Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2012 Aug 30;287(42):35318–35323. doi: 10.1074/jbc.M112.392639

Ubiquitin E3 Ligase A20 Facilitates Processing Microbial Product in Nasal Epithelial Cells*

Yun-Fang An ‡,1, Tong-Li Li §,¶,1, Xiao-Rui Geng , Gui Yang , Chang-Qing Zhao ‡,2, Ping-Chang Yang ¶,3
PMCID: PMC3471685  PMID: 22936803

Background: Ubiquitin A20 contributes to the homeostasis.

Results: A20 facilitates endosome/lysosome fusion and protein degradation in epithelial cells.

Conclusion: A20 is required in degradation of absorbed proteins in epithelial cells.

Significance: A20 is a critical molecule in maintaining the homeostasis in the body.

Keywords: E3 Ubiquitin Ligase, Epithelial Cell, Extracellular Matrix Proteins, Membrane Proteins, Protein Degradation

Abstract

Microbial products play a role in the pathogenesis of allergic diseases; ubiquitin E3 ligase A20 (A20) is an important molecule in regulating inflammation in the body. The present study aims to elucidate the role of A20 in processing the absorbed microbial products in nasal epithelial cells. Human nasal mucosal specimens were collected from patients with or without chronic rhinitis and analyzed by immunohistochemistry. Human nasal epithelial cell line, RPMI2650 cell, was employed to assess the role of A20 in processing the absorbed staphylococcal enterotoxin B (SEB). The RPMI2650 cells absorbed SEB in the culture. The increase in A20 was observed in RPMI2650 cells in parallel to the absorption of SEB. A20 is a critical molecule in the degradation of SEB in the nasal epithelial cells by promoting the tethering of endosomes and lysosomes. A20 plays a critical role in processing of the absorbed SEB in nasal epithelial cells.

Introduction

Staphylococcal aureus is a common opportunistic pathogen; its colonization frequently occurs in the anterior nares (1) and also occurs in the axilla, perineum, rectum, and throat (2). Its virulence factor, such as the staphylococcal enterotoxin B (SEB),4 acts as a superantigen, which is associated with the pathogenesis of a number of skewed immune responses. It is reported that SEB-specific IgE is detected in patients with allergic diseases, such as allergic rhinitis (3) and allergic dermatitis (4). Others observed that SEB had the immune adjuvant effect to promote the sensitization to specific antigens (5, 6). However, the process of SEB absorption into the body is not fully understood.

On the surface of the airway mucosa, there is a thin layer of epithelium; the epithelial cell bodies and the tight junctions form the epithelial barrier. The epithelial barrier physically separates the exterior environment and the deep tissue of the airway mucosa. It has been described that up to ∼1014 commensal bacteria live in the lumen of an adult human intestine (7). How exogenous antigens and microbial products pass across the epithelial barrier to be absorbed into the deep tissue in the body is to be further elucidated. Published data indicate that exposure to SEB does not affect the transepithelial resistance (TER) (8), which implies that SEB does not alter the paracellular permeability of the epithelial barrier. Our previous studies indicate that the exogenous antigens can be transported across the epithelial barrier to get into the deep tissue via the intracellular pathway (9, 10). Whether nasal epithelial cells absorb SEB via the intracellular pathway is not clear.

In previous studies, we (9, 10) and others (11) noted that that the endocytosed foreign antigens could be wrapped by the plasma membrane to form endosomes. The endosomes are defined as a membrane-bound compartment inside eukaryotic cells. It is an endocytic membrane transport pathway by which the endocytic cargo can be transported from the plasma membrane to the lysosome. The endocytic molecules from the plasma membrane can follow this pathway to lysosomes to be degraded.

Three types of endosomes are described, the early, late, and recycling endosomes (12). The early endosomes mature into the late endosomes; during the course of time, the endosomes become increasingly acidic mainly through the activity of the V-ATPase (13). The late endosomes finally fuse with lysosomes. The endocytic substance can be degraded by the hydrolyase in lysosomes. The process of the fusion of endosome/lysosome is not fully understood yet.

Recent studies indicate that the ubiquitin E3 ligase A20 (A20) plays a role in the fusion of endosome/lysosome (14). A20 is both a ubiquitin ligase and a deubiquitinating enzyme; whether these activities are required for degrading SEB remains to be investigated. Thus, we designed and carried out this project. The results indicate that nasal epithelial cells endocytosed SEB, which increased the expression of ubiquitin E3 ligase A20 (A20, in short) in the cells; the A20 facilitated the degradation of SEB in the epithelial cells.

MATERIALS AND METHODS

Reagents

SEB, NH4Cl, and cycloheximide were purchased from Sigma-Aldrich (Shanghai, China). Antibodies of IgE, CD23, SEB, A20, EEA1, LAMP2, A20 shRNA, and fluorescence-labeled second antibodies were purchased from Santa Cruz Biotechnology (Shanghai, China). Reagents for quantitative real time RT-PCR (qRT-PCR) were purchased from Invitrogen (Shanghai, China). RPMI2650 cell line was purchased from ATCC (Manassas, VA). The fluorescein isothiocyanate (FITC) labeling kit was purchased from Thermo Scientific (Beijing, China).

Cell Culture

Human nasal epithelial cell line, RPMI2650 cells, was grown in Eagle's minimal essential medium supplemented with 10% fetal bovine serum, 100 μg ml−1 streptomycin, 100 μg ml−1 penicillin, and 200 mm l-glutamine in a humidified 37 °C incubator with 5% CO2. When the cells reached 80–90% confluence, they were trypsinized with 0.05% trypsin-EDTA solution. For the SEB degradation assay, cells were cultured in Transwell filter inserts (polycarbonate membrane, 0.4-μm pore size, 1.12-cm2 surface area, Corning Costar Co.). To inhibit the lysosome function, 50 mm NH4Cl was included in the culture medium.

Recording Transepithelial Resistance

TER of RPMI2650 monolayers was determined using the Millicell-ERS apparatus (Millipore, Bedford, MA).

Assessment of Permeability of RPMI2650 Monolayers

Following published procedures (15), we cultured RPMI2650 cells for 2 weeks in Transwell inserts to confluence (TER ≥100 ohm/cm2). SEB (10 μg/ml) was added to the apical chambers. Samples were taken from the basal chambers 24 h later. The levels of SEB in the samples were determined by ELISA.

Enzyme-linked Immunoassay (ELISA)

ELISA was performed to assess the levels of SEB and A20. Sample proteins (20 μg/ml), standard proteins, or bovine serum albumin (BSA, using as an irrelevant protein and a negative control) were added to 96-well plates (0.1 ml/well for every reagent); the plates were incubated at 4 °C overnight. 5% skim milk was added to each well for 30 min to block nonspecific binding. The primary antibodies (10 ng/ml) were added to the wells and incubated at 4 °C overnight. HRP-labeled secondary antibodies (5 ng/ml) were added and incubated at room temperature for 1 h. 3,3′,5,5′-Tetramethylbenzidine was added and incubated for 15 min; the reactions were stopped by adding 2 m H2SO4. Washing with TBS for three times was performed after each step. The optical density of each well was measured with a microplate reader (Bio-Tek, Shanghai, China). The optical density value of the negative control wells was subtracted from the optical density value of each sample well and the standard wells. The results were calculated against the standard curve.

Western Blotting

Protein samples (60 μg/well) were fractioned in SDS-PAGE and transferred onto nitrocellulose membrane. The membrane was incubated with primary antibodies (10 ng/ml) at 4 °C overnight and followed by adding HRP-labeled secondary antibodies (5 ng/ml). The positive immunoreaction was visualized with the ECL Plus Western blotting reagent (Amersham Biosciences; Shanghai, China).

qRT-PCR

The A20 gene expression in RPMI2650 cells was assessed by qRT-PCR. The total RNA was converted to cDNA with reverse transcriptase with the primer of A20 (forward, gagagcacaatggctgaaca; reverse, tccagtgtgtatcggtgcat; National Center for Biotechnology Information (NCBI), NM_006290.2). The quantitative PCR was performed with SYBR Green master mix (Qiagen, Shanghai, China) in a Bio-Rad thermocycler (Bio-Rad Biotech, Shanghai, China). The results were expressed as the percentage of the housekeeping gene β-actin).

RNA Interference of A20

A20 gene was knocked down in RPMI2650 cells with the shRNA of A20 (nonspecific shRNA was used as a control) following the manufacturer's instructions. The gene knockdown effect was presented in Fig. 3C.

FIGURE 3.

FIGURE 3.

A20 facilitates SEB degradation in nasal epithelial cells. RPMI2650 cells were cultured in Transwell inserts. SEB was added to the apical chambers in the presence of absence of the lysosome inhibitor (Lysosome-i, NH4Cl, 50 mm). A, samples were taken from the basal chambers. The SEB levels were determined by ELISA. The bars indicate the levels of SEB in the basal chambers of Transwell inserts. The data were expressed as the percentage of the original amount of SEB added to the apical chambers. cshRNA, nonspecific shRNA used as a control. B, the bars indicate the TER of the RPMI2650 monolayers recorded 24 h after the addition of SEB to the apical chambers. The data were expressed as the percentage of the TER recorded before the addition of SEB. C, the immune blots show the results of A20 gene knockdown. The x axis indicates the treatments on RPMI2650 cells. The data in A and B were expressed as mean ± S.D. The data represent three separate experiments.

Immunocytochemistry

Following our established procedures with minor modifications (16), we stained A20, the absorbed SEB, endosomes, and lysosomes in RPMI2650 cells in an Eppendorf tube. The cells were fixed with 2% paraformaldehyde for 2 h and incubated with the primary antibodies for 1 h followed by incubating with fluorescence-labeled secondary antibodies for 1 h. The cells were smeared onto a slide and observed under a confocal microscope.

Image Analysis

The positive immune staining was quantitatively analyzed with the software Photoshop CS5. The results were expressed as pixels.

Collection of Nasal Epithelial Samples

10 healthy subjects (5 male, 5 female; age, 23–30 years old), 10 patients with allergic rhinitis (5 male, 5 female, age, 25–32 years old), and 10 patients with non-allergic chronic rhinitis (5 male, 5 female; age, 24–29 years old) were recruited into this study at our outpatient clinic. The nasal epithelial samples were collected by scratching on the surface of the inferior turbinate with a plastic spoon (3 mm in diameter). The samples were processed for the extraction of RNA and protein immediately. The use of human tissue in this study was approved by the Human Study Ethic Committee at Shanxi Medical University. Informed, written consent was obtained from each subject.

Cycloheximide Chase Assay

The cultured epithelial cells exposed to SEB in the culture were incubated with cycloheximide (70 μg/ml) for different periods of time. The cells were collected at the end of culture; the total cell extracts were analyzed by Western blotting.

Labeling SEB with FITC

For the endocytosis of SEB of the epithelial cells, SEB was labeled with FITC employing the FITC-labeling kits following the manufacturer's instructions.

Statistical Analysis

All data are presented as mean ± S.D. Differences between means were evaluated by Student t test and considered statistically significant at p < 0.05. All experiments were repeated at least three times.

RESULTS

SEB by Nasal Epithelial Cells

To elucidate whether nasal epithelial cells absorbed SEB, the nasal epithelial cell line, RPMI2650 cells, was exposed to SEB in culture for 0–30 min. The total proteins in the RPMI2650 cells were extracted and analyzed by ELISA. The results showed that the cells could absorb SEB in a SEB dose-(Fig. 1A) and exposure time-dependent manner (Fig. 1B). To confirm the results, we exposed the epithelial cells to the FITC-labeled SEB in the culture; the cells were collected at different time points and observed by confocal microscopy. The results showed the FITC staining inside the epithelial cells in a time-dependent manner (Fig. 1C). The data indicate that the nasal epithelial cells can endocytose SEB.

FIGURE 1.

FIGURE 1.

Nasal epithelial cells absorb SEB. RPMI2650 cells were cultured in the presence of SEB. The cellular extracts were assessed for SEB absorption by ELISA. A, the bars indicate the levels of SEB in the cell extracts. B, cells were treated with SEB (10 μg/ml) in culture for 0–30 min; the bars indicate the levels of SEB in the protein extracts of the cells. The x axis indicates the time points at which the cells were collected. C, the cells were cultured in the presence of FITC-labeled SEB (10 μg/ml) and collected at the indicated time points; the cells were smeared on slides and observed with a confocal microscope. The representative confocal images indicate the endocytosis of SEB (in green) of the cells at the indicated time points. Saline: the cells were treated with saline instead of SEB. The original magnification of the image: ×630. The data represent three separate experiments.

Absorption of SEB Increases Production of A20 by Nasal Epithelial Cells

Recent studies indicate that A20 plays a role in the endosome/lysosome fusion (14); the latter is a critical procedure in degradation of the absorbed proteins in cells. To see whether human nasal epithelial cells express A20, we collected nasal epithelial samples and analyzed by qRT-PCR and Western blotting. The results showed that the A20 expression was detected in healthy subjects and that this expression was significantly less in patients with chronic non-allergic rhinitis and allergic rhinitis (Fig. 2, A and B). The results were corroborated by the data from a cell line study. The expression of A20 was also observed in the human nasal epithelial cell line, the RPMI2650 cells, at naive status; exposure to SEB in culture markedly increased the expression of A20 in the cells in a SEB dose- and exposure time-dependent manner (Fig. 2, C and D).

FIGURE 2.

FIGURE 2.

Nasal epithelial cells produce A20. A and B, human nasal epithelial specimen was collected from 10 healthy subjects and patients with non-allergic chronic rhinitis (CR; 10 patients) and allergic rhinitis (AR; 10 patients) by scratching. The specimens were processed individually for A20 expression by qRT-PCR and Western blotting. A, the bars indicate the A20 mRNA levels. B, the immune blots indicate the A20 contents in the extracted proteins. C and D, RPMI2650 cells (105 cells/ml) were cultured in the presence of SEB at graded doses in culture (C) or the cells were exposed to SEB at 10 μg/ml for 0–48 h (D). The cells were collected at the end of culture; the total proteins were extracted and analyzed by ELISA. The bars in C and D indicate the A20 levels in the cell extracts of RPMI2650 cells. The data were presented as mean ± S.D. *, p < 0.01, as compared with the healthy group in A, with the dose 0 group in C, or with time point 0 in D. The data in C and D represent three separate experiments.

A20-facilitated Degradation of SEB by Nasal Epithelial Cells Is A20- and Lysosome-dependent

Published data indicate that A20 plays a critical role in the prevention of immune inflammation in the body (17) and facilitates protein degradation in the cells (14). We postulated that the increase in A20 in nasal epithelial cells upon uptake of SEB may be associated with the degradation of the absorbed SEB in the cells. Because SEB could be absorbed into RPMI2650 cells (Fig. 1), the absorbed SEB could be either degraded within the cells or converted to the basal side of the cells. We next cultured the RPMI2650 cells in Transwell inserts to confluence. SEB was added to the apical chambers. Samples were taken from the basal chambers 24 h later. The contents of SEB in the basal chambers were assessed by ELISA using this test as a reference parameter to reflect the degradation of SEB by RPMI2650 cells. The results showed that the levels of SEB in samples from A20-sufficient RPMI2650 cells were below the detectable levels, implying that the SEB was degraded within the cells. To test the role of A20 in the degradation of SEB in nasal epithelial cells, the A20 gene was knocked down in a batch of RPMI2650 cells and then exposed to SEB in the Transwell system. Abundant SEB was detected in the basal chambers. To clarify whether the absorption of SEB altered the nasal epithelial paracellular permeability, we recorded the TER of RPMI2650 monolayer in Transwell inserts after the addition of SEB. The results showed that TER in the SEB-treated group was not significantly different from the control group (Fig. 3). The results indicate that the exposure to SEB does not alter the paracellular space of the nasal epithelial monolayer.

We next further tested the role of the lysosome in the degradation of endocytic SEB in the epithelial cells. With the same experimental setting above, we added the lysosome inhibitor, NH4Cl, to the culture medium; the SEB flux through the epithelial monolayers was carried out. The results showed that even the A20-sufficient epithelial monolayers showed the high permeability to SEB (Fig. 3). The data indicate that A20 may not be directly involved in the degradation of the endocytic SEB; lysosome activities are required in the degradation of endocytic SEB.

Endosome/Lysosome Fusion in Nasal Epithelial Cells Requires A20

To further understand the role of A20 in the degradation of the endocytic SEB, we stained the SEB-treated RPMI2650 cells with antibodies against the markers of endosome, lysosome, and SEB; the cells were observed under a confocal microscope. As shown in Fig. 4 and Table 1, SEB+ EEA1+ and SEB+ EEA1+ LAMP2+ immune products were observed in the A20-sufficient cells (Fig. 4A). In A20-deficient cells, more SEB+ EEA1+ immune products and fewer SEB+ EEA1+ LAMP2+ immune products were observed as compared with A20-sufficient cells (Fig. 4B). The results indicate that A20 plays a role in the fusion of endosome and lysosome. To confirm this inference, another batch of cells was stained with antibodies of A20, EEA1, and LAMP2. The results showed that A20+ EEA1+ and A20+ EEA1+ LAMP2+ immune products, but no A20+ LAMP2+ immune products, were observed (Fig. 4C). The results indicate that A20 is involved in the fusion of endosome and lysosome.

FIGURE 4.

FIGURE 4.

A20 facilitates endosome/lysosome fusion. RPMI2650 cells were exposed to SEB in culture for 24 h. The cells were stained for SEB (or A20), EEA1 (an endosome marker), and LAMP2 (a lysosome marker). The representative confocal images show the positive staining of SEB (or A20; in green), EEA1 (in red), and LAMP2 (in blue) respectively. The image analysis data are presented in Table 1. The data represent three separate experiments.

TABLE 1.

Quantified data of immune staining in nasal epithelial cells

The immune positive staining particles in Fig. 4 were counted with confocal microscopy. The data were presented as mean (S.D.). Cells were analyzed individually. 30 cells were analyzed for each group. *, p < 0.01, as compared with the A20+ group.

Number of particles SEB/EEA1a SEB/EEA1/LAMP2a
% %
Immune staining
    A20+ cell 866 44.26 (5.8) 51.63 (4.8)
    A20− cell 897 85.23 (8.2)* 5.44 (6.1)*
Number of particles A20/EEA1 A20/EEA1/LAMP2
% %
Immune staining
    A20+ cell 882 41.55 (5.3) 55.6 (7.4)

a Numbers in parentheses indicate number of cells.

DISCUSSION

The present data reveal a novel mechanism by which nasal epithelial cells process the absorbed microbial product, SEB. Upon the absorption of SEB, nasal epithelial cells express A20, which facilitates the fusion of endosome and lysosome and promotes the degradation of the absorbed SEB. Deficiency of A20 interferes with the fusion of endosome and lysosome, resulting in the endocytic SEB being un-degraded and being transported across the epithelial barrier.

SEB is a superantigen; it is capable of activating T cells directly to trigger skewed immune response (18). On the other hand, SEB can also act as an immune adjuvant to promote immune responses such as the induction of the hypersensitivity (5, 6). SEB is produced by S. aureus. The nasal mucosa is one of the sites at which S. aureus commonly colonizes (19), which can be a source of SEB. Applying SEB to the nasal mucosa directly facilitates the development of nasal hypersensitivity (20) and airway mucosal sensitization (21). This information implies that the nasal epithelial cells can absorb SEB from the nasal cavity. The present study has proved the inference that nasal epithelial cells indeed absorb SEB. We expected that SEB would be converted to the basal side of the epithelial monolayers. However, this was not shown by the data. The amounts of SEB in the basal chamber of the Transwell were below detectable levels. The phenomenon indicates that the amounts of SEB converted to the basal chambers of Transwell inserts are very small if there is any.

The amounts of A20 in the epithelial cells were also increased upon exposure to SEB, which was in parallel to the absorption of SEB in the cells. This is in line with previous studies; Hitotsumatsu et al. (22) reported that the expression of A20 was increased in macrophages upon the exposure to a microbial product, peptidoglycan. The biological significance of the increase in A20 is to limit the activities of the nuclear factor-κB in the cells to avoid potential injury caused by the microbial products (22). The present results indicate that the increase in A20 may facilitate the degradation of the absorbed SEB in the epithelial cells. The subsequent data support the inference; the A20-deficient nasal epithelial monolayers converted significantly more amounts of SEB to the basal chambers of Transwell inserts. This inference is also supported by a previous study that indicates A20 plays a role in tethering endosomes and lysosomes to facilitate the endosome/lysosome fusion (14). Our data are in line with the study by showing that the SEB-carrying endosome/lysosome fusion was inhibited by knockdown of A20 in the nasal epithelial cells. Furthermore, we observed much lower levels of A20 in the nasal epithelium from patients with chronic allergic and non-allergic rhinitis; the data indirectly indicate that the insufficient amount of A20 may contribute to the pathogenesis of the chronic inflammation in the nasal mucosa. This inference is supported by a recent publication indicating that knocking out the gene of A20 from intestinal epithelial cells resulted in severe inflammation in the intestine (17).

The nasal epithelium directly faces the exterior environment. The airborne antigens and microbial products can physically contract the nasal epithelial cells. As shown by the present study, the nasal epithelial cells can endocytose SEB, an example of microbial products. The results indicate that the nasal epithelial cells should have the ability to degrade the endocytic cargo. The results showed that the nasal epithelial cells did have such a capacity to degrade the endocytic SEB. The results also showed that after being endocytosed, the SEB was wrapped by the plasma membrane to form endosomes. Our previous studies also showed a similar phenomenon in which intestinal epithelial cells endocytosed protein antigens to form endosomes in the cells (10, 23); such endosomes were also observed in rat nasal epithelial cells (24).

The present data show that the endocytic SEB can be degraded within the naive nasal epithelial cells, but cannot be degraded in the A20-deficient epithelial cells. The endocytic SEB is thus transported across the epithelial monolayer. Similar phenomena were observed previously; under allergic environment, the epithelial layer actively transports specific antigens to the subepithelial region (9, 24). We also observed that the expression of A20 was significantly less in the nasal mucosa of patients with allergic rhinitis; thus, these epithelial layers may have hyperpermeability to airborne antigens and microbial products. Further investigations are needed to prove this.

After endocytosis, the early antigen-carrying endosomes fuse each other to form late endosomes and finally fuse to lysosomes (12, 13); the endocytic antigens are thus degraded by the acidic hydrolases of lysosomes (12, 13). In the present study, we observed an interesting phenomenon that most SEB-carrying endosomes fused with lysosomes in the A20-sufficient epithelial cells, whereas far fewer SEB-carrying endosomes fused with lysosomes in those A20-deficient epithelial cells. The results imply that A20 is required in the fusion of endosome and lysosome. Similar phenomena were also observed in previous studies; Li et al. (14) found that A20 was capable of targeting an associated signaling molecule such as TRAF2 to the lysosomes for degradation. We also observed that the endocytic SEB could also pass across the A20-sufficient epithelial monolayer in the presence of lysosome inhibitor. The results indicate that SEB is not degraded by A20 directly, but by the A20 deficiency-interfered endosome/lysosome fusion, which was supported by the immunocytochemistry data as shown by the present study.

In summary, the present study reveals that nasal epithelial cells can endocytose SEB, which can be degraded in the cells with the aid of A20. Knockdown of A20 increases the SEB flux to the basal side of the nasal epithelial monolayers by interfering with the fusion of endosome/lysosome in the epithelial cells.

*

This work was supported in part by the Canadian Institutes of Health Research (CIHR); Grants 191063 and 220058), the Natural Sciences and Engineering Research Council of Canada (Grant 371268), and the National Natural Science Foundation of China (Grants 81070767 and 81271059).

4
The abbreviations used are:
SEB
staphylococcal enterotoxin B
TER
transepithelial resistance
qRT-PCR
quantitative real time RT-PCR.

REFERENCES

  • 1. Kluytmans J., van Belkum A., Verbrugh H. (1997) Nasal carriage of Staphylococcus aureus: epidemiology, underlying mechanisms, and associated risks. Clin. Microbiol. Rev. 10, 505–520 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Fritz S. A., Hogan P. G., Hayek G., Eisenstein K. A., Rodriguez M., Krauss M., Garbutt J., Fraser V. J. (2012) Staphylococcus aureus colonization in children with community-associated Staphylococcus aureus skin infections and their household contacts. Arch. Pediatr. Adolesc. Med. 166, 551–557 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Zhang N., Holtappels G., Gevaert P., Patou J., Dhaliwal B., Gould H., Bachert C. (2011) Mucosal tissue polyclonal IgE is functional in response to allergen and SEB. Allergy 66, 141–148 [DOI] [PubMed] [Google Scholar]
  • 4. Niebuhr M., Scharonow H., Gathmann M., Mamerow D., Werfel T. (2010) Staphylococcal exotoxins are strong inducers of IL-22: a potential role in atopic dermatitis. J. Allergy Clin. Immunol. 126, 1176–1183 [DOI] [PubMed] [Google Scholar]
  • 5. Forbes-Blom E., Camberis M., Prout M., Tang S. C., Le Gros G. (2012) Staphylococcal-derived superantigen enhances peanut-induced Th2 responses in the skin. Clin. Exp. Allergy 42, 305–314 [DOI] [PubMed] [Google Scholar]
  • 6. Yang P. C., Xing Z., Berin C. M., Soderholm J. D., Feng B. S., Wu L., Yeh C. (2007) TIM-4 expressed by mucosal dendritic cells plays a critical role in food antigen-specific Th2 differentiation and intestinal allergy. Gastroenterology 133, 1522–1533 [DOI] [PubMed] [Google Scholar]
  • 7. Ley R. E., Peterson D. A., Gordon J. I. (2006) Ecological and evolutionary forces shaping microbial diversity in the human intestine. Cell 124, 837–848 [DOI] [PubMed] [Google Scholar]
  • 8. Lu J., Philpott D. J., Saunders P. R., Perdue M. H., Yang P. C., McKay D. M. (1998) Epithelial ion transport and barrier abnormalities evoked by superantigen-activated immune cells are inhibited by interleukin-10 but not interleukin-4. J. Pharmacol. Exp. Ther. 287, 128–136 [PubMed] [Google Scholar]
  • 9. Yang P. C., Berin M. C., Perdue M. H. (1999) Enhanced antigen transport across rat tracheal epithelium induced by sensitization and mast cell activation. J. immunol. 163, 2769–2776 [PubMed] [Google Scholar]
  • 10. Berin M. C., Kiliaan A. J., Yang P. C., Groot J. A., Taminiau J. A., Perdue M. H. (1997) Rapid transepithelial antigen transport in rat jejunum: impact of sensitization and the hypersensitivity reaction. Gastroenterology 113, 856–864 [DOI] [PubMed] [Google Scholar]
  • 11. He W., Ladinsky M. S., Huey-Tubman K. E., Jensen G. J., McIntosh J. R., Björkman P. J. (2008) FcRn-mediated antibody transport across epithelial cells revealed by electron tomography. Nature 455, 542–546 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Mellman I. (1996) Endocytosis and molecular sorting. Annu. Rev. Cell Dev. Biol. 12, 575–625 [DOI] [PubMed] [Google Scholar]
  • 13. Lafourcade C., Sobo K., Kieffer-Jaquinod S., Garin J., van der Goot F. G. (2008) Regulation of the V-ATPase along the endocytic pathway occurs through reversible subunit association and membrane localization. PLoS ONE 3, e2758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Li L., Soetandyo N., Wang Q., Ye Y. (2009) The zinc finger protein A20 targets TRAF2 to the lysosomes for degradation. Biochim. Biophys. Acta 1793, 346–353 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Wengst A., Reichl S. (2010) RPMI2650 epithelial model and three-dimensional reconstructed human nasal mucosa as in vitro models for nasal permeation studies. Eur. J. Pharm. Biopharm. 74, 290–297 [DOI] [PubMed] [Google Scholar]
  • 16. Chen X., Cho D. B., Yang P. C. (2010) Double staining immunohistochemistry. N Am. J. Med. Sci. 2, 241–245 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Vereecke L., Sze M., Mc Guire C., Rogiers B., Chu Y., Schmidt-Supprian M., Pasparakis M., Beyaert R., van Loo G. (2010) Enterocyte-specific A20 deficiency sensitizes to tumor necrosis factor-induced toxicity and experimental colitis. J. Exp. Med. 207, 1513–1523 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Niebuhr M., Mamerow D., Heratizadeh A., Satzger I., Werfel T. (2011) Staphylococcal α-toxin induces a higher T cell proliferation and interleukin-31 in atopic dermatitis. Int Arch Allergy Immunol. 156, 412–415 [DOI] [PubMed] [Google Scholar]
  • 19. Thienhaus M. L., Wohlers J., Podschun R., Hedderich J., Ambrosch P., Laudien M. (2011) Antimicrobial peptides in nasal secretion and mucosa with respect to Staphylococcus aureus colonization in chronic rhinosinusitis with nasal polyps. Rhinology 49, 554–561 [DOI] [PubMed] [Google Scholar]
  • 20. Moon I. J., Hong S. L., Kim D. Y., Lee C. H., Rhee C. S., Min Y. G. (2012) Blocking interleukin-17 attenuates enhanced inflammation by staphylococcal enterotoxin B in murine allergic rhinitis model. Acta Otolaryngol. 132, S6-S12 [DOI] [PubMed] [Google Scholar]
  • 21. Huvenne W., Callebaut I., Plantinga M., Vanoirbeek J. A., Krysko O., Bullens D. M., Gevaert P., Van Cauwenberge P., Lambrecht B. N., Ceuppens J. L., Bachert C., Hellings P. W. (2010) Staphylococcus aureus enterotoxin B facilitates allergic sensitization in experimental asthma. Clin. Exp. Allergy 40, 1079–1090 [DOI] [PubMed] [Google Scholar]
  • 22. Hitotsumatsu O., Ahmad R. C., Tavares R., Wang M., Philpott D., Turer E. E., Lee B. L., Shiffin N., Advincula R., Malynn B. A., Werts C., Ma A. (2008) The ubiquitin-editing enzyme A20 restricts nucleotide-binding oligomerization domain containing 2-triggered signals. Immunity 28, 381–390 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Yang P. C., Berin M. C., Yu L. C., Conrad D. H., Perdue M. H. (2000) Enhanced intestinal transepithelial antigen transport in allergic rats is mediated by IgE and CD23 (FcϵRII). J. Clin. Invest. 106, 879–886 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Yang P. C., Zeng H. Y., Zhang T. Y., Zheng Y. Q., Chen J. Z. (2001) The effects of sensitization and hypersensitivity reaction on transepithelial antigen transport of rat nasal mucosa. Otolaryngol Head Neck Surg. 125, 54–59 [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES