Abstract
Using the zebrafish model we describe a previously unrecognized requirement for the transcription factor gata4 controlling embryonic angiogenesis. The development of a vascular plexus in the embryonic tail, the caudal hematopoietic tissue (CHT), fails in embryos depleted of gata4. Rather than forming a normal vascular plexus, the CHT of gata4 morphants remains fused, and cells in the CHT express high levels of osteogenic markers ssp1 and runx1. Definitive progenitors emerge from the hemogenic aortic endothelium, but fail to colonize the poorly vascularized CHT. We also found abnormal patterns and levels for the chemokine sdf1a in gata4 morphants, which was found to be functionally relevant, since the embryos also show defects in development of the lateral line, a mechano-sensory organ system highly dependent on a gradient of sdf1a levels. Reduction of sdf1a levels was sufficient to rescue lateral line development, circulation, and CHT morphology. The result was surprising since neither gata4 nor sdf1a is obviously expressed in the CHT. Therefore, we generated transgenic fish that conditionally express a dominant-negative gata4 isoform, and determined that gata4 function is required during gastrulation, when it is co-expressed with sdf1a in lateral mesoderm. Our study shows that the gata4 gene regulates sdf1a levels during early embryogenesis, which impacts embryonic patterning and subsequently the development of the caudal vascular plexus.
Introduction
A characteristic feature of organ morphogenesis is the coordinated cell migration of groups of cells, resulting in the appropriate organ position, shape and size. The gata4 gene is known to play key roles in the development and maintenance of several organ systems, including those comprising cardiovascular, reproductive, and digestive tissues [1], [2]. The gross phenotype of the mouse Gata4 mutant is defective embryonic folding, caused indirectly due to unknown alterations in extra-embryonic endoderm [3], [4]. Conditional mouse mutants [5], [6], [7] and studies in zebrafish [8] defined functions for gata4 in early embryonic organ formation, including heart and liver. The mutants display morphogenetic defects, rather than a failure in cell specification or differentiation, because those functions are compensated by the sister genes gata5 and gata6 [9], [10]. The morphogenetic genes that gata4 regulates remain largely unknown, although they include cell cycle regulators [11] and signaling molecules including BMPs and WNT inhibitors [12], which can function by non-cell-autonomous mechanisms. Given the pleiotropic nature of the gata4 mutant phenotype, the question arises whether a common morphogenetic program controlled by gata4 functions in different organ systems, or if varied tissue-specific programs are downstream of gata4 to control development of distinct organ systems.
We developed a loss-of-function model for gata4 in the zebrafish system using anti-sense morpholinos to block expression of the gene during embryogenesis [8]. An advantage of the zebrafish model is that it lacks the requirement of gata4 in extra-embryonic tissues, which in the knockout mouse leads to early embryonic lethality. Zebrafish embryos depleted of gata4 are defective for normal heart tube growth and looping, with a phenotype remarkably similar to mouse embryos lacking Gata4 in the embryo proper, and rescued for extra-embryonic function by tetraploid complementation [8], [13]. In contrast to mouse mutants, the morphant fish embryos continue to survive even in the absence of a normal heart, and this allowed us to identify an additional function for gata4 in gut-derived organ growth. The finding that gata4 is needed for growth of both heart and gut-derived organs is not unexpected, since the gene is expressed in progenitors that contribute to these organ systems from early stages of embryogenesis. Here we revisit the phenotype of gata4 morphant embryos, and describe for the first time a function for gata4 in the development of the vascular system, specifically the caudal hematopoietic tissue (CHT). We show that gata4 regulates angiogenesis that normally forms this plexus during a “fetal-like” intermediate stage of hematopoiesis. This observation was unexpected because gata4 is not obviously expressed in the hematopoietic progenitors or the CHT.
Considering that the function of gata4 might be indirect, we discovered another previously uncharacterized phenotype, occurring in the lateral line of gata4 morphants. The lateral line is an ectodermal placode-derived system comprised of a set of pressure-sensitive sensory organs, the neuromasts, distributed in a stereotypic pattern along the body surface [14]. A major determinant of the collective cell migration required for lateral line development is the chemokine stromal-derived factor 1 or sdf1a (also called cxcl12a), mediated by cxcr4/cxcr7 chemokine receptor signaling [15], [16], [17], [18]. This ligand is well characterized as a chemo-attractant controlling the migration of neurons and primordial germ cells, lymphocyte trafficking, and hematopoietic stem cell (HSC) homing [19], [20], [21]. In the lateral line, the pathway coordinates the migration and timely deposition of collective groups of cells that form neuromasts. Therefore, chemokine signaling also regulates tissue migration and adherence in order to facilitate organ system development. We find that the novel functions for gata4 in angiogenesis and sensory organ development can both be ascribed to deregulated expression of the sdf1a gene.
Methods
Ethics Statement
The only animals used were zebrafish. All experiments using zebrafish were previously approved following full review of the Weill Cornell Medical College Institutional Animal Care and Use Committee (IACUC), on file as protocol 2011-0100, which expires February 2015. Weill Cornell Medical College operates its NIH approved Animal Care and Use program under the Animal Welfare Assurance number A3290-01.
Zebrafish Strains
Zebrafish were raised and staged according to Westerfield [22]. The tg(gata1:dsRed) line [23] was provided by Shou Lin (UCLA, Los Angeles, CA). The tg(fli1:egfp) [24] was purchased from the Zebrafish International Resource Center (Eugene, OR). The tg(claudinb:gfp) line [17] was provided by James Hudspeth (Rockefeller University, New York, NY). The tg(cd41:gfp) strain [25] was provided by Robert Handin (Brigham and Women’s Hospital, Boston, MA). The dominant-negative isoform for gata4 was generated essentially as described [26], but using the zebrafish gata4 cDNA clone for isolation of the DNA-binding domain, cloned in frame with the SR domain from mouse. A region of the zebrafish gata4 cDNA encompassing both zinc fingers and the entire DNA-binding domain (from amino acids 131–338) was isolated by PCR using primers that incorporated a stop codon and permitted in-frame fusion at the N-terminus with sequences encoding the strong repression domain (SR; amino acids 1–69) of the mouse Mxi1 gene, or a valine-proline mutation of the SR domain, SR-P [27]. PCR primers for gata4 were F: (TE2477), GAAGATCTTGGACGGCTTCGCAC.
R: (TE2476), AACTCGAGTTAGGATCCGCTTGGAGA.
The chimeric cDNA encoding a protein called SR-Gata4 was confirmed by sequencing. The chimeric cDNA was cloned into the middle entry vector in the Gateway Cloning Kit using the In-Fusion™ Advantage PCR kit (Clontech) and primers:
F: (TE2542), TATAGGGCGAATTGGGTACCATGGAGCGGGTGCGGATGATCAA,
R: (TE2543), GGGAACAAAAGCTGGAGCTCTTAGGATCCGCTTGGAGAGCCCATA and recombined with the hsp70I promoter vector and IRES driving RFP vector into the tol2 destination vector. DNA was co-injected with RNA encoding Tol2 recombinase, and potential F0 founders were tested for transmission of the transgene, and inducible expression of the sr-gata4 RNA. Several independent lines were isolated and maintained as tg(hsp70:sr-gata4). Characterization of SR and SR-P constructs was performed as described [26]. For gel mobility-shift experiments, the probe (top strand) was 5′-TCCATCTGATAAGACTTATCTGCTGCC. The same (unlabeled) sequence was used as specific competitor, while the control mutant sequence (top strand) was: 5′-TCCATCTCTTAAGACTTAAGTGCTGCC.
Morpholino Microinjection
All morpholinos were purchased from Gene-Tools, LLC. The sequence of the gata4 translation blocker is (5′-TCCACAGGTGAGCGATTATTGCTCC-3′). It was injected in concentrations ranging from 10–12 ng, which is sufficient to reproducibly generate the full range of morphant phenotypes in essentially 100% of the embryos. The morpholino targeting sdf1a is also a translation blocker, validated in multiple previous studies [16], [17], [18] and shown to phenocopy an sdf1a mutant; its sequence is 5′- TTGAGATCCATGTTTGCAGTGTGAA-3′. For rescue experiments, embryos were injected first with the gata4-specific morpholino, and a cohort of these morphants injected subsequently with the sdf1a-specific morpholino at concentrations between 0.25–4ng, which is below the threshold for generating an sdf1a morphant phenotype.
Whole Mount in-situ Hybridization and Di-2-ASP Staining
Whole mount in situ hybridization was performed as described [28]. Briefly, embryos were fixed in 4% paraformaldehyde at defined stages. Embryos were treated with 10 µg/ml proteinase K at 22C for 8 min (30 hpf), 10 min (36 hpf), or 20 min (48 hpf). Hybridization was performed at 70°C, in 57%–65% formamide buffer with digoxigenin-labeled anti-sense RNA probes. The l-plastin [29] and runx1 [30] probes were as described. Probes for sdf1a and spp1 were generated from full-length cDNA clones purchased from Open Biosystems.
To stain the lateral line neuromasts, 3–5 day old embryos were cultured in system water containing 5% BSA and 200 uM 4-[4-(diethylamino)styryl]-N-methylpyridinium iodide (4-Di-2-ASP, Invitrogen) for 5 minutes. They were then washed in system water, and observed under fluorescence using a GFP filter.
Microscopy
All in situ hybridization and 4-Di-2-Asp images were taken with a Nikon SMZ 1500 microscope using a Spot Insight Firewire digital camera and advanced Spot imaging software (Morell Instruments Company, NY). All other images were acquired with a Zeiss Observer.Z1 microscope and a Zeiss Axiocam digital camera (Carl Zeiss MicroImaging). The Axiovision40 V4.8.1 software was used to collect Z-stacks of the images which were then flattened by using the extended focus feature. For confocal analysis, fixed embryos were mounted in 1% low melt agarose (National Diagnostics) dissolved in water. Confocal images were taken with an Olympus Fluoview Microscope with a 60× lens and analyzed using Fluoview software. Images were processed with ImageJ (1.42 q), Imaris (Bitplane Inc.), and Adobe PhotoshopCS4 software.
Quantitative PCR
Total RNA was isolated from embryos using the RNeasy kit (Qiagen). First-strand cDNA synthesis was performed using the Superscript III kit (Invitrogen). The cDNA was analyzed with the Light Cycler 480 II SYBR green master mix (Roche), and using the Light Cycler 480 II machine (Roche). All samples were prepared in triplicate, and each experiment was repeated at least 3 times using independent batches of embryos. The PCR cycle conditions were 95°C for 5 minutes, (95°C for 10 seconds, 54°C for 10 seconds, and 72°C for 15 seconds) for 40 cycles. The data were analyzed to determine Cp values using the 2ΔΔT method [31], normalized to transcript levels for β-actin. Relative morphant transcript levels were quantified considering wild-type levels as 1. Primers were:
ae3globin, For: 5′-GACCTAAGCCCCAACTCTCC,
Rev: 5′-GTCAGCAAACCTCCCTTCAG
runx1, For: 5′- AGAGCTGACGGCGTTCAC, Rev: 5′- CATGGCTGACATGCCAATAC
lmo2, For: 5′- TGGGACGCAGGCTTTACTAC, Rev: 5′- AGTCCGTCCTGACCAAACAG
cmyb, For: 5′- TGATGCTTCCCAACACAGAG, Rev: 5′- AGGTATTTGTGCGTGGCTTC
sdf1a, For: 5′- ATTCGCGAGCTCAAGTTCC, Rev:5′- TGCACACCTCCTTGTTGTTC
bactin: For: 5′-GACAACGGCTCCGGTATG, Rev:5′-CATGCCAACCATCACTCC
Results
Gata4 Regulates Vascular Development
In a previous study [8], we noted that by 4 days post fertilization (dpf) there is a marked absence of blood flow through the improperly looped but still beating heart of the gata4 morphant embryo. This was unexpected since gata4 is not thought to be expressed in the hematopoietic system. Furthermore, although the morphant heart is abnormal, it continues to beat, and the embryonic morphant circulatory system is at least grossly normal. Therefore, we investigated the basis for the hematopoietic deficit. The initiation of hematopoiesis appears normal in gata4 morphants based on in situ hybridization experiments to detect transcripts for the erythroid transcription factor gata1 (not shown), and by imaging RFP+ cells in tg(gata1:dsRed) reporter fish (Fig. 1A–D). Also, in situ hybridization experiments using an l-plastin probe showed that early myelopoiesis is also not affected by loss of gata4 (Fig. 1E,F). Therefore, the initial generation of “primitive” waves of hematopoiesis is not regulated by gata4. Although the embryonic vasculature including angiogenesis of the intersomitic vessels (ISVs) is grossly intact (see Fig. 2), the heart defect could lead to a loss of blood flow and pooling of the blood at later stages. We used quantitative flow cytometry experiments to compare the number of erythroid cells in control and gata4 morphant embryos derived from tg(gata1:dsRed) reporter fish. In morphants, the number of RFP+ cells is significantly decreased by 4 dpf to a level on average of 53% the number in control embryos (n = 14 independent batches, p<0.001). The embryos live for several more days, but hematopoiesis does not recover. As in the mouse, several “waves” of definitive hematopoietic progenitors have been described during early zebrafish embryogenesis [32]. Between 30–36 hpf, erythro-myeloid committed progenitors (EMPs) arise in the posterior blood island, derived from lmo2+ lateral mesoderm [33]. Around this same time, cells that are thought to be the long-term adult HSCs begin to emerge from the floor of the dorsal aorta and subsequently migrate to the same region of the posterior tail, which has matured into a more vascularized niche, termed the CHT [34]. These aorta-derived HSCs do not contribute to erythropoiesis until a later stage compared to the time we document defects in hematopoiesis for the gata4 morphant (4 dpf). This suggests that the gata4 morphants have a late defect in primitive erythropoiesis, correlating with an intermediate stage during which time the CHT plexus develops.
To investigate this intermediate stage, the development of the CHT was evaluated in gata4 morphants using embryos derived from double transgenic tg(fli1:gfp; gata1:dsred) fish, to follow the co-development of CHT vasculature and circulating erythroid cells [34]. As shown in Fig. 2 (panels A,B) the CHT of gata4 morphants appears normal at 28 hpf, and erythroid cells circulate through the tail as in controls. However, by 3 dpf there is a significant disruption in the morphology of the CHT in gata4 morphants compared to controls (Fig. 2C,D). Circulation does not extend deeply into the tail and is limited to a much more proximal region of the trunk (note the length of the blue bracket indicating the morphant tail that lacks circulation in Fig. 2D). The vascular plexus is significantly reduced in size and extent of branching. The phenotype can be seen already by 48 hpf, when a clearly defined plexus between the dorsal aorta and caudal vein is seen in control embryos (Fig. 2E, denoted by the white arrows), which is not seen in the morphant embryos (Fig. 2F). Confocal microscopy was used to evaluate with higher resolution angiogenesis associated with the CHT. As shown in Fig. 3, the normal CHT plexus develops with a series of looped structures (indicated by asterisks in Fig. 3A). These structures are missing in the gata4 morphants, which develop a smooth unfenestrated tissue lacking looped structures (Fig. 3, panels B,C). Thus, while the primitive hematopoietic and vasculogenic programs initiate normally, gata4 morphants are disturbed subsequently for development and vascularization of the CHT, and this correlates temporally with a relative loss of circulating blood cells by 4 dpf. The failure to form a normal CHT plexus is not simply an indirect defect caused by a poorly functioning heart in the gata4 morphant. Two independent morphants that also display similar cardiac morphogenetic phenotypes and poor circulation (gata5 and tbx2a) have normal CHT plexus formation (Supplemental Fig. S1). Previously, Choi et al. demonstrated using defined mutants (tnnt2 and smo) that circulation is not required for the formation of the plexus in the CHT, although it can affect the subsequent stability of the structure [35].
HSCs are derived from hemogenic endothelium at the floor of the dorsal aorta [36], [37], and can be phenotypically identified by expression of HSC markers including cd41 [38] and runx1 [39]. To further evaluate circulation into the CHT, we analyzed the development of progenitors in morphant embryos from the cd41:gfp transgenic reporter line and confirmed that GFP+ cells emerge from the dorsal aorta similar to wildtype embryos. However, unlike control embryos, the GFP+ cells are never detected subsequently associated with the CHT (Supplemental Fig. S2). By 48 hpf, runx1+ progenitors in control embryos are found in the CHT or in circulation. However, at this same stage, runx1+ cells remain scattered along the midline of morphant embryos (Fig. 4A,B; see asterisks in panel B’). In addition, a strong patch of runx1 staining is found at 48 hpf associated with the CHT, which is never seen in control embryos (Fig. 4B, arrow). In addition to its function as a cell-autonomous regulator of HSC [30], [39], runx1 is expressed in prechondrocytic tissue that forms embryonic cartilage, and in periosteal and perichondral membranes of bone [40], [41]. We evaluated the expression pattern for various known bone marrow stromal factors and found a striking accumulation of transcripts for osteopontin (spp1), also associated with this runx1+ domain of the morphant CHT at 48 hpf (Fig. 4C,D). Therefore, when gata4 is depleted, definitive progenitors are born in the hemogenic endothelium. We do not know the fate of these progenitors, but based on the abnormal vascularization of the CHT, it appears that they fail to seed the CHT. At the same time, the CHT region expresses aberrantly at least some markers normally associated with osteochondrogenic tissue.
The sdf1a Expression Pattern is Altered in gata4 Morphants
In addition to spp1, the expression patterns for additional known stromal factors were evaluated in the gata4 morphants, including ang1, jagged1, ncad, sdf1a, and sdf1b. The expression patterns for ang1, jagged1, ncad, and sdf1b appeared unchanged in the gata4 morphant (data not shown). Only spp1 showed the aberrant pattern in the CHT, but an abnormal expression pattern was also found for the chemokine sdf1a (Fig. 5). Transcripts for sdf1a are normally found between 24–48 hpf at defined structures of the head, pronephric duct, and in a single stripe of mesoderm running down either side, for the length of the fish [15], [16]. In wildtype control fish these mesodermal stripes are clearly evident at 30 hpf (Fig. 5A), while transcript levels are reduced to near background levels in the tail by 35 hpf (Fig. 5C). The stripes are evident, albeit often patchy at 30 hpf in gata4 morphant embryos, and embryos showed enhanced relative expression levels in the pronephric duct (Fig. 5B). More strikingly, the transcript levels persist in the gata4 morphants and strong staining, relative to the control embryos, remains in the lateral stripes and pronephric duct at 35 hpf (Fig. 5D). Thus, sdf1a-dependent signaling that is normally down-regulated, may be inappropriately persistent in the gata4 morphant embryo. We compared expression levels by quantitative RT-PCR in isolated tail tissue from control and morphant embryos at 40, 48, and 72 hpf, representing the period when normal CHT development fails in the morphants (Fig. 5E). Fully consistent with reporter fish results and in situ hybridization data, in morphant tissue there is a significant loss of globin transcripts (consistent with a defect in primitive red blood cell maturation), and a major decrease in transcripts for hematopoietic progenitors, including lmo2 and cmyb, while both runx1 and sdf1a levels are significantly increased in the tails of morphant embryos.
Gata4 Regulates the Development of the Posterior Lateral Line
The changes in sdf1a expression pattern suggested a possible stromal-based defect caused by gata4 depletion, but does not ascribe a functional role. While Sdf1 is known for its function in mammalian hematopoiesis, it is also well characterized in zebrafish as a key regulator of the lateral line, a mechano-sensory organ system [42]. When analyzing gata4 morphant embryos around 3–4 dpf, we discovered that they fail to initiate an “avoidance” or “startle” response, for example when touched by a pipet. The morphants are not paralyzed and swim about of their own volition. Mediation of the startle response is a major function for the lateral line. The lateral line is comprised of neuromasts, sensory organs that contain central rosettes of hair cells, similar to those found in the mammalian inner ear, surrounded peripherally by supporting cells, and innervated by sensory neurons from the cranial ganglion. The neuromasts of the posterior lateral line are derived from a primordium originating from the cephalic placodes, located posterior to the otic placodes [14]. At around 22 hpf, a primordium on each side of the embryo, consisting of ∼100 cells, migrates distally along the lateral body wall, reaching the tip of the tail by 48 hpf. During the migration, groups of cells from the trailing edge of the primordium are deposited, every 5–6 somites, on each side of the embryo. These cells, the proneuromasts, differentiate into either hair cells or supporting cells. The neuromasts integrate mechano-sensory signals that control balance and the startle response. Therefore, the gata4 morphants display a behavior expected for embryos with a defective lateral line.
To assess the integrity of the lateral line, we first examined the development of the neuromasts. Control or morphant larvae were stained at 5 dpf in 4-Di-2-ASP, a cationic vital fluorophore that enters hair cells of the neuromasts through mechanoelectrical-transduction channels (Fig. 6A,B). The gata4 morphant embryos display a very low number of tail neuromasts (Fig. 6B). Although variable, the anterior lateral line is less affected, and neuromasts are often found in the head regions. However, most morphant embryos lack all or most of the trunk neuromasts that comprise the posterior lateral line, and this explains their failure to generate a startle response.
While many gata4 morphants lack all of the 4-Di-2-ASP staining trunk neuromasts, occasional neuromasts did stain. Notably, many of the morphant larvae displayed differentiated neuromasts at the extremity of the tail. Therefore, it seemed unlikely that the relative lack of trunk neuromasts is caused by a failure of the posterior lateral line primordium to migrate. Rather, we hypothesized that the primordium migrates, but that proneuromasts fail to be deposited or to differentiate normally. The migrating primordium is followed by a neurite that will innervate the future neuromasts. We reasoned that if the primordium migrates distally, the posterior lateral line neurons should be present in the gata4 morphant embryos. To test this hypothesis, larvae at 5 dpf were analyzed by whole-mount immunohistochemistry using an anti-acetylated tubulin antibody that detects neurons (Fig. 6C,D). Indeed, the staining confirmed the existence of the posterior lateral line neurons, extending along the body length to the tail tip. This pattern suggests that the primordium migrated normally along the lateral line path. However, there was a complete lack of normal branching of these neurons toward the presumed sites of neuromast deposition, suggesting that the defect in posterior lateral line development is due to a failure in the deposition of neuromasts by the migrating primordium. We further evaluated the migration of the primordium directly using the tg(claudinb:gfp) reporter fish [17]. In these embryos the primordium is imaged live, seen as a migrating patch of GFP+ cells, confirmed in both control and gata4 morphant embryos (Fig. 6E,F). As expected, the morphants generally failed to deposit proneuromast clusters. In morphant embryos the primordium often migrated along its normal route (as shown here), but it was always significantly delayed, and in some cases the primordium wandered off its normal lateral line route. Thus, in gata4 morphants the primordium forms and migrates, but migration rate and neuromast deposition is significantly disturbed.
Knockdown of sdf1a can Rescue the Lateral Line and CHT Defects Caused by Depletion of gata4
The unexpected defect in lateral line development, associated here with enhanced transcript levels for sdf1a, prompted us to test if sdf1a is epistatic to gata4, and therefore functionally implicated in one or more of the phenotypes. If increased levels of sdf1a, caused by depletion of gata4, are functionally relevant, then reduction of sdf1a in the gata4 morphant should abrogate the phenotype. In this case it is important to reduce sdf1a levels, but not below the threshold needed for its normal function. To test this, we used a morpholino that has been previously validated for knockdown of sdf1a and titrated by micro-injection to define the amount that causes reproducible lateral line defects similar to the sdf1a mutant [18]. We found lateral line development was normal in embryos injected with up to 4 ng of the sdf1a morpholino, while embryos that had been injected with 8 ng of the sdf1a morpholino fail to develop a lateral line. We therefore injected embryos first with the gata4-specific morpholino and then subsequently injected a cohort of these morphants with up to 4 ng of the morpholino targeting sdf1a. As little as 0.5 ng of the sdf1a morpholino was sufficient to effectively rescue the lateral line defect caused by loss of gata4 (Fig. 7A), as shown by restoration of the 4-Di-2-ASP staining pattern. This amount of sdf1a morpholino was not sufficient to rescue CHT development (not shown). However, injecting 4 ng of sdf1a morpholino in the background of the gata4 morphant was able to effectively rescue circulating blood levels, demonstrated with the tg(gata1:dsRed) transgenic reporter (Fig. 7B). This rescue correlates with enhanced vascularization and blood flow into the CHT. Therefore, through modulating sdf1a expression levels, gata4 normally regulates lateral line and angiogenesis in the CHT. In contrast, we were unable to consistently rescue heart development in gata4 morphants through manipulation of sdf1a levels (Supplemental Fig. S3).
Gata4 Regulates sdf1a during Gastrulation, with Subsequent Consequences for CHT Development
While a genetic interaction between gata4 and sdf1a was shown by the rescue experiments, the result is enigmatic, since neither gata4 nor sdf1a is obviously expressed in the CHT. While sdf1a transcripts persist in the morphant tail during CHT development, gata4 does not appear to be expressed in the tail. Although we cannot rule out low levels of expression, gata4 and sdf1a are co-expressed at a much earlier stage of development, in lateral mesoderm [43], [44], [45]. To determine when gata4 function is required for CHT development, we needed to generate a new animal model to control gata4 activity in a conditional manner, since morpholinos knockdown gata4 function throughout embryogenesis. For this purpose we generated a dominant-negative isoform of gata4 and created transgenic lines of fish that could be induced to express it at any time of embryogenesis by heat shock. Our strategy was the same as one we used previously in published studies to block the function of gata4 during Xenopus development [26]. Sequences encoding the well-defined DNA-binding domain of zebrafish Gata4 (amino acids 131–338) were fused with a strong-repressor domain derived from the amino terminal (amino acids 1–69) murine MXI1 transcriptional repressor protein, or a point mutant version of SR, SR-P (Supplemental Fig. S4). The SR domain of MXI1 (but not SR-P) interacts with the general chromatin repressor protein SIN3 to mediate suppression of MYC oncogenic activity [27], and when fused to a heterologous DNA-binding domain, the SR domain targets SIN3 to gene-specific binding sites leading to repression [46]. We used gel mobility-shift assays, and reporter assays to show that SR-Gata4 blocks co-expressed Gata4 from activation of target genes ([26], Supplemental Fig. S5). In preliminary experiments we also tested the homologous SR domain derived from zebrafish mxi1, but found no differences compared with the murine-derived domain (not shown). Injection of 250–1000 pg RNA encoding SR-Gata4 into fertilized eggs caused dose-dependent developmental defects including cardiomyopathies, whereas injection of RNA encoding SR-P-Gata4 at equivalent doses was much less active (not shown). We cloned the cDNA encoding SR-Gata4 downstream of the hsp70I heat-shock promoter in a tol2-dependent transgenic destination vector (Supplemental Fig. S6), and used this to generate lines of fish that express SR-Gata4, dependent on heat-shock.
Embryos derived from the tg(sr-gata4) line appeared entirely normal when grown at standard 28.5C temperature. When embryos were heat-shocked for one hour at 37–39C SR-specific transcripts were readily detected by qPCR (not shown). Transgenic embryos that were heat shocked (but not sibling non-transgenic, or transgenic but non-heat-shocked embryos) developed heart and endoderm defects that phenocopy the gata4 morphant embryos, as expected (Supplemental Fig. S6). Importantly, when heat-shocked for one hour during gastrulation, the majority of the transgenic embryos developed with a fused CHT that failed to generate a vascular plexus (Fig. 8). Heat-shock of the embryos at later stages, including 10 or 14 hpf during somitogenesis was still sufficient to generate cardiac looping defects, indicating that gata4 function remains important during these stages for heart development. In contrast, embryos heat-shocked at the later stages are much less likely to develop defects in the CHT plexus (Fig. 9A). Importantly, heat-shock of the tg(sr-gata4) embryos at 3 hpf was sufficient to cause a modest but significant increase in sdf1a expression levels during subsequent stages of epiboly (Fig. 9B), when sdf1a signaling is known to control the interaction of endoderm and overlaying lateral mesoderm. Therefore, although the vascular plexus does not form until later, it appears that gata4-dependent regulation of sdf1a expression levels during gastrulation is important for mesoderm patterning relevant to CHT development.
Discussion
In addition to its roles in cardiogenesis, gut organogenesis, and gonadal development, we discovered previously unknown functions for the transcription factor gata4 in two additional organ systems: the vascular system and the lateral line. Recently, a functionally redundant role for gata4/5/6 genes was shown for the development of primitive myeloid lineages [47]. However, that reflects a patterning role in lateral mesoderm for the generation of anterior primitive hemangioblasts, distinct from the non-redundant role of gata4 we describe here. With respect to blood development, embryos depleted of gata4 do not develop a normal vascular niche that is required during the transition from primitive to definitive lineages (the CHT), and this can explain the failure in these embryos to expand or maintain early progenitors and a lack of blood as the initial wave of primitive cells declines. The lateral line defect prompted an evaluation of sdf1a, which we found to be over-expressed in the gata4 morphants. Functional epistatic tests showed that both lateral line and CHT defects can be reversed in the gata4 morphants by depleting sdf1a levels, thus confirming a common, presumably non-cell-autonomous, signaling defect. In contrast, the cardiac and gut phenotypes, which may require gata4 cell-autonomously, are not rescued by reduction of sdf1a levels.
In lateral line development the mechanism of sdf1a function has been studied extensively [48]. Active sdf1a-dependent cxcr4 signaling is required at the leading edge for directed migration of the entire primordium, while cxcr7 interprets sdf1a levels distinctly at the trailing edge where the release of proneuromast clusters is facilitated. In gata4 morphants the primordium migrates, consistent with the presence of sdf1a. However neuromasts fail to be deposited, which is consistent with excessive Sdf1a ligand and the inability of the cxcr7 receptor to interpret the gradient needed for deposition. The sdf1a-dependent signaling impacts the relative adhesion of interacting tissues. During gastrulation this controls the extent of anterior endoderm migration, relative to associated mesoderm [44], [45]. This serves to “tether” the tissues in an appropriate position, at least in part through the stimulated expression of integrins, thus facilitating spatial control of subsequent inductive signals across germ layers. While the previous work documented that disruptions in this signaling-dependent germ layer interaction alters endoderm patterning and subsequent endoderm organogenesis, our data indicate that it also affects mesoderm patterning and subsequent vascular development of the CHT.
While gastrulation and lateral line development involve collective cell migrations, it was possible that the defect in hematopoiesis could be due to a cellular chemo-attraction issue, reflecting a function more similar to that described in bone-marrow homing of hematopoietic stem cells [49]. Indeed, the expression and function of sdf1a in the adult zebrafish kidney is well conserved with the mammalian bone marrow program [50]. The cxcr4a gene facilitates regional patterning of the early aortic endothelium [51], although in this case mediated by sdf1b. Inappropriate levels of Sdf1a ligand in the region of the pronephros could in principle disrupt the normal migration pattern of definitive progenitors to the CHT. However, our data suggest that the defect can be explained instead by a mesoderm patterning defect leading to morphological disruption in the CHT vasculature. By 36 hpf we found in gata4 morphants aberrant expression of spp1 and runx1 in the CHT, again suggesting that normal mesoderm patterning was disrupted by loss of gata4 function. This tissue fails to be fully vascularized by 3 dpf, and so hematopoietic progenitors would be unable to seed the tissue regardless of misplaced signaling cues. To gain insight into when gata4 expression is required to regulate CHT development we needed to develop a strategy for conditional depletion of gata4. This was accomplished through expression of a dominant-negative isoform of Gata4 (SR-Gata4) under the control of the heat shock promoter. The CHT failed to form a normal vascular plexus when gata4 function was disturbed during gastrulation, while it formed normally if SR-Gata4 was expressed later during somitogenesis. Cardiac development was disrupted when SR-Gata4 is expressed at either time point. Since the SR (repressor) isoform phenocopied loss of gata4, including enhanced levels of sdf1a, the result is consistent with a normal function for gata4 to activate gene(s) that restrict normal sdf1a expression levels (indirectly). Interestingly, a recent cell-tracking analysis in the zebrafish cmyb mutant documented defects in migration of the HSC from the dorsal aorta, which was attributed at least partly to elevated expression levels of sdf1a [52]. This fits well with the HSC phenotype observed in the gata4 morphants, suggesting that mesoderm patterning may not be the only cause for the failure of HSCs to migrate to the CHT.
We speculate that one role of the CHT may be functionally homologous to the mammalian liver, as a transition zone to support hematopoiesis prior to establishment of the adult stem cell populations in the bone (mammals) or kidney (fish). The same gene, gata4, is an essential regulator of liver growth and development in both mammals and fish, and therefore may represent an ancient link to the evolution of hematopoietic niches. Whether the gata4-sdf1a axis is conserved in relation to murine fetal hematopoiesis is not known, although Palis and colleagues [53] showed that hematopoietic progenitors in the fetal liver are responsive to an SDF1 gradient. Furthermore, in separate studies we used a murine embryonic stem cell model that allows conditional control of Gata4 expression [12]. When murine Gata4 was expressed for 6 hours starting at day 2 in embryoid body (EB) cultures, the top most down-regulated gene was Sdf1, based on microarray analyses, and confirmed by qPCR (not shown). Thus, it seems likely that Gata4 has a conserved role for restricting Sdf1 during embryonic development.
Supporting Information
Acknowledgments
We greatly appreciate the providing of transgenic reporter lines from Drs. Shuo Lin, Robert Handin, and Jim Hudspeth. The authors thank Kellie McCartin for her outstanding fish husbandry. Gabriel Rosenfeld carried out the qPCR confirmation of Sdf1 repression by Gata4 in the murine ESC model.
Funding Statement
This work was supported entirely by a grant from the National Institutes of Health to TE (R37HL056182). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. No additional external funding was received for this study.
References
- 1. Peterkin T, Gibson A, Loose M, Patient R (2005) The roles of GATA-4, −5 and −6 in vertebrate heart development. Seminars in cell & developmental biology 16: 83–94. [DOI] [PubMed] [Google Scholar]
- 2. Heicklen-Klein A, McReynolds LJ, Evans T (2005) Using the zebrafish model to study GATA transcription factors. Seminars in cell & developmental biology 16: 95–106. [DOI] [PubMed] [Google Scholar]
- 3. Kuo CT, Morrisey EE, Anandappa R, Sigrist K, Lu MM, et al. (1997) GATA4 transcription factor is required for ventral morphogenesis and heart tube formation. Genes & development 11: 1048–1060. [DOI] [PubMed] [Google Scholar]
- 4. Molkentin JD, Lin Q, Duncan SA, Olson EN (1997) Requirement of the transcription factor GATA4 for heart tube formation and ventral morphogenesis. Genes & development 11: 1061–1072. [DOI] [PubMed] [Google Scholar]
- 5. Pu WT, Ishiwata T, Juraszek AL, Ma Q, Izumo S (2004) GATA4 is a dosage-sensitive regulator of cardiac morphogenesis. Developmental biology 275: 235–244. [DOI] [PubMed] [Google Scholar]
- 6. Zeisberg EM, Ma Q, Juraszek AL, Moses K, Schwartz RJ, et al. (2005) Morphogenesis of the right ventricle requires myocardial expression of Gata4. The Journal of clinical investigation 115: 1522–1531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Watt AJ, Zhao R, Li J, Duncan SA (2007) Development of the mammalian liver and ventral pancreas is dependent on GATA4. BMC developmental biology 7: 37. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Holtzinger A, Evans T (2005) Gata4 regulates the formation of multiple organs. Development 132: 4005–4014. [DOI] [PubMed] [Google Scholar]
- 9. Holtzinger A, Evans T (2007) Gata5 and Gata6 are functionally redundant in zebrafish for specification of cardiomyocytes. Developmental biology 312: 613–622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Zhao R, Watt AJ, Battle MA, Li J, Bondow BJ, et al. (2008) Loss of both GATA4 and GATA6 blocks cardiac myocyte differentiation and results in acardia in mice. Developmental biology 317: 614–619. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Rojas A, Kong SW, Agarwal P, Gilliss B, Pu WT, et al. (2008) GATA4 is a direct transcriptional activator of cyclin D2 and Cdk4 and is required for cardiomyocyte proliferation in anterior heart field-derived myocardium. Molecular and cellular biology 28: 5420–5431. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Holtzinger A, Rosenfeld GE, Evans T (2010) Gata4 directs development of cardiac-inducing endoderm from ES cells. Developmental biology 337: 63–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Watt AJ, Battle MA, Li J, Duncan SA (2004) GATA4 is essential for formation of the proepicardium and regulates cardiogenesis. Proceedings of the National Academy of Sciences of the United States of America 101: 12573–12578. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Ghysen A, Dambly-Chaudiere C (2004) Development of the zebrafish lateral line. Current opinion in neurobiology 14: 67–73. [DOI] [PubMed] [Google Scholar]
- 15. David NB, Sapede D, Saint-Etienne L, Thisse C, Thisse B, et al. (2002) Molecular basis of cell migration in the fish lateral line: role of the chemokine receptor CXCR4 and of its ligand, SDF1. Proceedings of the National Academy of Sciences of the United States of America 99: 16297–16302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Li Q, Shirabe K, Kuwada JY (2004) Chemokine signaling regulates sensory cell migration in zebrafish. Developmental biology 269: 123–136. [DOI] [PubMed] [Google Scholar]
- 17. Haas P, Gilmour D (2006) Chemokine signaling mediates self-organizing tissue migration in the zebrafish lateral line. Developmental cell 10: 673–680. [DOI] [PubMed] [Google Scholar]
- 18. Valentin G, Haas P, Gilmour D (2007) The chemokine SDF1a coordinates tissue migration through the spatially restricted activation of Cxcr7 and Cxcr4b. Current biology : CB 17: 1026–1031. [DOI] [PubMed] [Google Scholar]
- 19. Cyster JG (2003) Homing of antibody secreting cells. Immunological reviews 194: 48–60. [DOI] [PubMed] [Google Scholar]
- 20. Nervi B, Link DC, DiPersio JF (2006) Cytokines and hematopoietic stem cell mobilization. Journal of cellular biochemistry 99: 690–705. [DOI] [PubMed] [Google Scholar]
- 21. Vilz TO, Moepps B, Engele J, Molly S, Littman DR, et al. (2005) The SDF-1/CXCR4 pathway and the development of the cerebellar system. The European journal of neuroscience 22: 1831–1839. [DOI] [PubMed] [Google Scholar]
- 22.Westerfield M (1995) The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio rerio). Eugene, OR: University Of Oregon Press. [Google Scholar]
- 23. Traver D, Paw BH, Poss KD, Penberthy WT, Lin S, et al. (2003) Transplantation and in vivo imaging of multilineage engraftment in zebrafish bloodless mutants. Nature immunology 4: 1238–1246. [DOI] [PubMed] [Google Scholar]
- 24. Lawson ND, Weinstein BM (2002) In vivo imaging of embryonic vascular development using transgenic zebrafish. Developmental biology 248: 307–318. [DOI] [PubMed] [Google Scholar]
- 25. Lin HF, Traver D, Zhu H, Dooley K, Paw BH, et al. (2005) Analysis of thrombocyte development in CD41-GFP transgenic zebrafish. Blood 106: 3803–3810. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Jiang Y, Drysdale TA, Evans T (1999) A role for GATA-4/5/6 in the regulation of Nkx2.5 expression with implications for patterning of the precardiac field. Developmental biology 216: 57–71. [DOI] [PubMed] [Google Scholar]
- 27. Schreiber-Agus N, Chin L, Chen K, Torres R, Rao G, et al. (1995) An amino-terminal domain of Mxi1 mediates anti-Myc oncogenic activity and interacts with a homolog of the yeast transcriptional repressor SIN3. Cell 80: 777–786. [DOI] [PubMed] [Google Scholar]
- 28. Alexander J, Stainier DY, Yelon D (1998) Screening mosaic F1 females for mutations affecting zebrafish heart induction and patterning. Dev Genet 22: 288–299. [DOI] [PubMed] [Google Scholar]
- 29. Herbomel P, Thisse B, Thisse C (1999) Ontogeny and behaviour of early macrophages in the zebrafish embryo. Development 126: 3735–3745. [DOI] [PubMed] [Google Scholar]
- 30. Kalev-Zylinska ML, Horsfield JA, Flores MV, Postlethwait JH, Vitas MR, et al. (2002) Runx1 is required for zebrafish blood and vessel development and expression of a human RUNX1-CBF2T1 transgene advances a model for studies of leukemogenesis. Development 129: 2015–2030. [DOI] [PubMed] [Google Scholar]
- 31. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408. [DOI] [PubMed] [Google Scholar]
- 32. Bertrand JY, Traver D (2009) Hematopoietic cell development in the zebrafish embryo. Current opinion in hematology 16: 243–248. [DOI] [PubMed] [Google Scholar]
- 33. Bertrand JY, Kim AD, Violette EP, Stachura DL, Cisson JL, et al. (2007) Definitive hematopoiesis initiates through a committed erythromyeloid progenitor in the zebrafish embryo. Development 134: 4147–4156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Murayama E, Kissa K, Zapata A, Mordelet E, Briolat V, et al. (2006) Tracing hematopoietic precursor migration to successive hematopoietic organs during zebrafish development. Immunity 25: 963–975. [DOI] [PubMed] [Google Scholar]
- 35. Choi J, Mouillesseaux K, Wang Z, Fiji HD, Kinderman SS, et al. (2011) Aplexone targets the HMG-CoA reductase pathway and differentially regulates arteriovenous angiogenesis. Development 138: 1173–1181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Bertrand JY, Kim AD, Teng S, Traver D (2008) CD41+ cmyb+ precursors colonize the zebrafish pronephros by a novel migration route to initiate adult hematopoiesis. Development 135: 1853–1862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Kissa K, Murayama E, Zapata A, Cortes A, Perret E, et al. (2008) Live imaging of emerging hematopoietic stem cells and early thymus colonization. Blood 111: 1147–1156. [DOI] [PubMed] [Google Scholar]
- 38. Ma D, Zhang J, Lin HF, Italiano J, Handin RI (2011) The identification and characterization of zebrafish hematopoietic stem cells. Blood 118: 289–297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Burns CE, Traver D, Mayhall E, Shepard JL, Zon LI (2005) Hematopoietic stem cell fate is established by the Notch-Runx pathway. Genes & development 19: 2331–2342. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Lian JB, Balint E, Javed A, Drissi H, Vitti R, et al. (2003) Runx1/AML1 hematopoietic transcription factor contributes to skeletal development in vivo. Journal of cellular physiology 196: 301–311. [DOI] [PubMed] [Google Scholar]
- 41. Wang Y, Belflower RM, Dong YF, Schwarz EM, O'Keefe RJ, et al. (2005) Runx1/AML1/Cbfa2 mediates onset of mesenchymal cell differentiation toward chondrogenesis. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 20: 1624–1636. [DOI] [PubMed] [Google Scholar]
- 42. Raz E, Mahabaleshwar H (2009) Chemokine signaling in embryonic cell migration: a fisheye view. Development 136: 1223–1229. [DOI] [PubMed] [Google Scholar]
- 43. Heicklen-Klein A, Evans T (2004) T-box binding sites are required for activity of a cardiac GATA-4 enhancer. Developmental biology 267: 490–504. [DOI] [PubMed] [Google Scholar]
- 44. Mizoguchi T, Verkade H, Heath JK, Kuroiwa A, Kikuchi Y (2008) Sdf1/Cxcr4 signaling controls the dorsal migration of endodermal cells during zebrafish gastrulation. Development 135: 2521–2529. [DOI] [PubMed] [Google Scholar]
- 45. Nair S, Schilling TF (2008) Chemokine signaling controls endodermal migration during zebrafish gastrulation. Science 322: 89–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Harper SE, Qiu Y, Sharp PA (1996) Sin3 corepressor function in Myc-induced transcription and transformation. Proceedings of the National Academy of Sciences of the United States of America 93: 8536–8540. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Peterkin T, Gibson A, Patient R (2009) Common genetic control of haemangioblast and cardiac development in zebrafish. Development 136: 1465–1474. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Perlin JR, Talbot WS (2007) Signals on the move: chemokine receptors and organogenesis in zebrafish. Science's STKE : signal transduction knowledge environment 2007: pe45. [DOI] [PubMed] [Google Scholar]
- 49. Hattori K, Heissig B, Rafii S (2003) The regulation of hematopoietic stem cell and progenitor mobilization by chemokine SDF-1. Leukemia & lymphoma 44: 575–582. [DOI] [PubMed] [Google Scholar]
- 50. Glass TJ, Lund TC, Patrinostro X, Tolar J, Bowman TV, et al. (2011) Stromal cell-derived factor-1 and hematopoietic cell homing in an adult zebrafish model of hematopoietic cell transplantation. Blood 118: 766–774. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Siekmann AF, Standley C, Fogarty KE, Wolfe SA, Lawson ND (2009) Chemokine signaling guides regional patterning of the first embryonic artery. Genes & development 23: 2272–2277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Zhang Y, Jin H, Li L, Qin FX, Wen Z (2011) cMyb regulates hematopoietic stem/progenitor cell mobilization during zebrafish hematopoiesis. Blood 118: 4093–4101. [DOI] [PubMed] [Google Scholar]
- 53. McGrath KE, Koniski AD, Maltby KM, McGann JK, Palis J (1999) Embryonic expression and function of the chemokine SDF-1 and its receptor, CXCR4. Developmental biology 213: 442–456. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.