Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Nov 1.
Published in final edited form as: J Mol Cell Cardiol. 2012 Aug 11;53(5):626–638. doi: 10.1016/j.yjmcc.2012.08.002

Collagen XIV is important for growth and structural integrity of the myocardium

Ge Tao a,b, Agata K Levay c, Jacqueline D Peacock c, Danielle J Huk b,c, Sarah N Both b, Nicole H Purcell d, Jose R Pinto c,e, Maarten L Galantowicz b, Manuel Koch f, Pamela A Lucchesi b,g, David E Birk h, Joy Lincoln b,g,†
PMCID: PMC3472103  NIHMSID: NIHMS401255  PMID: 22906538

Abstract

Collagen XIV is a fibril-associated collagen with an interrupted triple helix (FACIT). Previous studies have shown that this collagen type regulates early stages of fibrillogenesis in connective tissues of high mechanical demand. Mice null for Collagen XIV are viable, however formation of the interstitial collagen network is defective in tendons and skin leading to reduced biomechanical function. The assembly of a tightly regulated collagen network is also required in the heart, not only for structural support but also for controlling cellular processes. Collagen XIV is highly expressed in the embryonic heart, notably within the cardiac interstitium of the developing myocardium, however its role has not been elucidated. To test this, we examined cardiac phenotypes in embryonic and adult mice devoid of Collagen XIV. From as early as E11.5, Col14a1−/− mice exhibit significant perturbations in mRNA levels of many other collagen types and remodeling enzymes (MMPs, TIMPs) within the ventricular myocardium. By post natal stages, collagen fibril organization is in disarray and the adult heart displays defects in ventricular morphogenesis. In addition to the extracellular matrix, Col14a1−/− mice exhibit increased cardiomyocyte proliferation at post natal, but not E11.5 stages, leading to increased cell number, yet cell size is decreased by 3 months of age. In contrast to myocytes, the number of cardiac fibroblasts is reduced after birth associated with increased apoptosis. As a result of these molecular and cellular changes during embryonic development and post natal maturation, cardiac function is diminished in Col14a1−/− mice from 3 months of age; associated with dilation in the absence of hypertrophy, and reduced ejection fraction. Further, Col14a1 deficiency leads to a greater increase in left ventricular wall thickening in response to pathological pressure overload compared to wild type animals. Collectively, these studies identify a new role for type XIV collagen in the formation of the cardiac interstitium during embryonic development, and highlight the importance of the collagen network for myocardial cell survival, and function of the working myocardium after birth.

Keywords: Collagen XIV, Myocardium, Extracellular Matrix, Cardiomyocytes, Cardiac fibroblasts

1. Introduction

The working heart requires integration of many diversified structures including the myocardium, valves and vessels. To achieve this, each structure is composed of specialized cell populations and a specific extracellular matrix (ECM) network that collectively provide the necessary biomechanics to meet hemodynamic demands during the cardiac cycle [1]. In the myocardium, cardiac myocytes and fibroblasts are the predominant cell types arranged within a complex ‘cardiac interstitium’ primarily composed of collagens, proteoglycans and glycoproteins [2]. During cardiogenesis, the ECM plays a crucial role in regulating many cellular processes including proliferation, adhesion, migration and changes in gene expression [1, 3, 4]. Further, perturbation of genes encoding matrix proteins can result in prenatal lethality or congenital heart disease in humans [1, 3]. After birth, the ECM is required to maintain homeostasis of adult cardiac structures under normal physiological conditions and in response to stress or injury [1, 3]. This is achieved through remodeling that commonly occurs in the myocardium following injury, such as myocardial infarction. This process is characterized by cardiac fibroblast activation to increase ECM synthesis and deposition of scar tissue to replace necrotic cardiomyocytes and maintain structural integrity [5]. While short-term remodeling can be beneficial, persistent ECM deposition after repair is deleterious and leads to ventricular stiffening and congestive heart failure [5]. Therefore it is imperative that the myocardium establishes and maintains an appropriately organized ECM network to meet the functional demands of healthy and compromised hearts.

Like most connective tissue systems, the development and maintenance of the cardiac interstitium is dependent on the assembly of collagen fibrils, predominantly types I, III and V, and the subsequent organization into highly ordered fibers [2, 6]. This hierarchical organization of collagen fibrils is essential for providing tensile strength to the myocardium in response to changes in hemodynamic load, and functions to transmit force during the cardiac cycle. The process of fiber formation from fibril bundles requires two major groups of fibril-associated molecules; the first are members of the leucine-rich repeat family of proteoglycans and glycoproteins including decorin, lumican, biglycan and fibromodulin [7–10]. The second group is the fibril-associated collagens with interrupted triple helices (FACIT) that include Collagen XIV, previously shown to be highly expressed in areas of high mechanical stress [11–15]. In its role as a FACIT, Collagen XIV predominantly interacts with, and adheres to Collagen I to promote fiber assembly [16]. Mice null for Collagen XIV are viable but detailed analyses of skin and tendons reveal defects in fibril growth and fiber assembly during embryonic development [11]. As a result of altered fibrillogenesis, fiber structure is compromised and the biomechanical functions of these tissues are significantly diminished [11]. Therefore suggesting that Collagen XIV is important for ECM assembly and tissue function in tendons and skin.

To date, there are limited studies examining the requirement of collagens for structure and function of the heart. A recent study reported that Collagen XV, a non-fibrillar collagen type localized to basement membranes of microvessels and cardiac myocytes, is necessary for organization of the cardiac interstitium and vasculature [17]. As a result, cardiomyocyte size is reduced and alignment is disrupted in young Col15a1−/− mice, while older animals develop early onset cardiomyopathy [17]. In addition to this study, we have described the roles of fibrillar Collagens V and XI for myocardial morphogenesis and formation of the cardiac valves during embryonic development [18]. In another study from our group, we reported Collagen XIV expression in the heart [19, 20], however its function was not examined. Therefore, in this current study we set out to characterize the cardiovascular phenotypes of embryonic and adult hearts from Col14a1−/− mice [11] at molecular, cellular and functional levels. Our data show that Collagen XIV plays an important role in establishing the cardiac interstitium within the developing myocardium, in addition to regulating cardiomyocyte growth and cardiac fibroblast survival. These alterations during embryonic development lead to functional defects in adult mice and greater increases in chamber wall growth in the absence of hyperplasia, in Col14a1−/− hearts following pressure overload conditions. Collectively our findings reveal previously unappreciated roles for FACIT collagens in the formation of the cardiac interstitium and development of the mature myocardium.

2. Material and methods

2.1 Generation of mice

Collagen (Col) 14a1+/− mice [11] were inbred to generate Col14a1−/− and wild type (Col14a1+/+) controls. Genotyping by PCR was performed as previously described [11] using genomic DNA isolated from mouse tail biopsies. All animal procedures were approved and performed in accordance with IACUC institutional guidelines at The Research Institute at Nationwide Children’s Hospital.

2.2 Histology

Whole hearts from Col14a1−/− and wild type (Col14a1+/+) mice were collected at E11.5, E14.5, Post natal day 1 (PND1) and 3 months of age in 1X Phosphate Buffered Saline (PBS) and either fixed in 4% paraformaldehyde (PFA) overnight at 4°C or left unfixed. Fixed tissues were subsequently processed for either paraffin- or cryo-embedding and sectioned at 6 µm and 10 µm, respectively. Alternatively, unfixed tissue was immediately processed for frozen block cryo-embedding and 10 µm tissue sections were cut. For fluorescent immunohistochemistry, fixed tissue sections were processed as previously described [21], followed by an overnight incubation at 4°C with primary antibodies against Collagen XIV [22] (1:200), Vimentin (Abcam, 1:200) Laminin a-2 (Sigma, 1:200), N-cadherin (Invitrogen, 1:200), MF20 (Hybridoma Bank, 1:400) and Phospho-histone H3 (Millipore, 1:200). Unfixed frozen sections were post fixed in ice-cold acetone at −20 °C for 15 mins, blocked in 5% bovine serum albumin/1XPBS for 30 mins and incubated with anti- Collagen Ia1 (Abcam, 1:200), Laminin a2 (Sigma, 1:200), MF20 (Hybridoma Bank, 1:400), Cleaved Caspase-3 (Cell Signaling, 1:200) and Thy-1 (BD Pharmingen, 1:100) for 2 hours at room temperature. Detection of primary antibodies was performed using appropriate conjugated secondary antibodies (1:200, PBS) (Alexa-Fluor, Invitrogen). Nuclei were detected by staining with DAPI (1µg/ml, 10 minutes) and/or cell membranes with Wheat Germ Agglutinin (WGA) (10µg/ml, 10 minutes). Stained tissue was mounted in Vectashield Hard Set mounting medium (Vector Laboratories). Images were captured using an Olympus BX51 fluorescent microscope. Quantitation of cardiac fibroblast and cardiomyocyte number was determined by counting cells the number of Thy1+/Vimentin+ (fibroblasts) or MF20+ (cardiomyocytes) cells, over the total number of DAPI-stained nuclei. To further examine proliferation and apoptosis rates of these cells, the number of Thy1+ (fibroblasts) or MF20+ double stained with Phospho-Histone H3+ (proliferation) or Cleaved Caspase-3 (apoptosis) were reported over the number of nuclei in at least 10 microscopic images from 3 hearts. The average number of cardiomyocytes (outlined by WGA staining), and number and length of intercalated discs (labeled by antibody against N-cadherin) were determined using Photoshop CS5 software (Adobe) (10 fields, n=3). Trichrome and Pentachrome staining were performed on paraffin tissue sections from Col14a1−/− and wild type adult hearts as previously reported [19]. Quantification of fibrosis in Trichrome stained tissue sections was determined by counting the total pixel numbers of blue area (total collagens) normalized to red area (cardiac muscle) using ImagePro Plus software. Significant differences in Col14a1−/− compared to wild types was determined using Student’s t-test (p<0.05).

2.3 Transmission Electron Microscopy

Ventricles were isolated from 3 month old Col14a1−/− and wild type mice and processed for transmission electron microscopy as described [23] [11]. Briefly, left ventricles were dissected and fixed in 4% PFA, 2.5% glytaraldehyde, 0.1 M sodium cacodylate, pH7.4, with 8.0 mM CaCl2, post-fixed with 1 % osmiumtetroxide and En-Bloc-Stained with uranyl acetate/50% ethanol. After dehydration in an ethanol series, followed by propylene oxide, tissue samples were infiltrated and embedded in a mixture of Embed 812, nadic methyl anhydride, dodecenyl succinic anhydride, and DMP-30 (Electron Microscopy Sciences, Hatfield, PA). Thin sections (90nm) were cut using a Leica Ultracut UCT ultramicrotome and post-stained with 2% aqueous uranyl acetate and 1% phosphotungstic acid, pH3.2. Sections were examined at 80 kV using JEOL 1400 transmission electron microscope and captured with a Gatan Ultrascan US1000 2 K digital camera.

2.4 Western blot

Collagens were extracted from Col14a1−/− and wild type ventricles at PND1 as previously described [11] using a 1X buffer (20 mM Tris (pH7.5), 150mM NaCl, 1mM EDTA, 1mM EGTA, 1% Triton X-100, 2.5mM sodium pyrophosphate, 1mM β-glycerophosphate, 1mM Na3VO4, supplemented with Complete EDTA (Roche) free protease inhibitor cocktail). 30µg of extracted collagen was run on a pre-cast 8% SDS PAGE gel (Invitrogen) and transferred to nitrocellulose membranes as described [19]. Membranes were blocked in 5% fat free dried milk for 1 hour and probed with antibodies against Collagen XIV [22] (1:1000, 2 hours) and Actin (1:5000, 1 hour, Chemicon/Millipore), followed by incubation with anti-mouse horseradish peroxidase-conjugated secondary antibody (1:15000, 1 hour, Cell signaling). Membranes were then washed three times in 1X TBST for 15 minutes. Western blots were developed using Super Signal West Pico Substrate (Pierce) and BioMax MR film (Eastman Kodak).

2.5 PCR analyses

Total mRNA was isolated from Col14a1−/− and wild type ventricles at E11.5, PND1 and 3 months of age, as well as TAC and Sham-operated mice using TRIzol [24]. 200~400 ng mRNA was used to generate cDNA using the high-capacity cDNA kit (Applied Biosystems) [21]. 1 µg of cDNA from each mRNA sample was subject to custom Taqman Low Density Array (TLDA) analysis using the 7900 HT Fast Real-Time System according the manufacturer’s instructions (Applied Biosystems). The ΔCt (cycle count) of each target gene was determined by normalization to the Ct of 18s. Fold changes in Col14a1−/− samples over wild types were determined as described [19]. Alternatively cDNA from E11.5, PN and 3 month old Col14a1−/− and wild type ventricles was subject to quantitative PCR (qPCR) using Taqman probes (Applied Biosystems) against mouse Col14a1 and normalized to 18s expression level (n=3). For absolute transcript calculation, the formula POWER(2, ((40−ΔCt)+Ct18s) was used, with Ct18s denoting the average cycle count of 18s mRNA levels. In addition, qPCR was also performed with cDNA prepared from TAC and Sham-operated (see below) Col14a1−/− and wild type ventricle CDNA using specific primers targeting mouse Col1a1 (Forward: GAGCGGAGAGTACTGGATCG; Reverse GTTCGGGCTGATGTACCAGT), Col3a1 (Forward: ACCAAAAGGTGATGCTGGAC; Reverse: GACCTCGTGCTCCAGTTAGC), Lox (Forward: TACTCCAGACTCTGTGCGCT; Reverse: GGACTCAGATCCCACGAAGG), Plod1 (Forward: TTCGTCGTCCGCTATAAGCC; Reverse: AGGAAGCCCCTCGTGATAGT), Plod2 (Forward: GAGCACTGAGTCCTGATGGG; Reverse: TGTTTCCGGAGTAGGGGAGT), P3H1 (Forward: CGCTTACACCTTTCGGGACT; Reverse: GTATCCGCTCCAGTTCTCGG), Glt25D1 (Forward: CATGTGCTTGCCTGGGACTA; Reverse: TCTCTTGGTGGTCAGCCCTA) and Glt25D2 (Forward: ATGTCAGGTGCAATGCTGGA; Reverse: CACAAGCTGGGGCTGGATAA), normalized to L7 (Forward: GAAGCTCATCTATGAGAAGGC; Reverse: AAGACGAAGGAGCTGCAGAAC) and detected using Sybr Green as described [19]. Statistical significance in transcript levels between Col14a1−/− and wild type samples were determined using Student’s t-test on at least 3 independent experiments with p<0.05.

2.6 Skinned Fiber Assays

Mouse Skinned Cardiac Fiber Preparation

Skinned papillary muscles were prepared from left ventricles isolated from Col14a1−/− and wild type mice (>n=3) at 3 months of age. Small bundles of fibers were isolated and treated overnight with a pCa 8.0 relaxing solution (10−8 M [Ca2+]free, 1 mM [Mg2+]free, 7 mM EGTA, 2.5 mM MgATP2−, 20 mM MOPS, pH 7.0, 20 mM creatine phosphate, and 15 units/ml creatine phosphokinase) containing 1% Triton X-100 and including 50% glycerol at −20 °C. Fibers were then transferred to a similar solution without Triton X-100 and stored at −20 °C [25].

Stretch-force Relationship Measurements at Low Ca2+ Concentration

Ventricular papillary muscle skinned fiber, prepared from 3 month old Col14a1−/− and wild types were mounted as described above. Fibers were treated with pCa8.0 containing 1% Triton X-100 for 30 mins and extensively washed with pCa 8.0 without Triton X-100. After the skinning process, the slack length from the fiber was determined by releasing and stretching until it starts to generate tension. This point was set as zero for both passive force and starting length. After this, the fiber was consecutively stretched 10% of its original length and the passive force in KN/m2 was recorded. These experiments were carried out at pCa 8.0.

2.7 Echocardiography

Transthoracic encocardiography was performed on 3, 6 and 12 month old Col14a1−/− and wild type male mice, as well as the TAC and Sham-operated mice before and 2 weeks after the surgery, using the VisualSonics 770 system (Toronto, Canada) as described [21]. Mice were anesthetized by 1% isoflurane inhalation and placed on a heated platform (37°C). Two-dimensional imaging was recorded with a 45 MHz transducer to capture long- and short-axis projections with guided M-Mode, B-Mode and PW Doppler recorded. For data presented in Table 1, the average reading for each echocardiographic parameter was recorded from at least 3 distinct frames from n=5–8 individual mice from the four experimental groups (wild type Sham (n=6), wild type TAC (n=8), Col14a1−/− Sham (n=5), Col14a1−/− TAC (n=7)) both prior to surgery and two weeks post surgery. Statistical significance was determined using Student’s t-test (p<0.05).

Table 1. Echocardiography measurements of wild type and Col14a1−/− mice following Sham and TAC surgeries.

Sham and TAC surgeries were performed on 8 week old wild type (ca1+/+) and Col14a1−/− mice. (Top) Average measurements taken from four experimental groups subjected to echocardiography pre-surgery, and 2 weeks post-surgery. (Bottom) Average percent changes in echocardiographic measurements of individual wild type and Col14a1−/− mice subject to Sham and TAC, comparing pre-surgery vs. post-surgery.

LVPW;d
(mm)
LVPW;s
(mm)
PWTH (%) LVID
stroke
vol. (µl)
EF (%) LV
Mas
corrected (mg)
HW/BW
(mg/g)
Pre-surgery
      Wild type Sham 0.64±0.09 0.83±0.13 29.36±2.26 40.63±5.95 52.90±6.17 76.59±8.87
      Wild type TAC 0.65±0.04 0.84±0.04 28.82±13.75 42.36±3.25 52.13±6.91 78.60±10.14
      Col14a1−/− Sham 0.72±0.03 0.87±0.07 21.59±13.61 43.38±9.63 49.27±6.02 93.77±18.68
      Col14a1−/− TAC 0.66±0.05 0.82±0.09 23.68±11.48 40.90±8.19 46.08±5.15 84.66±14.64
Post-surgery
      Wild type Sham 0.64±0.12 0.78±0.16 21.06±5.05 37.88±3.63 52.62±5.24 82.58±20.07 0.64±0.12
      Wild type TAC 0.82±0.14 1.06±0.14 29.97±11.54 39.23±3.65 55.10±5.05 96.39±19.92 0.82±0.14*
      Col14a1−/− Sham 0.70±0.10 0.81±0.09 16.23±12.85 43.58±7.73 48.73±5.44 93.00±27.99 0.70±0.10
      Col14a1−/− TAC 0.88±0.10 1.05±0.11 20.47±12.26 42.57±11.77 47.22±10.49 111.64±15.59 0.88±0.10*§

% Change
(Pre- vs. Post-surgery)
LVPW;d LVPW;s PWTH LVID
stroke
vol.c
EF LV Mass
corrected

      Wild type Sham 0±5 −7±6 −28±20 −5±18 0±1 7±16
      Wild type TAC 20±8# 26±14# 1±21 −8±9 5±11 19±4
      Col14a1−/− Sham −2±14 −7±7 −63±105 4±23 0±2 −1±16
      Col14a1−/− TAC 39±13*§ 29±11§ −56±28* 4±35 4±8 35±7*§
#

Sham vs. TAC within the same genotype;

Pre-surgery vs. post-surgery within the same genotype;

§

Wild type TAC vs. Col14a1−/− TAC (post surgery).

Note, no significant differences were observed between Wild type Sham vs. Col14a1−/− Sham post-surgery groups. Data presented as standard error of the ean. LVPW, Left ventricular wall thickness; LVID, left ventricular internal dimension; EF, Ejection fraction; Ao, aortic; LV, left ventricular; HW, heart weight; BW, body weight.

2.8 Transverse aortic constriction (TAC)

Artificial left ventricular pressure overload was performed on 8 week old Col14a1−/− and wild type mice following echocardiography, as previously described [26] with the modification of TAC and Sham-operated mice receiving Buprenorphine treatment subcutaneously (0.1 mg/kg) 12 hours after surgery. 2 weeks post surgery, mice were weighed and subjected again to echocardiography and then euthanized, hearts weighed and collected for analyses as described above.

2.9 Primary mouse cardiomyocyte isolation

Ventricular cardiomyocytes were isolated from 10 week old Col14a1−/− and wild type hearts (n=3) as described [27]. Briefly, each heart was mounted on a Langendorf apparatus followed by retrograde perfusion through the aorta with perfusion buffer (Alliance for Cell Signaling, Protocol PP00000125) [27] for 4 mins, followed by perfusion with buffer containing 12.5 µM CaCl2, 0.14 mg/mL trypsin and 4 Wünsch units of Liberase TH (Roche) for 4 mins (Col14a1−/−) or 6 mins (wild type). Ventricles were separated from the digested hearts, minced, triturated and cardiomyocytes were mechanically dispersed in perfusion buffer (containing 12.5 µM CaCl2 and 10% calf serum), and filtered. The isolated cardiomyocytes were then resuspended in increasing concentrations of CaCl2 over 16 mins to achieve a final concentration of 1 mM. Treated myocytes were plated on Laminin-coated 2-well chamber slides (Thermo) in Minimal Essential Medium with Hanks’ salts and 2 mM L-glutamine (MEM), supplemented with 5% calf serum, 10mM 2,3-butanedione monoxime, and 100 U/mL penicillin-streptomycin. After 1-hour incubation (5% CO2, 37 °C), plated cardiomyocytes were fixed with 2% PFA for 30 mins on ice and subjected to immunofluorescence using an antibody against MF20 (hybridoma bank, 1:400). Detection of the primary antibody against MF20 using appropriate secondary antibodies (Alexa-Fluor, Invitrogen) was performed and cells were further stained with WGA and DAPI as described above. Images of cells (400X magnification) were taken using Olympus BX51 microscope. The average size of each cardiomyocyte was determined by measuring the area (WGA+) of 50–100 cells (n=3) using Image J software. Statistical significance in cardiomyocyte area in Col14a1−/− versus wild type mice was determined using Student’s t-test (n=3, p<0.05).

3. Results

3.1 Collagen XIV is expressed in the developing heart

Collagen XIV is predominantly expressed in tissues of high mechanical stress [11–14], however its expression in the heart has not been fully examined. Using immunohistochemistry, Collagen XIV was not detected in the heart until embryonic day (E) 12.5 where it was observed in the developing epicardium and endocardial cushions (data not shown). By E14.5, expression was detectable at low levels within the interstitial space of the developing ventricular myocardium and epicardium (Figure 1A). In contrast, high levels of expression were observed in the developing rib structures (Figure 1A). By post natal (PN) stages, expression was higher within the subepicardial region (arrowhead, Figures 1B, E) as well as the interstitial space within the ventricular myocardium, particularly within the compact layer compared to the trabeculae layer (arrows, Figure 1B, E). Additional immunoreactivity was also seen within the developing valve leaflets and chordae tendineae (Figure 1C), as well as around the intramyocardial coronary vessels (Figure 1D). Expression was maintained in the adult myocardium (Figure 1F) and valve structures, although levels were less than during post natal stages (Figure 1F).

Figure 1. Collagen XIV is expressed in embryonic and adult mouse hearts.

Figure 1

(A) Immunofluorescence to show Collagen XIV expression at low levels within the cardiac interstitium of the developing murine myocardium at E14.5 (arrows), and subepicardial region (arrowhead). (B–E) Collagen XIV immunoreactivity is more highly expressed in the myocardium at post natal (PN) stages, with comparatively stronger immunoreactivity within the compact (C) versus trabeculae (T) layers, and continued high expression in the subepicardial region (arrowhead). (C) At PN stages, expression is also detected in the leaflets (arrow) and chordae tendineae (arrowhead) of the valves (mitral valve shown), as well as the intramyocardial coronary vessels (arrow, D). (E) Higher magnification of Collagen XIV immunoreactivity within the cardiac interstitium of the PN heart (arrows). Laminin α2 indicates cell membranes and DAPI, nuclei. (F) By 3 months of age, Collagen XIV is still detectable within the adult myocardium, although levels are reduced. LV, left ventricle; IVS, interventricular septum; MV, mitral valve, PN, post natal.

3.2 Col14a1−/− mice have attenuated cardiac function, but no change in the stretch-force relationship of the myocardium

To determine the role of Collagen XIV in the developing heart, cardiac structure and function was examined in Col14a1−/− and Col14a1+/+ (wild type) mice [11]. Western blot analysis performed on collagen extracts from post natal mice confirms a knockout of Collagen XIV in Col14a1−/− hearts compared to wild types (Figure 2A). Histological examination of hearts from 3 month old Col14a1−/− mice revealed a ‘rounded’ ventricular chamber (Figure 2C) compared to littermate wild types (Figure 2B), with no gross changes in wall thickness; consistent with indifferent heart weight to body weight ratios at baseline (data not shown). At the functional level, echocardiography of 3, 6 and 12 month old Col14a1−/− males showed increased left ventricular end-diastolic volume at 12 months of age (110µl±6.7 vs. 88µl±9.4), and all time points examined during systole (50µl±3.77 vs. 35µl±4.6, 42µl±1.8 vs. 34µl±1.0, 59µl±4.1 vs. 40µl±5.8) (Figures 3A, B). In addition, ejection fraction was significantly decreased in mutant mice at 3 (50.6%±3.0 vs. 57%±2.8), 6 (49.4%±1.44 vs. 56.3%±0.9) and 12 months (47.6%±1.6 vs. 54.4%±2.2) (Figure 3E). In support of histological analyses, left ventricular posterior wall (LVPW) thickness was not significantly altered in mutant mice (Figures 3C, D), other than a subtle decrease in LVPW during systole at 12 months of age (0.91mm±0.05 vs. 1.12mm±0.07) (Figure 3D). To determine if Collagen XIV deficiency affects the biomechanics of the ventricular chamber, stretch-force relationship assays were performed using skinned papillary muscles isolated from 3 month old Col14a1−/− and wild type mice. Unlike previous studies in the skin in which the maximum stretch of skin was dramatically reduced [11], the resistance of ventricular skinned fibers to stretch (0–40%) under resting conditions was not altered in Col14a1−/− mice. Collectively, these data suggest that gross cardiac structure and myocardial contractility is modestly altered in Col14a1−/− mice.

Figure 2. Col14a1−/− mice show gross histological changes in ventricular morphology at 3 months of age.

Figure 2

(A) Western blot of Collagen XIV expression in collagen extracts from post natal wild type (Col14a1+/+), and Col14a1−/− hearts. Note loss of protein in Col14a1−/− mice. Actin is used as a loading control. (B, C) Pentachrome staining to show cardiac morphology of 3 month old wild type (B) and Col14a1−/− (C) mouse hearts. Note the spherical appearance of the left ventricle of Col14a1−/− hearts. LV, left ventricle.

Figure 3. Echocardiography reveals differences in cardiac structure and function in adult Col14a1−/− male mice.

Figure 3

M-mode Doppler analysis to show left ventricular end-diastolic volume (LV vol;d) (A), LV end-systolic volume during systole (LV vol;s) (B), LV posterior wall thickness (LVPW) during diastole (d) (C), LVPW during systole (s) (D), and ejection fraction (EF) in Col14a1−/− and Col14a1+/+ male mice at 3, 6, and 12 months of age. *, indicates statistical significance, p<0.05. (F) Stretch-force relationship assay to determine maximal stretch of skinned fibers from 3 month old Col14a1−/− and wild type mice.

3.3 Loss of Collagen XIV during embryogenesis disrupts extracellular matrix homeostasis within the developing and mature myocardial interstitium

To ascertain changes in the composition and organization of ECM components within the ventricular myocardium of Col14a1−/− mice, a combination of gene expression, immunohistochemistry and electron microscopy assays were performed. Using Taqman Low Density Array assays, the approximate transcript levels of Col14a1 and several other collagen types were determined in ventricular tissue isolated from wild type and Col14a1−/− mice at E11.5, post natal and 3 months of age (Figure 4). In wild type mice, Col14a1 mRNA levels were relatively high and comparable with Col1a1 in the ventricular myocardium at E11.5 through post natal stages, while levels were significantly lower by 3 months of age. In the absence of Collagen XIV notable changes in mRNA levels of other collagen isoforms were observed in the ventricular myocardium of Col14a1−/− mice by E11.5. These include significant increases in Col1a1, Col1a2, Col3a1, Col27a1 and Col12a1 mRNA levels, and reduced Col6a1 and Col9a1. At post natal stages, only Col6a1 was affected with increased levels observed in null animals. By 3 months of age, levels of collagen isoforms were altered again in Col14a1−/− mice with alpha chain transcripts for fibril-forming collagen types Col1a1, Col1a2, Col11a1, Col27a1 all increasing, along with the network collagen type, Col8a2, while levels of Col12a1 (FACIT) were reduced. Consistent with a trend towards reduced levels of Col1a1 in the ventricular myocardium at 3 months of age (Figure 4A), additional Western blot analysis showed a 2.6-fold and 2185-fold decrease in protein expression in ventricles from Col14a1+/− and Col14a1−/− mice, respectively (Figure 5A). In support, immunostaining revealed a similar trend within the epicardium and ventricular interstitium (Figure 5A). Collectively these data show that loss of Collagen XIV from early stages of embryogenesis alters mRNA levels of several other collagen types in the developing and mature ventricular myocardium.

Figure 4. Collagen homeostasis is disrupted in the myocardium of Col14a1−/− mice.

Figure 4

Taqman Low Density Array was used to examine changes in mRNA levels of fibril-forming (A), network and beaded-forming (B) and FACIT-forming (C) collagens in cDNA generated from E11.5, PND1 and 3 months Col14a1−/− and Col14a1+/+ (wild type) ventricles. *, indicate p<0.05 in samples from Col14a1−/− mice compared to wild types.

Figure 5. Collagen fiber organization and remodeling gene expression is altered in the myocardium of Col14a1−/− mice.

Figure 5

(A) Western blot (left) and immunofluorescence (right) to show decreased Col1a1 expression in the ventricular myocardium of 3 month old Col14a1−/−, Col14a1+/− and wild type mice. (B) qPCR analysis to show fold changes in collagen processing enzymes in the ventricular myocardium of post natal Col14a1−/− compared to wild type controls. (C) TLDA analysis to show fold changes in expression of matrix remodeling genes in the ventricular myocardium of Col14a1−/− mice at E11.5, PN and 3 months of age. (D–F) Electron microscopy to examine collagen fiber organization in the ventricular myocardium of wild type (D) and Col14a1−/− mice (E–F) at PND1. Note lack of collagen fiber bundles in Col14a1−/− mice (E–F), compared to wild types (arrow, D).

To examine if changes in collagen transcripts are associated with alterations in overall collagen processing and myocardial matrix remodeling [28], qPCR analyses were performed. Compared to wild types, expression of Plod1 that encodes the enzyme lysyl hydroxylase1, and GLT25D1 and GLT25D2 (procollagen galactosyltransferases) were increased in the ventricular myocardium of post natal Col14a1−/− mice (Figure 5B). Therefore suggesting that post translational modifications of collagens are affected in these mice. At the level of matrix remodeling, Mmp2 (8.0±1.5), Mmp9 (412±42.6), and their inhibitors Timp2 (3.5±0.2) and Timp3 (2.2±0.08) were increased in Col14a1−/− mice at E11.5. Mmp2 and Mmp9 are gelatinases and serve to digest denatured collagens and Collagens IV and V within basement membranes [29]. In contrast, by post natal stages, Mmp3, known to target non-fibrillar collagens, proteoglycans, laminin, fibronectin and elastin, was significantly downregulated (0.0004±0.0002). However in the adult, only Timp2 expression is decreased (0.3±0.09) (Figure 5C). Electron microscopy analysis revealed that these collective alterations in collagen and remodeling gene profiles have detrimental effects on the ultrastructure of the ventricular myocardium at post natal stages (Figure 5D–F). In wild types, collagen fibrils were highly organized and arranged in tight bundles within the interstitial space (Figure 5D), while in Col14a1−/− mice fibrils were abnormally dispersed throughout the interstitial space (Figures 5E–F). These observations suggest that Collagen XIV is required to establish and maintain a balanced and organized ECM environment in the development myocardium.

3.4 Myocyte cell size and number is altered in the post natal ventricular myocardium of Col14a1−/− mice

To determine potential changes in cardiomyocyte maturation and growth in Col14a1−/− mice, morphometric and proliferation analyses were performed. At E11.5, analysis of Phospho-histone H3 (pHH3) immunoreactivity revealed undetectable differences in cell proliferation in the ventricle of Col14a1−/− mice compared to wild types (Figure 6C). At this time, cardiomyocyte size was also comparable with wild type mice (data not shown). By post natal stages (PND1), proliferation rates of cells almost certainly cardiomyocytes (MF20-positive) was significantly higher in Col14a1−/− mice (7.2±0.19 vs. 3.6±0.4) (Figures 6A–C), however at 3 months levels were back comparable with wild types. Although no change in cell proliferation was observed at 3 months, changes in cardiomyocyte size and number were noted. N-cadherin immunostaining revealed dramatic increases in the number (57.3±1.78 vs. 38.7±1.2, per microscopic field) (Figure 6D–F), and length (2.69mm±0.17 vs. 9.24mm±0.5) (data not shown) of cardiomyocyte intercalated discs in Col14a1−/− mice compared to wild types, suggesting increased numbers of smaller cells. In support, cultured cardiomyocytes isolated from 10 week old Col14a1−/− mice are 24% (±0.04%) smaller than wild types (Figure 6G–I). Although it is noted that this in vitro approach is circumstantial to in vivo conditions.. These studies suggest that Col14a1 plays an important role in proliferation and growth of cardiomyocytes during later stages of myocardial maturation.

Figure 6. Cardiomyocyte proliferation is prolonged in the myocardium of Col14a1−/− mice at post natal stages.

Figure 6

(A–C) Immunostaining of phospho-Histone H3 (pHH3) and MF20 to examine proliferation of cardiomyocytes respectively in PND1 Col14a1−/− mice (B) and wild types (A). Quantitation of the number of cells double stained with MF20 and pHH3 at E11.5 and PND1. (D, E) Immunoreactivity of N-cadherin to detect intercalated discs of cardiomyocytes in tissue sections of ventricles from 3 month old Col14a1−/− (E) and wild type (D) mice. Wheat Germ Agglutinin (WGA) highlights the cell membrane, and DAPI indicates nuclei. (F) Quantitation of the average number of cells per microscopic field. (G, H) MF20 immunostaining of cultured ventricular cardiomyocytes isolated from 3 month old Col14a1−/− (H) and wild type (G) mice. (I) Quantitation to show fold change in cardiomyocyte cell area. *p<0.05, in Col14a1−/− mice compared to wild types.

3.5 Cardiac fibroblast number is reduced in the post natal ventricular myocardium of Col14a1−/− mice

Our analyses show that in the absence of Collagen XIV, mRNA levels of differential collagens and matrix remodeling genes are significantly altered and myocyte proliferation is prolonged in the post natal myocardium. As previous studies have shown that cardiac fibroblasts interact with the ECM and cardiomyocytes to modulate homeostasis and remodeling of the myocardium [1], we examined this cell population in our system. At PND1, the percentage of cells expressing the fibroblast-associated marker Thy1, [30] was significantly lower in the post natal ventricular myocardium of Col14a1−/− mice (Figure 7A–C). In support, similar trends of reduced fibroblast numbers were also observed using a second marker, Vimentin (7.1%±0.3 vs. 5.5%±0.2). These observations were consistent with a significant increase in the number of Thy1-positive cells co-expressing the apoptosis marker, Cleaved Caspase-3 (Figures 7D–F), however differences in Thy-1+ cell proliferation were not detected (Figure 7G–I). Therefore we conclude that cardiac fibroblast cell death is increased in Collagen XIV null mice at post natal stages.

Figure 7. Fibroblast cell number is decreased in the ventricular myocardium of Col14a1−/− mice at post natal stages.

Figure 7

(A, B) Thy1 immunostaining to detect cardiac fibroblasts (arrows) within the ventricular myocardium of Col14a1−/− (B) and wild type (Col14a1−/−) mice (A) at PND1. (C) Percentage of Thy1 positive cells over the total number of nuclei. (D, E) Double immunostaining of Cleaved Caspase-3 and Thy1 within the ventricular myocardium of Col14a1−/− (E) and wild type (Col14a1−/−) mice (D) at the same time point. Arrowhead in D indicates apoptosis in a non-fibroblast cell, while arrows in E indicate double stained fibroblasts undergoing apoptosis. (F) Percentage of double stained (Cleaved Caspase-3 and Thy1) cells in Col14a1−/− and wild type mice over total number of Thy1-positive cells. (G, H) Double staining of phospho-Histone H3 (pHH3) and Thy1 within the ventricular myocardium of Col14a1−/− (H) and wild type (H) mice. (I) Percentage of double stained (pHH3 and Thy1) cells in Col14a1−/− and wild type mice over total number of Thy1-positive cells. *p<0.05, statistical significance in Col14a1−/−mice compared to wild types.[13]

3.6 Pressure overload enhances left ventricular wall growth in Col14a1−/− mice

Transverse aortic constriction (TAC) is commonly used as a model for pressure overload-induced cardiac hypertrophy [31]. In addition to myocyte enlargement (hypertrophy), animals subjected to TAC undergo extensive myocardial remodeling including an accumulation of interstitial collagen termed fibrosis, which is largely beneficial for ventricular remodeling short term, but long term, it increases ventricular stiffness, impairing cardiac function [32, 33]. To determine if hypertrophy and/or fibrosis is altered in Col14a1−/− mice, 8 week old null and wild type animals were subject to TAC to induce pressure overload for 2 weeks, or Sham surgery in which mice undergo the entire surgical procedure except for ligation of the aorta. As expected, compared to Sham mice, heart weight:body weight ratios, left ventricular posterior wall thickness (LVPW) and corrected left ventricular corrected mass were all increased in both wild type and Col14a1−/− mice subject to TAC (Table 1, Figure 8A–H). Interestingly, by determining the percent change of echocardiographic measurements between pre-versus post-surgery of Sham and TAC-operated mice, greater changes in LVPW and LV corrected mass were observed in Col14a1−/− mice following TAC, compared to wild types (Table 1). However, the average increase in myocyte cell size was not significantly different between genotypes after TAC, with an average increase of 37.71%±5.24 in wild types and 44.48%±5.02 in Col14a1−/− mice (p=0.4) (data not shown). At the level of fibrosis, Masson’s Trichrome staining to detect collagen deposition revealed no significant difference between Sham versus TAC-operated wild type mice and Col14a1−/− animals (Figure 8I). Collagen types I and III are predominant within pathological fibrotic lesions of the heart [34]. In our system, comparable fold change increases in Col1a1 were seen in both wild type (2.5±0.23) and Col14a1−/− (2.3±0.1) TAC-operated animals compared to respective Sham wild types, however the fold change of Col3a1 expression was more significantly increased in Col14a1−/− (4.0±0.05) TAC- versus Sham-operated Col14a1−/− mice compared to wild types (2.4±0.24) (Figure 8J). Collectively, these studies suggest that increased left ventricular wall thickness is greater in Col14a1−/− subject to pressure overload compared to wild type animals, despite levels of cardiomyocyte hypertrophy and fibrotic responses being comparable.

Figure 8. Left ventricular wall thickness is further increased in Col14a1−/− mice following pressure overload.

Figure 8

(A–H) Images from echocardiography B-mode short-axis view of the ventricular chambers of wild type (A–D) and Col14a1−/− (E–H) mice, prior to surgery (pre-surgery) (A, C, E, G) and two weeks post-surgery (B, D, F, H). Red lines indicate left ventricular wall thickness. White * indicate papillary muscles in the shortaxis view. (I) Quantitation of trichrome staining and (J) qPCR of fold changes in Col1a1 and Col3a1 gene expression in the ventricles of wild type and Col14a1−/− mice following surgeries. *, indicates significant differences in TAC-operated animals versus Sham mice of the same genotype. #, shows p<0.05 in differences between Sham and TAC in Col14a1−/− mice compared to differences observed between wild types.

4. Discussion

Collagen XIV is a FACIT-type collagen expressed in tissues of high mechanical stress [11–15]. Previously Ansorge et al., [11] generated mice null for this collagen type and reported dysfunctional fibrillogenesis in tendons and skin of mutant animals. In this current study, we report cardiac phenotypes and identify previously unappreciated roles for Collagen XIV in the development of the working myocardium. We observe that in the absence of Collagen XIV, the overall homeostasis of the ECM scaffold within the ventricular myocardium is compromised from as early as E11.5 (Figures 4 and 5) and associated with prolonged cardiomyocyte proliferation after birth and decreased myocyte size in adult Col14a1−/− mice (Figure 6). In addition, fewer fibroblasts within the ventricular myocardium are noted after birth as a result of increased apoptosis (Figure 7). These molecular and cellular abnormalities in young animals have detrimental effects on the overall structure and function of the adult working myocardium including exacerbated thickening of the left ventricular wall following pressure overload (Figure 8). These observations are one of the first to use a genetic mouse model to describe the importance of different collagens within the cardiac interstitium for myocardial growth and maturation, therefore providing new insights into potential mechanisms of adult myocardial disease in the human population.

The composition of ECM is a major factor well studied in the adult heart [1], however relatively less is known about how the cardiac interstitium is assembled in the developing embryo [35]. In this study, we show that by E11.5, mRNA levels of many collagen types are highly expressed in the developing ventricular myocardium, predominantly fibril-forming types Col1, Col2 and Col3, and comparable mRNA levels of the FACIT member, Col14a1 (Figure 4). Spatially, Col14a1 is first observed in nonmyocardial structures including the endocardial cushions from as early as E10.5, and high levels of expression are maintained in adult valves (Figure 1C) [20]. Surprisingly, loss of Col14a1 did not result in overt valvular phenotypes, suggesting a less important role in these connective tissue structures. In the myocardium, Collagen XIV immunoreactivity is not observed until E14.5, where it is localized to the subepicardial space and compact zone (Figure 1). Consistent with high levels of Col14a1 mRNA at E11.5, null mice display dramatic changes in transcript levels of other collagen types in the ventricular myocardium at this time (Figure 4). This includes significant increases in fibril-forming collagens Col1a1, Col1a2, Col3a1 and Col27a1 that form the structural framework of the cardiac interstitium and provide tensile strength during high mechanical demand [1]. These observed alterations in collagen mRNA homeostasis at E11.5 suggests that similar to tendons, Collagen XIV plays a role in establishing the collagen network in the ventricular myocardium and observed increases in the closely related FACIT, Col12a1 are not sufficient to compensate. It is known from Ansorge et al., [11] that Collagen XIV is important for fibrillogenesis, however it is appreciated that changes in transcript levels observed in this myocardial study may not reflect fibril assembly and fiber formation, although Collagen I protein levels were consistent with mRNA observations. Nonetheless, the lack of collagen fiber organization seen in the myocardium of Col14a1−/− mice (Figure 5C, D) along with significant changes in MMPs and their inhibitors, does suggest that assembly and remodeling of the cardiac interstititum is attenuated in this model. In contrast to tendons, these disruptions in collagen homeostasis do not affect the biomechanical properties of isolated ventricular skinned papillary fibers (Figure 3F). However, echocardiography to determine function of the intact heart indicates mild dilation of the left ventricle in the absence of hypertrophy, and decreased ejection fraction (Figure 3), although these parameters do not worsen after pressure overload. These studies suggest that defects in establishing the cardiac interstitium during development lead to attenuated physiological function of the working myocardium after birth. Additional studies using conditional approaches to delete Col14a1 function after birth would further test this hypothesis and determine the requirement of Collagen XIV in the adult myocardium for maintaining structure-function relationships.

In addition to the ECM architecture, collagens are critical components of the development and maintenance of cellular organization, communication and function including cell survival [1]. In many systems, collagens have been shown to play roles in positively and negatively regulating cell proliferation and apoptosis [36–39], although to date, little is known about the embryonic heart. During early stages of myocardial development myocyte proliferation is rapid, however after birth, cell division is rarely observed and growth into adulthood relies on hypertrophy [40]. At E11.5, cardiomyocyte proliferation in Col14a1−/− embryos is apparently normal, yet at post natal stages proliferation rates are much higher than wild types (Figure 7A–C), suggesting that Collagen XIV is not required for promoting early cardiomyocyte cell proliferation, but potentially important for cell cycle withdrawal after birth. By three months of age, proliferation as expected, is virtually absent in both wild types and null animals, however due to differences at post natal stages, cardiomyocyte number is higher in ventricles of adult Col14a1−/− mice (Figure 7D–F). Interestingly, this hyperplastic phenotype does not lead to increased wall thickness at baseline, as determined by echocardiography (Figure 3D), and this is likely due to the observed decrease in cardiomyocyte size in the absence of Collagen XIV. The mechanisms of prolonged proliferation in the post natal heart of Col14a1−/− mice are not clear and previous studies have reported a positive role for fibroblasts in promoting proliferation of embryonic myocytes [41, 42]. In the myocardium of Col14a1−/− mice fibroblast number is decreased as a result of apoptosis (Figure 7C), therefore suggesting that increased myocyte cell number is not due to expansion of the fibroblast cell population. However, it is considered that these opposing changes in myocyte and fibroblast cell survival in the neonatal myocardium of Col14a1−/− mice commonly stem from interruptions in formation of the collagen network during development. The effects of this will likely be detrimental on cell-cell and cell-ECM interactions [41], and lead to aberrations in known mechanisms of collagen-mediated cell survival, including integrin-mediated regulation of downstream signaling cascades such as PI3K/AKT [43–45]. Although these collective changes in myocardial cell number and size do not lead to hypertrophy or overt functional defects in adult Col14a1−/− mice at baseline, the pathological thickening of the left ventricular wall after TAC surgery is significantly greater than comparable surgeries in wild type mice (Figure 8, Table 1). As the degree of hypertrophy of individual myocytes in null animals is not significantly different, this suggests that in pressure overload conditions the underlying increase in myocyte number significantly promotes exacerbated pathological growth of the heart. This model of Col14a1 deficiency provides insights into the importance of establishing the cardiac interstitium for the regulation of cardiomyocyte and fibroblast cell survival and therefore, susceptibility of the working myocardium after birth.

It is well established that collagens serve to positively regulate tissue morphogenesis and function, and defects in the assembly, organization and maintenance of collagen fibrils underlies and promotes the progression of many pathological states. In the adult heart this is most well understood during fibrosis when initial collagen deposition is considered beneficial for replacing interstitial regions occupied by necrotic myocytes, while long-term, collagen secretion becomes deleterious to the overall biomechanics and function of the heart [5]. Despite a striking alteration in the balance of collagen mRNA levels in Col14a1−/− mice from E11.5, as well as reduced fibroblast number at birth, the cardiac fibrosis program is not significantly affected two weeks after pressure overload. However, long-term evaluations of fibrous scar tissue formation and ventricular function were not made in Col14a1−/− mice in this current study. In the human population, collagen gene mutations underlie many connective tissue diseases including Ehlers-Danlos and Stickler Syndrome, and although musculoskeletal abnormalities are prominent in these patients, cardiac defects are not commonly reported [46]. However in this current mouse model, exacerbated pathological left ventricular wall thickening was only evident following pressure overload, and therefore it is considered that Col14a1 loss of function may increase susceptibility in response to cardiac stress. To date, COL14 mutations have not been identified in the human population and although Col14a1−/− mice are viable, several connective tissues associated with high mechanical demand (tendon, skin, myocardium) display structural abnormalities and functional weaknesses stemming from defects in collagen composition and organization. This current mouse model [11] is the first to demonstrate the role of FACIT collagens in formation of the cardiac interstitium within the developing myocardium, and the importance of Collagen XIV in regulating cardiomyocyte and fibroblast cell populations during post natal stages. Further, we demonstrate that aberrations in assembly of the collagen network during embryonic development have detrimental effects on cardiac structure function after birth, particularly in a pressure overload model. Identification of the mechanism(s) underlying development of healthy myocardium will provide valuable insights into the mechanisms of cardiac disease including the previously unappreciated susceptibility in patients with connective tissue disorders.

Highlights.

  • Collagen XIV is expressed in the developing and mature heart

  • Col14a1−/− mice have alterations in collagen homeostasis and organization

  • Col14a1 regulates cardiomyocyte proliferation and fibroblast apoptosis

  • Cardiac stress increased myocardial wall thickening in Col14a1−/− mice

Acknowledgements

We thank Shelia Adams, Blair Austin, Damien Barnette, Harriet Hammond and Jingsheng Liang for technical assistance, in addition to Dr. Vidu Garg for scientific discussion. This work was supported by NIH/NHLBI (HL091878, JL) and AHA Predoctoral Fellowship (10PRE4360052, GT).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Disclosures. The authors of this paper have nothing to disclose.

Conflict of Interest. The authors of this paper have no conflicts of interest.

References

  • 1.Bowers SL, Banerjee I, Baudino TA. The extracellular matrix: at the center of it all. J Mol Cell Cardiol. 2010;48:474–482. doi: 10.1016/j.yjmcc.2009.08.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Eghbali M, Weber KT. Collagen and the myocardium: fibrillar structure, biosynthesis and degradation in relation to hypertrophy and its regression. Molecular and cellular biochemistry. 1990;96:1–14. doi: 10.1007/BF00228448. [DOI] [PubMed] [Google Scholar]
  • 3.Lockhart M, Wirrig E, Phelps A, Wessels A. Extracellular matrix and heart development. Birth Defects Res A Clin Mol Teratol. 2011;91:535–550. doi: 10.1002/bdra.20810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Carver W, Terracio L, Borg TK. Expression and accumulation of interstitial collagen in the neonatal rat heart. Anat Rec. 1993;236:511–520. doi: 10.1002/ar.1092360311. [DOI] [PubMed] [Google Scholar]
  • 5.Jourdan-Lesaux C, Zhang J, Lindsey ML. Extracellular matrix roles during cardiac repair. Life Sci. 2010;87:391–400. doi: 10.1016/j.lfs.2010.07.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zhang G, Young BB, Ezura Y, Favata M, Soslowsky LJ, Chakravarti S, et al. Development of tendon structure and function: regulation of collagen fibrillogenesis. Journal of musculoskeletal & neuronal interactions. 2005;5:5–21. [PubMed] [Google Scholar]
  • 7.Iozzo RV. Matrix proteoglycans: from molecular design to cellular function. Annual review of biochemistry. 1998;67:609–652. doi: 10.1146/annurev.biochem.67.1.609. [DOI] [PubMed] [Google Scholar]
  • 8.Birk DE, Lande MA. Corneal and scleral collagen fiber formation in vitro. Biochimica et biophysica acta. 1981;670:362–369. doi: 10.1016/0005-2795(81)90108-2. [DOI] [PubMed] [Google Scholar]
  • 9.Rada JA, Cornuet PK, Hassell JR. Regulation of corneal collagen fibrillogenesis in vitro by corneal proteoglycan (lumican and decorin) core proteins. Experimental eye research. 1993;56:635–648. doi: 10.1006/exer.1993.1081. [DOI] [PubMed] [Google Scholar]
  • 10.Pogany G, Vogel KG. The interaction of decorin core protein fragments with type I collagen. Biochemical and biophysical research communications. 1992;189:165–172. doi: 10.1016/0006-291x(92)91539-3. [DOI] [PubMed] [Google Scholar]
  • 11.Ansorge HL, Meng X, Zhang G, Veit G, Sun M, Klement JF, et al. Type XIV Collagen Regulates Fibrillogenesis: PREMATURE COLLAGEN FIBRIL GROWTH AND TISSUE DYSFUNCTION IN NULL MICE. J Biol Chem. 2009;284:8427–8438. doi: 10.1074/jbc.M805582200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Walchli C, Koch M, Chiquet M, Odermatt BF, Trueb B. Tissue-specific expression of the fibril-associated collagens XII and XIV. J Cell Sci. 1994;107(Pt 2):669–681. doi: 10.1242/jcs.107.2.669. [DOI] [PubMed] [Google Scholar]
  • 13.Berthod F, Germain L, Guignard R, Lethias C, Garrone R, Damour O, et al. Differential expression of collagens XII and XIV in human skin and in reconstructed skin. J Invest Dermatol. 1997;108:737–742. doi: 10.1111/1523-1747.ep12292122. [DOI] [PubMed] [Google Scholar]
  • 14.Niyibizi C, Visconti CS, Kavalkovich K, Woo SL. Collagens in an adult bovine medial collateral ligament: immunofluorescence localization by confocal microscopy reveals that type XIV collagen predominates at the ligament-bone junction. Matrix Biol. 1995;14:743–751. doi: 10.1016/s0945-053x(05)80017-4. [DOI] [PubMed] [Google Scholar]
  • 15.Young BB, Gordon MK, Birk DE. Expression of type XIV collagen in developing chicken tendons: association with assembly and growth of collagen fibrils. Dev Dyn. 2000;217:430–439. doi: 10.1002/(SICI)1097-0177(200004)217:4<430::AID-DVDY10>3.0.CO;2-5. [DOI] [PubMed] [Google Scholar]
  • 16.Gerecke DR, Meng X, Liu B, Birk DE. Complete primary structure and genomic organization of the mouse Col14a1 gene. Matrix Biol. 2004;22:595–601. doi: 10.1016/j.matbio.2003.11.005. [DOI] [PubMed] [Google Scholar]
  • 17.Rasi K, Hurskainen M, Kallio M, Staven S, Sormunen R, Heape AM, et al. Lack of collagen XV impairs peripheral nerve maturation and, when combined with laminin-411 deficiency, leads to basement membrane abnormalities and sensorimotor dysfunction. J Neurosci. 2010;30:14490–14501. doi: 10.1523/JNEUROSCI.2644-10.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lincoln J, Florer JB, Deutsch GH, Wenstrup RJ, Yutzey KE. ColVa1 and ColXIa1 are required for myocardial morphogenesis and heart valve development. Dev Dyn. 2006;235:3295–3305. doi: 10.1002/dvdy.20980. [DOI] [PubMed] [Google Scholar]
  • 19.Levay AK, Peacock JD, Lu Y, Koch M, Hinton RB, Jr, Kadler KE, et al. Scleraxis is required for cell lineage differentiation and extracellular matrix remodeling during murine heart valve formation in vivo. Circ Res. 2008;103:948–956. doi: 10.1161/CIRCRESAHA.108.177238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Peacock JD, Lu Y, Koch M, Kadler KE, Lincoln J. Temporal and spatial expression of collagens during murine atrioventricular heart valve development and maintenance. Dev Dyn. 2008;237:3051–3058. doi: 10.1002/dvdy.21719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Peacock JD, Levay AK, Gillaspie DB, Tao G, Lincoln J. Reduced sox9 function promotes heart valve calcification phenotypes in vivo. Circ Res. 2010;106:712–719. doi: 10.1161/CIRCRESAHA.109.213702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Veit G, Hansen U, Keene DR, Bruckner P, Chiquet-Ehrismann R, Chiquet M, et al. Collagen XII interacts with avian tenascin-X through its NC3 domain. J Biol Chem. 2006;281:27461–27470. doi: 10.1074/jbc.M603147200. [DOI] [PubMed] [Google Scholar]
  • 23.Birk DE, Trelstad RL. Extracellular compartments in tendon morphogenesis: collagen fibril, bundle, and macroaggregate formation. J Cell Biol. 1986;103:231–240. doi: 10.1083/jcb.103.1.231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lincoln J, Kist R, Scherer G, Yutzey KE. Sox9 is required for precursor cell expansion and extracellular matrix organization during mouse heart valve development. Developmental biology. 2007;305:120–132. doi: 10.1016/j.ydbio.2007.02.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Baudenbacher F, Schober T, Pinto JR, Sidorov VY, Hilliard F, Solaro RJ, et al. Myofilament Ca2+ sensitization causes susceptibility to cardiac arrhythmia in mice. J Clin Invest. 2008;118:3893–3903. doi: 10.1172/JCI36642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wilkins BJ, Dai YS, Bueno OF, Parsons SA, Xu J, Plank DM, et al. Calcineurin/NFAT coupling participates in pathological, but not physiological, cardiac hypertrophy. Circ Res. 2004;94:110–118. doi: 10.1161/01.RES.0000109415.17511.18. [DOI] [PubMed] [Google Scholar]
  • 27.Shenouda SK, Lord KC, McIlwain E, Lucchesi PA, Varner KJ. Ecstasy produces left ventricular dysfunction and oxidative stress in rats. Cardiovasc Res. 2008;79:662–670. doi: 10.1093/cvr/cvn129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Levick SP, Brower GL. Regulation of matrix metalloproteinases is at the heart of myocardial remodeling. Am J Physiol Heart Circ Physiol. 2008;295:H1375–H1376. doi: 10.1152/ajpheart.907.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Clark IM, Swingler TE, Sampieri CL, Edwards DR. The regulation of matrix metalloproteinases and their inhibitors. Int J Biochem Cell Biol. 2008;40:1362–1378. doi: 10.1016/j.biocel.2007.12.006. [DOI] [PubMed] [Google Scholar]
  • 30.Hudon-David F, Bouzeghrane F, Couture P, Thibault G. Thy-1 expression by cardiac fibroblasts: lack of association with myofibroblast contractile markers. J Mol Cell Cardiol. 2007;42:991–1000. doi: 10.1016/j.yjmcc.2007.02.009. [DOI] [PubMed] [Google Scholar]
  • 31.deAlmeida AC, van Oort RJ, Wehrens XH. Transverse aortic constriction in mice. J Vis Exp. 2010 doi: 10.3791/1729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Creemers EE, Pinto YM. Molecular mechanisms that control interstitial fibrosis in the pressure-overloaded heart. Cardiovasc Res. 2011;89:265–272. doi: 10.1093/cvr/cvq308. [DOI] [PubMed] [Google Scholar]
  • 33.Oka T, Xu J, Kaiser RA, Melendez J, Hambleton M, Sargent MA, et al. Genetic manipulation of periostin expression reveals a role in cardiac hypertrophy and ventricular remodeling. Circ Res. 2007;101:313–321. doi: 10.1161/CIRCRESAHA.107.149047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.van den Borne SW, Diez J, Blankesteijn WM, Verjans J, Hofstra L, Narula J. Myocardial remodeling after infarction: the role of myofibroblasts. Nat Rev Cardiol. 2010;7:30–37. doi: 10.1038/nrcardio.2009.199. [DOI] [PubMed] [Google Scholar]
  • 35.Espira L, Czubryt MP. Emerging concepts in cardiac matrix biology. Can J Physiol Pharmacol. 2009;87:996–1008. doi: 10.1139/Y09-105. [DOI] [PubMed] [Google Scholar]
  • 36.Sasaki J, Fujisaki H, Adachi E, Irie S, Hattori S. Delay of cell cycle progression and induction death of cancer cells on type I collagen fibrils [corrected] Connective tissue research. 2011;52:167–177. doi: 10.3109/03008207.2010.498596. [DOI] [PubMed] [Google Scholar]
  • 37.Hopfer U, Hopfer H, Meyer-Schwesinger C, Loeffler I, Fukai N, Olsen BR, et al. Lack of type VIII collagen in mice ameliorates diabetic nephropathy. Diabetes. 2009;58:1672–1681. doi: 10.2337/db08-0183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Ieda M, Tsuchihashi T, Ivey KN, Ross RS, Hong TT, Shaw RM, et al. Cardiac fibroblasts regulate myocardial proliferation through beta1 integrin signaling. Developmental cell. 2009;16:233–244. doi: 10.1016/j.devcel.2008.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Cheng IH, Lin YC, Hwang E, Huang HT, Chang WH, Liu YL, et al. Collagen VI protects against neuronal apoptosis elicited by ultraviolet irradiation via an Akt/phosphatidylinositol 3-kinase signaling pathway. Neuroscience. 2011;183:178–188. doi: 10.1016/j.neuroscience.2011.03.057. [DOI] [PubMed] [Google Scholar]
  • 40.Ahuja P, Sdek P, MacLellan WR. Cardiac myocyte cell cycle control in development, disease, and regeneration. Physiological reviews. 2007;87:521–544. doi: 10.1152/physrev.00032.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Baudino TA, Carver W, Giles W, Borg TK. Cardiac fibroblasts: friend or foe? Am J Physiol Heart Circ Physiol. 2006;291:H1015–H1026. doi: 10.1152/ajpheart.00023.2006. [DOI] [PubMed] [Google Scholar]
  • 42.Ieda M, Fukuda K. Cardiac innervation and sudden cardiac death. Current cardiology reviews. 2009;5:289–295. doi: 10.2174/157340309789317904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Howell SJ, Doane KJ. Type VI collagen increases cell survival and prevents anti-beta 1 integrin-mediated apoptosis. Experimental cell research. 1998;241:230–241. doi: 10.1006/excr.1998.4051. [DOI] [PubMed] [Google Scholar]
  • 44.Milner R, Campbell IL. The integrin family of cell adhesion molecules has multiple functions within the CNS. Journal of neuroscience research. 2002;69:286–291. doi: 10.1002/jnr.10321. [DOI] [PubMed] [Google Scholar]
  • 45.Iyengar P, Espina V, Williams TW, Lin Y, Berry D, Jelicks LA, et al. Adipocyte-derived collagen VI affects early mammary tumor progression in vivo, demonstrating a critical interaction in the tumor/stroma microenvironment. J Clin Invest. 2005;115:1163–1176. doi: 10.1172/JCI23424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Malfait F, Wenstrup RJ, De Paepe A. Clinical and genetic aspects of Ehlers-Danlos syndrome, classic type. Genetics in medicine : official journal of the American College of Medical Genetics. 2010;12:597–605. doi: 10.1097/GIM.0b013e3181eed412. [DOI] [PubMed] [Google Scholar]

RESOURCES