdR significantly repressed Dnmt1, Dnmt3a, and Dnmt3b protein levels in the endometrium. On PD5, mice showed significantly decreased Dnmt3a protein level with 0.1 mg/kg 5-aza-CdR, and significantly decreased Dnmt1 and Dnmt3a with 0.5 mg/kg 5-aza-CdR. Immunohistochemical staining showed that 5-aza-CdR repressed DNMT expression in a cell type–specific fashion within the uterus, including decreased expression of Dnmt1 in luminal and/or glandular epithelium and of Dnmt3a and Dnmt3b in stroma. Furthermore, the 5′ flanking regions of the Esr1, Pgr, and Hoxa10 were hypomethylated on PD5. Interestingly, the higher (0.5 mg/kg) dose of 5-aza-CdR decreased protein expression of Esr1, Pgr, and Hoxa10 in the endometrium on PD5 in both methylation-dependent and methylation-independent manners.
Conclusions
The effects of 5-aza-CdR on embryo implantation in mice were associated with altered expression of endometrial Dnmts and genes controlling endometrial changes, suggesting that altered gene methylation, and not cytotoxicity alone, contributes to implantation defects induced by 5-aza-CdR.
Introduction
The nucleoside analog 5-aza-2′-deoxycytidine (5-aza-CdR) is a potent DNA demethylating agent that has been widely used to demonstrate the correlation between demethylation and reactivation of specific genes [1]. 5-Aza-CdR induces cell cycle arrest, cell differentiation, and cell death mainly by inhibiting post-replication methylation of DNA. In mice, exposure to 5-aza-CdR during development alters gene expression, causes malformations, and suppresses growth; administration of 5-aza-CdR to pregnant mice or rats at mid- or late-gestational periods elicits multiple characteristic defects [2]–[4].
Among the DNA cytosine-5-methyltransferase (Dnmt) family of DNA methylases, three members (Dnmt1, 3a, and 3b) have been shown to mediate the cytotoxic effects of 5-aza-CdR in mammals [5], [6]. 5-Aza-CdR inhibits DNMT and demethylates DNA by incorporation into DNA [1], degradation of DNMT [7], downregulation of DNMT mRNA and protein levels [8]–[11], or repression of DNMT enzymatic activity [11], [12], leading to changes in gene reactivation. 5-Aza-CdR also downregulates gene expression independently of DNA methylation [9], [13]–[17].
Embryo implantation is a critical step in embryo development and pregnancy outcome. To enable implantation, the uterus goes through changes that prepare it to receive the embryo. Recent studies have suggested that DNA methylation may be involved in endometrial change during periimplantation stages. For instance, mRNA levels of Dnmt1, Dnmt3a, and Dnmt3b are altered according to the phase of the menstrual cycle [18], [19]. Several genes are regulated by DNA methylation in relevant cell types, including estrogen receptor 2 (ESR2) [20], paired box gene 2 (PAX2) [21], E-cadherin [22], and S100A4 [23] in endometrial cells, and killer cell immunoglobulin-like receptor 3DL3 (KIR3DL3) in natural killer cells [24]. In addition, human endometrial stromal cells treated with 5-aza-CdR showed significantly enhanced expression of 76 genes by microarray analysis, including two established decidualization marker genes. These expression patterns are similar to those of cells treated with medroxyprogesterone acetate [25].
Currently, the effect of 5-aza-CdR on mouse endometrial gene expression, DNA methylation, and embryo implantation from the beginning of fertilization is unknown. Here, we investigated whether the effect of 5-aza-CdR on embryo implantation in mice was associated with endometrial DNMT expression. We also investigated the effect of 5-aza-CdR on methylation of the flanking regions of estrogen receptor α (Esr1), progesterone receptor (Pgr), and homeobox A10 (Hoxa10), which have key roles in implantation, and examined expression of their encoded proteins in mouse endometrium [26], [27] following 2 or 4 days of 5-aza-CdR administration.
Results
5-Aza-CdR Reduced the Number of Implantation Sites and Impaired Decidualization, and Stromal Cell Proliferation
On D5 (after 4 days of treatment), the number of embryo implantation sites did not differ significantly between control mice and those treated with 0.1 mg/kg 5-aza-CdR (p = 0.249), but was greatly reduced in mice treated with 0.5 mg/kg 5-aza-CdR (p<0.001; Figure 1A–D). On D5, there were no differences in embryonic appearance or weight between the three treatment groups (data not shown). Hematoxylin and eosin staining of longitudinal uterine sections on D7 after 4 days treatment with 5-aza-CdR, indicates defected development of uterus during post-implantation period in mice treated by 0.5 mg/kg 5-aza-CdR (Figure 1E–G). Alkaline phosphatase activity is an indicator of stromal cell differentiation in response to decidualization [28], which is a vital step during implantation [29]. The oil-induced decidualized endometria on PD6 of mice treated with 0.1 mg/kg 5-aza-CdR for 4 days showed strong alkaline phosphatase activity, whereas the endometria of mice treated at 0.5 mg/kg had no detectable alkaline phosphatase activity (Figure 1H–J). In addition, an increase in the presence of Ki67-positive cells on PD6 indicated a decrease in proliferation of endometrial stromal cells in mice treated at 0.5 mg/kg for 4 days; there was no significant difference in the number of Ki67-positive cells in endometrial stroma of control mice versus mice treated at 0.1 mg/kg (Figure 1K–N).
5-Aza-CdR Repressed Dnmt Protein Expression
Because 5-aza-CdR is an inhibitor of DNA methyltransferases, we analyzed Dnmt1, Dnmt3a, and Dnmt3b protein expression in mouse endometrium after 2 days (PD3) and 4 days (PD5) of treatment with 5-aza-CdR. On PD3, western blot analysis showed that 0.1 mg/kg 5-aza-CdR significantly repressed Dnmt3a expression (p<0.001) compared to the control, but did not significantly alter Dnmt1 (p = 0.129) or Dnmt3b (p = 0.167) expression. In contrast, 0.5 mg/kg 5-aza-CdR significantly repressed all three Dnmts (p<0.01 each). On PD5, the 0.1 mg/kg dose led to a decrease only in Dnmt3a protein (p<0.01), and the 0.5 mg/kg dose repressed Dnmt1 (p<0.01) and Dnmt3a (p<0.001), but Dnmt3b was not significantly repressed at either dose (p = 0.154 at 0.1 mg/kg; p = 0.105 at 0.5 mg/kg; Figure 2).
We next examined tissue sections to determine whether 5-aza-CdR affected Dnmt expression in a cell type–specific fashion within the uterus. On PD3, mice treated at 0.1 and 0.5 mg/kg showed a repressed Dnmt1 protein level in stroma compared to control mice, with no changes in the luminal or glandular epithelium (Figure 3A–C). On PD5, mice showed a decreased Dnmt1 protein level in stroma at 0.1 and 0.5 mg/kg 5-aza-CdR, and repressed expression in luminal epithelium at 0.5 mg/kg (Figure 3D–F). On PD3 and PD5, mice showed reduced expression of Dnmt3a in stroma, but not in luminal or glandular epithelium, at 0.1 and 0.5 mg/kg 5-aza-CdR (Figure 3G–L). On PD3, mice showed no change in Dnmt3b protein level in stroma at 0.1 or 0.5 mg/kg 5-aza-CdR, but showed decreased expression in luminal and glandular epithelia at 0.5 mg/kg (Figure 3M–O). On PD5, Dnmt3b protein levels were unchanged in stroma, luminal epithelia, and glandular epithelia at both doses (Figure 3P–R). These results are summarized in Table 1.
Table 1. Localization of DNA methyltransferases (Dnmts) in mouse endometrium following treatment with 5-aza-2′-deoxycytidine.
Protein | 5-aza-CdR (mg/kg) | Day of pseudo-pregnancy | Stroma | Luminal epithelium | Glandular epithelium |
Dnmt1 | 0 | PD3 | ++ | + | + |
PD5 | + | + | + | ||
0.1 | PD3 | + | + | + | |
PD5 | − | + | + | ||
0.5 | PD3 | − | + | + | |
PD5 | − | − | + | ||
Dnmt3a | 0 | PD3 | +++ | +++ | +++ |
PD5 | ++ | +++ | +++ | ||
0.1 | PD3 | ++ | +++ | +++ | |
PD5 | + | +++ | +++ | ||
0.5 | PD3 | + | +++ | +++ | |
PD5 | + | +++ | +++ | ||
Dnmt3b | 0 | PD3 | ++ | ++ | ++ |
PD5 | − | + | + | ||
0.1 | PD3 | ++ | ++ | ++ | |
PD5 | − | + | + | ||
0.5 | PD3 | ++ | + | + | |
PD5 | − | + | + |
−, no staining; +, weak staining; ++, moderate staining; and +++, strong staining.
5-Aza-CdR Reduced Methylation of Hoxa10, a Gene that Controls Endometrial Change
To investigate whether a 5-aza-CdR affects methylation in flanking regions of genes that are vital for endometrial changes in mouse embryo implantation, we used BSP to quantitatively assess the methylation status of each CpG site in the flanking regions of three genes: estrogen receptor α (Esr1), progesterone receptor (Pgr), and homeobox A10 (Hoxa10). For each group (control and 0.5 mg/kg 5-aza-CdR), we randomly selected five clones of each gene region from each of three mice, resulting in 15 BSP analyses for each gene (Figure 4A–C). For Esr1 (Figure 4A), there were 19 CpG sites spanning –73 to +327 nt of the promoter and 5′-UTR (exon 1). For Pgr (Figure 4B), there were 16 CpG sites spanning +119 to +396 nt of the 5′-UTR (exon 1). For Hoxa10, there were 21 CpG sites spanning –386 to +8 nt of the promoter and 5′-UTR (exon 1). The percentages of total methylated CpG sites in Esr1, Pgr, and Hoxa10 in control mice were 2.807%, 3.750%, and 10.159%, respectively, indicating the baseline hypomethylation status of these regions. Compared to these controls, 0.5 mg/kg 5-aza-CdR significantly reduced methylation of the Hoxa10 region (2.540%, p<0.001), but had no significant effect on Esr1 (1.053%, p = 0.128) or Pgr (2.500%, p = 0.431).
5-Aza-CdR Decreased Expression of Proteins that Control Endometrial Change
We examined the expression of Esr1, Pgr, and Hoxa10 protein in the endometrium on PD5 using western blot analysis. This revealed that Hoxa10 was significantly repressed at both 0.1 and 0.5 mg/kg 5-aza-CdR, and that Esr1 and Pgr were repressed only at 0.5 mg/kg 5-aza-CdR (Figure 5). Immunohistochemistry revealed that Esr1 was reduced in stroma and glandular epithelium (Figure 6A, B), and Pgr (Figure 6C, D) and Hoxa10 (Figure 6E, F) were reduced in stroma at 0.5 mg/kg 5-aza-CdR. These results are summarized in Table 2.
Table 2. Localization of Esr1, Pgr, and Hoxa10 in mouse endometrium following 4 days of 5-aza-2′-deoxycytidine treatment.
Protein | 5-aza-CdR (mg/kg) | Stroma | Luminal epithelium | Glandular epithelium |
Esr1 | ||||
0 | + | − | +++ | |
0.5 | − | − | ++ | |
Pgr | ||||
0 | +++ | +++ | +++ | |
0.5 | ++ | +++ | +++ | |
Hoxa10 | ||||
0 | +++ | − | − | |
0.5 | ++ | − | − |
−, no staining; +, weak staining; ++, moderate staining; and +++, strong staining.
Discussion
It has been shown that intrauterine insult during mid- to late-gestation using the anti-cancer agent and cytidine analog 5-aza-CdR causes temporally related defects in the developing mouse [3], [30]. Our results showed a significantly decreased number of embryo implantation sites on PD5 in mice treated daily with 0.5 mg/kg 5-aza-CdR on PD1–4. Further results showed that the proliferation of endometrial stromal cells was significantly reduced and decidualization was impaired in these mice. Endometrial stromal cell proliferation and differentiation are key processes for successful implantation [31]. Hence, our study indicates that the cytotoxic effects of 5-aza-CdR on embryo implantation might be associated with reduced stromal cell proliferation and differentiation (decidualization). This cytotoxicity of 5-aza-CdR results from its capacity to cause DNA damage, as 5-aza-CdR is a nucleoside analog that can be incorporated into the DNA backbone, which may in turn induce formation of a covalent adduct between the 5-aza-CdR molecule and DNMTs [1].
In addition to its cytotoxic function, 5-aza-CdR demethylates DNA and thereby alters gene expression through DNMT activity, and has been widely used to demonstrate how DNA methylation affects biological processes previously thought to be regulated primarily by genetic factors [1], [7], [11], [12]. The present results show that 5-aza-CdR affected Dnmt expression in a time- and dose-dependent manner in mouse endometrium. Moreover, repression of Dnmt in the endometrium was found to be cell specific. Therefore, it is possible that one or more critical methylation factors may be involved in regulating the cellular response to 5-aza-CdR treatment, and these may vary by cell type in endometrium. Previous studies have shown a significant role for DNA methylation in regulating endometrial changes associated with implantation. Relatively high levels of DNMT1, DNMT3A, and DNMT3B expression are seen in the proliferative phase of the human endometrium, with lower expression in the second secretory phase; this expression pattern is essential for human endometrial changes throughout the reproductive cycle [18], [19]. Recently we found that expression of mouse Dnmt1, Dnmt3a, and Dnmt3b was decreased during the receptive phase compared with the prereceptive phase, and that implantation sites showed significantly lower levels of Dnmt3a mRNA and protein [32]. These observations provide further support for the role of DNA methylation in endometrial changes during embryo implantation. Thus, we suggest that the effect of 5-aza-CdR on implantation might be associated with DNA demethylation through repression of Dnmt expression.
Esra, Pgr, and Hoxa10 are essential genes controlling uterine receptivity and decidualization, and their aberrant expression results in implantation defects in mammals [33]–[37]. We found repressed expression of Esr1, Pgr, and Hoxa10 and subsequent defective uterine decidualization in 5-aza-CdR-treated mice, which may explain the implantation failure. Promoter hypermethylation plays a major role in repressing ESR1 [38]–[40] and PGR [41]–[45] expression in human tumors. The HOXA10 promoter is also susceptible to methylation in the endometria of women wearing intrauterine devices [46], in patients with ovarian cancer [47] or endometriosis [48], and in the uteri of mice exposed to diethylstilbestrol [49]. In general, DNA methylation blocks gene expression, whereas demethylation (e.g., with 5-aza-CdR) activates gene expression. Treatment with 5-aza-CdR reactivated the expression of ESR1, PGR, and HOXA10 from their repressed state in the above studies [38]–[49]. However, we found that Esr1, Pgr, and Hoxa10 had reduced expression with hypomethylated promoters after treatment with 5-aza-CdR. This finding suggests that 5-aza-CdR plays diverse roles in cells, including demethylating functions as well as methylation-independent functions [50]. Our results agree well with previous findings that 5-aza-CdR may inhibit gene expression in a methylation-independent manner. Cx31, Cx43, Cx45, Cdh1, and Ctnnb1 are all repressed by 5-aza-CdR in preimplantation embryos [9]. 5-Aza-CdR decreases expression of MDR1 mRNA in K562/ADM cells [13]. In addition, microchip assays revealed a large number of genes downregulated in human endometrial stromal cells [25] and different cancer cells following 5-aza-CdR treatment [14]–[17].
The mechanism by which 5-aza-CdR decreases gene expression is still unknown, and few studies have addressed this question. Stability of estrogen receptor mRNA is decreased through modulation of HuR (Hu Antigen R) in ER-positive MCF7 cells following 5-aza-CdR treatment [51], which might explain why Esr1 was suppressed by 5-aza-CdR. It has been also found that 5-aza-CdR incorporates into DNA; this may inhibit template function and chain elongation [52], inhibit DNA polymerase α in opposition to the normal substrate deoxycytidine 5′-triphosphate [53], and induce DNA damage in a dose-dependent manner [50]. In addition, the 5-aza-CdR analog 5-aza-cytidine (5-aza-C) induces formation of DNMT-DNA adducts at the DNA replication fork in vivo [54], [55]. We suggest that 5-aza-CdR-induced DNMT-DNA adducts may affect DNA replication and expression of Esr1, Pgr, and Hoxa10 as well.
In conclusion, we showed that the effects of 5-aza-CdR on embryo implantation may be due to both cytotoxicity in stromal cell proliferation and differentiation. 5-aza-CdR may interfere with endometrial expression of Dnmts and genes vital for implantation, thereby leading to significant inhibition of embryo implantation.
Materials and Methods
Ethics Statement
All experiments involving animals were approved by the Ethics Committee of Chongqing Medical University (Permit Number: 20110016).
Animals
Kunming mice were purchased from Laboratory Animal Centre, Chongqing Medical University and were housed in separate cages with a 12-h light/dark cycle. Female mice (8–10 wks, 20–24 g) were mated with fertile or vasectomized male mice and checked for vaginal plugs at 0700–0800 the next morning; the presence of a vaginal plug was used to designate day 1 of pregnancy (D1) or pseudo-pregnancy (PD1).
Experimental Design
Control pregnant mice (n = 18) served as embryo donors. Induced pseudo-pregnant mice were randomly assigned to four treatment groups (n = 24 each) that received daily intraperitoneal injections [3] of sterile isotonic saline (control) or 5-aza-CdR (0.1 or 0.5 mg/kg; Sigma, St. Louis, MO, USA). Treatment began on PD1 (pseudo-pregnant day 1, first day of the presence of a vaginal plug) and continued for 2 or 4 days to ensure the continual effect of the drug, as it has a short half-life in vivo. Six mice from each treatment group received embryo transfer on PD4; each mouse received ten embryos with normal appearance from control pregnant mice. To minimize the effects of 5-aza-CdR on preimplanted embryos, embryo transfer was performed 2 hr after the last 5-aza-CdR treatment on PD4. Twelve pseudo-pregnant mice from each treatment group were sacrificed for tissue collection on PD3 and PD5 (n = 6 each). The remaining six female mice were used for artificial decidualization, and 10 µl of sesame oil was injected into each horn in the morning of PD4. Implantation sites were counterstained by intravenous injection with Chicago Blue B solution, 15 min prior to sacrifice.
Western Blot Analysis
Fragments of endometrial tissues were obtained by finely scraping the luminal wall of the uterus of pseudo-pregnant mice on PD5. Endometrial tissues (200 mg) were weighed and homogenized in cell lysis buffer (Beyotime, Shanghai, China). Protein aliquots (30 µg) were mixed with SDS-sample loading buffer and heated at 100°C for 10 min. Protein was separated by 10% (w/v) SDS-PAGE and electrotransferred onto nitrocellulose membranes (Bio-Rad Laboratories, Foster City, CA, USA), which were incubated in blocking buffer (20 mM Tris, pH 7.6, 137 mM NaCl, 0.05% (v/v) Tween 20, and 10% nonfat dry milk) for 2 h and then incubated at 4°C overnight with primary polyclonal rabbit antibodies against Dnmt1, Dnmt3a, Dnmt3b (Santa Cruz Biotechnology, Santa Cruz, CA, USA; all 1∶400) and Pgr (Abcam, San Francisco, CA, USA; 1∶500), or monoclonal antibodies against Esr1 and β-actin (Abcam; both 1∶1000), or goat antibody against Hoxa10 (Santa Cruz, 1∶200). After three washes with blocking buffer, membranes were incubated with horseradish peroxidase-conjugated rabbit anti-goat or goat anti-rabbit IgG secondary antibody (both 1∶200, Zhongshan Golden Bridge, Beijing, China). After additional washes, immunoreactive bands were visualized using enhanced chemiluminescence reagents (Beyotime). Densitometry was performed using Quantity One v4.4.0 (Bio-Rad Laboratories) with β-actin as a loading control.
Histologic and Immunohistochemical Staining
Uterine tissues were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 12 hr, air-dried, and embedded in paraffin. Sections (4 µm thick) were cut, mounted on slides, deparaffinized with a graded series of xylene, and rehydrated in a descending graded alcohol series. Sections were immersed in 0.1 M citrate buffer and boiled for 15 min in a microwave for antibody retrieval. Once the slides had cooled at room temperature, they were washed for 10 min in TBST (Tris-buffered saline, pH 7.6, with 1% (w/v) Tween 20) and rinsed in distilled H2O. Sections were blocked in 3% H2O2/methanol for 10 min at room temperature, incubated with blocking solution containing 10% normal goat or rabbit serum in TBST for 30 min at room temperature, then incubated with primary antibodies for Dnmt1, Dnmt 3a, Dnmt 3b, Hoxa10 (Santa Cruz Biotechnology; 1∶100, 1∶200, 1∶100, and 1∶50, respectively), Pgr and Esr1 (Abcam; 1∶200 and 1∶300, respectively) or Ki67 (Millipore, Temecula, CA, USA; 1∶300) overnight at 4°C. Sections were washed three times with TBST, then incubated with secondary antibody (biotinylated goat anti-rabbit or rabbit anti-goat IgG, Zhongshan Goldenbridge, 1∶200) for 1 h at room temperature. After one wash, sections were analyzed using the StrepABC horseradish peroxidase kit (Beyotime). Negative controls were created in parallel by replacing the primary antibody with PBS. All sections were lightly counterstained with hematoxylin and eosin (Beyotime). Image-Pro Plus (Media Cybernetics, Bethesda, MD, USA) was used to quantify images. The intensity of Dnmt staining was classified as no staining (–), weak staining (+), moderate staining (++), or strong staining (+++).
Bisulfite Sequencing PCR (BSP)
Genomic DNA was extracted from frozen endometrial tissue of control and 5-aza-CdR-treated mice (n = 3 each) using a standard DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA). Genomic DNA (1 mg) was modified by bisulfite to convert unmethylated cytosines to uracil using the Methylamp DNA Modification Kit (Epigentek, Brooklyn, NY, USA). Bisulfite-modified DNA was dissolved in 20 µl water and stored at −80°C. The flanking regions () of Esr1, Pgr, and Hoxa10, were sequenced by BSP using primers listed in Table 3. PCR was carried out at 98°C for 4 min, followed by 20 cycles of 94°C for 45 s, 66°C (−0.5°C each cycle) for 45 s, and 72°C for 1 min, with a final incubation at 72°C for 7 min. The resulting first-stage PCR product was amplified using 20 additional cycles of 94°C for 45 s, 56°C for 45 s, and 72°C for 1 min, with a final incubation at 72°C for 8 min. PCR products were purified using the QIAquick PCR purification kit (Qiagen) and sequenced by Sangon Biotechnology.
Table 3. Primers for bisulfite-sequencing PCR.
Gene | Primer sets | Accession numbera |
Esr1 | Forward 5′ GGGAGGGGTTGTTAAGTGTT 3′ | NM_007956.4 |
Reverse 5′ CCCAAAACCCTCTCCATAA 3′ | ||
Pgr | Forward 5′ GAGAATTTAGGGAGTTATAGAGATTG 3′ | NM_008829.2 |
Reverse 5′ CG(A)TAAAATCTCCACCTCCTA 3′ | ||
Hoxa10 | Forward 5′ TATGGGAGTATTTAAGGTTGGTTG 3′ | NM_008263.3 |
Reverse 5′ CATTTCTTATACAAAACATACTAAATAC 3′ |
Genebank accession number.
Alkaline Phosphatase Staining
Isolated fresh uterine tissues on PD6 were fixed in 2% paraformaldehyde in PBS for 20 min and then cryoprotected in 30% sucrose/PBS for 18 hr at 4°C. Sections (4 µm thick) were cut and embedded in OCT compound (Sakura Finetek, Torrance, CA, USA), and stained with 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium chloride (both from Beyotime), and counterstained with Nuclear Fast Red (Beyotime).
Statistical Analysis
Comparisons between two or more groups were made using Fisher’s exact test, t test, and analysis of variance. The CpG methylation rates of genes were analyzed by the Fisher’s exact test. Pearson’s or Spearman’s rank correlation coefficient was used for evaluating correlation between two variables. To see whether 5-aza-CdR treatment or other possible factors were responsible for the change in implantation before and after the treatment, a multiple linear regression model was used. A p value <0.05 was considered statistically significant.
Supporting Information
Funding Statement
This work was supported by the National Natural Science foundation of China (number 30700898), the Natural Science Foundation Project of CQ CSTC (numbers 2009BA5082, 2009BB5271, and 2011jjA10085), and Excellent Doctoral Dissertation of Chongqing Medical University. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Juttermann R, Li E, Jaenisch R (1994) Toxicity of 5-aza-2′-deoxycytidine to mammalian cells is mediated primarily by covalent trapping of DNA methyltransferase rather than DNA demethylation. Proc Natl Acad Sci U S A 91: 11797–11801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Schmahl W, Torok P, Kriegel H (1984) Embryotoxicity of 5-azacytidine in mice. Phase- and dose-specificity studies. Arch Toxicol 55: 143–147. [DOI] [PubMed] [Google Scholar]
- 3. Rosen MB, Chernoff N (2002) 5-Aza-2′-deoxycytidine-induced cytotoxicity and limb reduction defects in the mouse. Teratology 65: 180–190. [DOI] [PubMed] [Google Scholar]
- 4. Cisneros FJ, Branch S (2003) 5-AZA-2′-deoxycytidine (5-AZA-CdR): a demethylating agent affecting development and reproductive capacity. J Appl Toxicol 23: 115–120. [DOI] [PubMed] [Google Scholar]
- 5. Oka M, Meacham AM, Hamazaki T, Rodic N, Chang LJ, et al. (2005) De novo DNA methyltransferases Dnmt3a and Dnmt3b primarily mediate the cytotoxic effect of 5-aza-2′-deoxycytidine. Oncogene 24: 3091–3099. [DOI] [PubMed] [Google Scholar]
- 6. Jung Y, Park J, Kim TY, Park JH, Jong HS, et al. (2007) Potential advantages of DNA methyltransferase 1 (DNMT1)-targeted inhibition for cancer therapy. J Mol Med (Berl) 85: 1137–1148. [DOI] [PubMed] [Google Scholar]
- 7. Ghoshal K, Datta J, Majumder S, Bai S, Kutay H, et al. (2005) 5-Aza-deoxycytidine induces selective degradation of DNA methyltransferase 1 by a proteasomal pathway that requires the KEN box, bromo-adjacent homology domain, and nuclear localization signal. Mol Cell Biol 25: 4727–4741. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 8. Deng T, Zhang Y (2009) 5-Aza-2′-deoxycytidine reactivates expression of RUNX3 by deletion of DNA methyltransferases leading to caspase independent apoptosis in colorectal cancer Lovo cells. Biomed Pharmacother 63: 492–500. [DOI] [PubMed] [Google Scholar]
- 9. Yu JN, Xue CY, Wang XG, Lin F, Liu CY, et al. (2009) 5-AZA-2′-deoxycytidine (5-AZA-CdR) leads to down-regulation of Dnmt1o and gene expression in preimplantation mouse embryos. Zygote 17: 137–145. [DOI] [PubMed] [Google Scholar]
- 10. Ding L, Qiu L, Zhang J, Guo B (2009) Camptothecin-induced cell proliferation inhibition and apoptosis enhanced by DNA methyltransferase inhibitor, 5-aza-2′-deoxycytidine. Biol Pharm Bull 32: 1105–1108. [DOI] [PubMed] [Google Scholar]
- 11. Qiu YY, Mirkin BL, Dwivedi RS (2002) Differential expression of DNA-methyltransferases in drug resistant murine neuroblastoma cells. Cancer Detect Prev 26: 444–453. [DOI] [PubMed] [Google Scholar]
- 12. Benbrahim-Tallaa L, Waterland RA, Dill AL, Webber MM, Waalkes MP (2007) Tumor suppressor gene inactivation during cadmium-induced malignant transformation of human prostate cells correlates with overexpression of de novo DNA methyltransferase. Environ Health Perspect 115: 1454–1459. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Ando T, Nishimura M, Oka Y (2000) Decitabine (5-Aza-2′-deoxycytidine) decreased DNA methylation and expression of MDR-1 gene in K562/ADM cells. Leukemia 14: 1915–1920. [DOI] [PubMed] [Google Scholar]
- 14. Gius D, Cui H, Bradbury CM, Cook J, Smart DK, et al. (2004) Distinct effects on gene expression of chemical and genetic manipulation of the cancer epigenome revealed by a multimodality approach. Cancer Cell 6: 361–371. [DOI] [PubMed] [Google Scholar]
- 15. Schmelz K, Sattler N, Wagner M, Lubbert M, Dorken B, et al. (2005) Induction of gene expression by 5-Aza-2′-deoxycytidine in acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS) but not epithelial cells by DNA-methylation-dependent and -independent mechanisms. Leukemia 19: 103–111. [DOI] [PubMed] [Google Scholar]
- 16. Yap OW, Bhat G, Liu L, Tollefsbol TO (2009) Epigenetic modifications of the Estrogen receptor beta gene in epithelial ovarian cancer cells. Anticancer Res 29: 139–144. [PMC free article] [PubMed] [Google Scholar]
- 17. Arai M, Yokosuka O, Hirasawa Y, Fukai K, Chiba T, et al. (2006) Sequential gene expression changes in cancer cell lines after treatment with the demethylation agent 5-Aza-2′-deoxycytidine. Cancer 106: 2514–2525. [DOI] [PubMed] [Google Scholar]
- 18. Yamagata Y, Asada H, Tamura I, Lee L, Maekawa R, et al. (2009) DNA methyltransferase expression in the human endometrium: down-regulation by progesterone and estrogen. Hum Reprod 24: 1126–1132. [DOI] [PubMed] [Google Scholar]
- 19.Vincent ZL, Farquhar CM, Mitchell MD, Ponnampalam AP (2011) Expression and regulation of DNA methyltransferases in human endometrium. Fertil Steril 95: 1522–1525 e1521. [DOI] [PubMed]
- 20. Xue Q, Lin Z, Cheng YH, Huang CC, Marsh E, et al. (2007) Promoter methylation regulates estrogen receptor 2 in human endometrium and endometriosis. Biol Reprod 77: 681–687. [DOI] [PubMed] [Google Scholar]
- 21. Wu H, Chen Y, Liang J, Shi B, Wu G, et al. (2005) Hypomethylation-linked activation of PAX2 mediates tamoxifen-stimulated endometrial carcinogenesis. Nature 438: 981–987. [DOI] [PubMed] [Google Scholar]
- 22. Rahnama F, Thompson B, Steiner M, Shafiei F, Lobie PE, et al. (2009) Epigenetic regulation of E-cadherin controls endometrial receptivity. Endocrinology 150: 1466–1472. [DOI] [PubMed] [Google Scholar]
- 23. Xie R, Loose DS, Shipley GL, Xie S, Bassett RL Jr, et al. (2007) Hypomethylation-induced expression of S100A4 in endometrial carcinoma. Mod Pathol 20: 1045–1054. [DOI] [PubMed] [Google Scholar]
- 24. Trundley AE, Hiby SE, Chang C, Sharkey AM, Santourlidis S, et al. (2006) Molecular characterization of KIR3DL3. Immunogenetics 57: 904–916. [DOI] [PubMed] [Google Scholar]
- 25. Logan PC, Ponnampalam AP, Rahnama F, Lobie PE, Mitchell MD (2010) The effect of DNA methylation inhibitor 5-Aza-2′-deoxycytidine on human endometrial stromal cells. Hum Reprod 25: 2859–2869. [DOI] [PubMed] [Google Scholar]
- 26. Tan J, Paria BC, Dey SK, Das SK (1999) Differential uterine expression of estrogen and progesterone receptors correlates with uterine preparation for implantation and decidualization in the mouse. Endocrinology 140: 5310–5321. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Ramathal CY, Bagchi IC, Taylor RN, Bagchi MK (2010) Endometrial decidualization: of mice and men. Semin Reprod Med 28: 17–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Taylor HS, Arici A, Olive D, Igarashi P (1998) HOXA10 is expressed in response to sex steroids at the time of implantation in the human endometrium. J Clin Invest 101: 1379–1384. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Finn CA, Martin L (1972) Endocrine control of the timing of endometrial sensitivity to a decidual stimulus. Biol Reprod 7: 82–86. [DOI] [PubMed] [Google Scholar]
- 30. Branch S, Francis BM, Brownie CF, Chernoff N (1996) Teratogenic effects of the demethylating agent 5-aza-2′-deoxycytidine in the Swiss Webster mouse. Toxicology 112: 37–43. [DOI] [PubMed] [Google Scholar]
- 31. Sun X, Zhang L, Xie H, Wan H, Magella B, et al. (2012) Kruppel-like factor 5 (KLF5) is critical for conferring uterine receptivity to implantation. Proc Natl Acad Sci U S A 109: 1145–1150. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Ding YB, He JL, Liu XQ, Chen XM, Long CL, et al.. (2012) Expression of DNA methyltransferases in the mouse uterus during early pregnancy and susceptibility to dietary folate deficiency. Reproduction: in press. [DOI] [PubMed]
- 33. Benson GV, Lim H, Paria BC, Satokata I, Dey SK, et al. (1996) Mechanisms of reduced fertility in Hoxa-10 mutant mice: uterine homeosis and loss of maternal Hoxa-10 expression. Development 122: 2687–2696. [DOI] [PubMed] [Google Scholar]
- 34. Lim H, Ma L, Ma WG, Maas RL, Dey SK (1999) Hoxa-10 regulates uterine stromal cell responsiveness to progesterone during implantation and decidualization in the mouse. Mol Endocrinol 13: 1005–1017. [DOI] [PubMed] [Google Scholar]
- 35. Zhu LJ, Cullinan-Bove K, Polihronis M, Bagchi MK, Bagchi IC (1998) Calcitonin is a progesterone-regulated marker that forecasts the receptive state of endometrium during implantation. Endocrinology 139: 3923–3934. [DOI] [PubMed] [Google Scholar]
- 36. Lessey BA, Palomino WA, Apparao KB, Young SL, Lininger RA (2006) Estrogen receptor-alpha (ER-alpha) and defects in uterine receptivity in women. Reprod Biol Endocrinol 4 Suppl 1 S9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP, Conneely OM (2000) Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 289: 1751–1754. [DOI] [PubMed] [Google Scholar]
- 38. Iwase H, Omoto Y, Iwata H, Toyama T, Hara Y, et al. (1999) DNA methylation analysis at distal and proximal promoter regions of the oestrogen receptor gene in breast cancers. Br J Cancer 80: 1982–1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Wiley A, Katsaros D, Chen H, Rigault de la Longrais IA, Beeghly A, et al. (2006) Aberrant promoter methylation of multiple genes in malignant ovarian tumors and in ovarian tumors with low malignant potential. Cancer 107: 299–308. [DOI] [PubMed] [Google Scholar]
- 40. Shen R, Tao L, Xu Y, Chang S, Van Brocklyn J, et al. (2009) Reversibility of aberrant global DNA and estrogen receptor-alpha gene methylation distinguishes colorectal precancer from cancer. Int J Clin Exp Pathol 2: 21–33. [PMC free article] [PubMed] [Google Scholar]
- 41. Wu Y, Starzinski-Powitz A, Guo SW (2008) Prolonged stimulation with tumor necrosis factor-alpha induced partial methylation at PR-B promoter in immortalized epithelial-like endometriotic cells. Fertil Steril 90: 234–237. [DOI] [PubMed] [Google Scholar]
- 42. Mirza S, Sharma G, Prasad CP, Parshad R, Srivastava A, et al. (2007) Promoter hypermethylation of TMS1, BRCA1, ERalpha and PRB in serum and tumor DNA of invasive ductal breast carcinoma patients. Life Sci 81: 280–287. [DOI] [PubMed] [Google Scholar]
- 43. Hill VK, Ricketts C, Bieche I, Vacher S, Gentle D, et al. (2011) Genome-wide DNA methylation profiling of CpG islands in breast cancer identifies novel genes associated with tumorigenicity. Cancer Res 71: 2988–2999. [DOI] [PubMed] [Google Scholar]
- 44. Walton TJ, Li G, Seth R, McArdle SE, Bishop MC, et al. (2008) DNA demethylation and histone deacetylation inhibition co-operate to re-express estrogen receptor beta and induce apoptosis in prostate cancer cell-lines. Prostate 68: 210–222. [DOI] [PubMed] [Google Scholar]
- 45. Wu Y, Strawn E, Basir Z, Halverson G, Guo SW (2006) Promoter hypermethylation of progesterone receptor isoform B (PR-B) in endometriosis. Epigenetics 1: 106–111. [DOI] [PubMed] [Google Scholar]
- 46. Lu Y, Nie J, Liu X, Guo SW (2010) Reduced expression and concomitant promoter hypermethylation of HOXA10 in endometrium from women wearing intrauterine devices. Fertil Steril 94: 1583–1588. [DOI] [PubMed] [Google Scholar]
- 47. Cheng W, Jiang Y, Liu C, Shen O, Tang W, et al. (2010) Identification of aberrant promoter hypomethylation of HOXA10 in ovarian cancer. J Cancer Res Clin Oncol 136: 1221–1227. [DOI] [PubMed] [Google Scholar]
- 48. Wu Y, Halverson G, Basir Z, Strawn E, Yan P, et al. (2005) Aberrant methylation at HOXA10 may be responsible for its aberrant expression in the endometrium of patients with endometriosis. Am J Obstet Gynecol 193: 371–380. [DOI] [PubMed] [Google Scholar]
- 49. Bromer JG, Wu J, Zhou Y, Taylor HS (2009) Hypermethylation of homeobox A10 by in utero diethylstilbestrol exposure: an epigenetic mechanism for altered developmental programming. Endocrinology 150: 3376–3382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Chai G, Li L, Zhou W, Wu L, Zhao Y, et al. (2008) HDAC inhibitors act with 5-aza-2′-deoxycytidine to inhibit cell proliferation by suppressing removal of incorporated abases in lung cancer cells. PLoS ONE 3: e2445. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Pryzbylkowski P, Obajimi O, Keen JC (2008) Trichostatin A and 5 Aza-2′ deoxycytidine decrease estrogen receptor mRNA stability in ER positive MCF7 cells through modulation of HuR. Breast Cancer Res Treat 111: 15–25. [DOI] [PubMed] [Google Scholar]
- 52. Sampath D, Rao VA, Plunkett W (2003) Mechanisms of apoptosis induction by nucleoside analogs. Oncogene 22: 9063–9074. [DOI] [PubMed] [Google Scholar]
- 53. Graham FL, Whitmore GF (1970) Studies in mouse L-cells on the incorporation of 1-beta-D-arabinofuranosylcytosine into DNA and on inhibition of DNA polymerase by 1-beta-D-arabinofuranosylcytosine 5′-triphosphate. Cancer Res 30: 2636–2644. [PubMed] [Google Scholar]
- 54. Ferguson AT, Vertino PM, Spitzner JR, Baylin SB, Muller MT, et al. (1997) Role of estrogen receptor gene demethylation and DNA methyltransferase.DNA adduct formation in 5-aza-2′deoxycytidine-induced cytotoxicity in human breast cancer cells. J Biol Chem 272: 32260–32266. [DOI] [PubMed] [Google Scholar]
- 55. Kuo HK, Griffith JD, Kreuzer KN (2007) 5-Azacytidine induced methyltransferase-DNA adducts block DNA replication in vivo. Cancer Res 67: 8248–8254. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.