Abstract
The Iroquois homeobox (Irx) homeodomain transcription factors are important for several aspects of embryonic development. In the developing heart, individual Irx genes are important for certain postnatal cardiac functions, including cardiac repolarization (Irx5) and rapid ventricular conduction (Irx3). Irx genes are expressed in dynamic and partially overlapping patterns in the developing heart. Here we show in mice that Irx3 and Irx5 have redundant function in the endocardium to regulate atrioventricular canal morphogenesis and outflow tract formation. Our data suggest that direct transcriptional repression of Bmp10 by Irx3 and Irx5 in the endocardium is required for ventricular septation. A postnatal deletion of Irx3 and Irx5 in the myocardium leads to prolongation of atrioventricular conduction, due in part to activation of expression of the Na+ channel protein Nav1.5. Surprisingly, combined postnatal loss of Irx3 and Irx5 results in a restoration of the repolarization gradient that is altered in Irx5 mutant hearts, suggesting that postnatal Irx3 activity can be repressed by Irx5. Our results have uncovered complex genetic interactions between Irx3 and Irx5 in embryonic cardiac development and postnatal physiology.
Keywords: Transcription factors, Heart development, Electrophysiology, Mouse
INTRODUCTION
Heart development is governed by a complex network of transcription factors that precisely regulates cardiac gene expression (Olson, 2006; Srivastava, 2006; Evans et al., 2010). Many transcription factors are specifically expressed in cardiogenic tissue early in development and are required for early steps in cardiogenesis. These factors are also relevant to human diseases, as mutations in these genes are associated with human congenital structural heart defects, including defects in chamber septation and outflow tract formation (Bruneau, 2008). No single transcription factor has been shown to be essential for all aspects of cardiogenesis, which is likely to reflect considerable functional redundancy between transcription factors in the cardiac lineage.
Transcription factors of the Iroquois homeobox (Irx) family are expressed in the heart and have conserved roles during embryonic development in metazoans (Christoffels et al., 2000; Cavodeassi et al., 2001; Mummenhoff et al., 2001). In mouse, five out of the six Irx members have been individually deleted, and deletions of three result in defects of cardiac function. Irx4-deficient mice develop adult mild cardiomyopathy and abnormal ventricular gene expression (Bruneau et al., 2001). Deletions of Irx3 or Irx5 lead to specific defects in adult ventricular conduction or repolarization, respectively (Costantini et al., 2005; Zhang, S. S. et al., 2011). The Irx genes encode proteins of similar structure, containing a highly conserved DNA-binding homeodomain, followed by an acidic activation domain and the IRO (Iroquois) box, a conserved motif of unknown function (Burglin, 1997). Irx genes provide a rare example of genetic redundancy in Drosophila (Gomez-Skarmeta et al., 1996; Cavodeassi et al., 2001) and are highly redundant in zebrafish (Itoh et al., 2002). Murine Irx genes are expressed in partially overlapping patterns in most developing tissues and organs, including the heart (Christoffels et al., 2000; Houweling et al., 2001; Mummenhoff et al., 2001). Although Irx3 or Irx5 deletion does not lead to abnormalities in embryonic cardiac morphogenesis (Costantini et al., 2005; Zhang, S. S. et al., 2011), the Fused toes mouse, in which three Irx genes (Irx3, Irx5 and Irx6) are deleted, displays cardiac abnormalities in utero (Peters et al., 2002). Along with the protein homology of the Irx3 and Irx5 transcription factors and their overlapping expression patterns, these data suggest that they function redundantly in pre-natal cardiac development as well as postnatal cardiac function.
To investigate the potential functional redundancy between Irx3 and Irx5, we generated mice bearing a deletion of both genes. In contrast to the single knockouts, mice lacking both Irx3 and Irx5 die in utero and have severe defects of the outflow tract (OFT) and atrioventricular (AV) canal due to specific requirement for Irx3 and Irx5 in the endocardium. Several BMPs are upregulated in the embryonic double-knockout (DKO) mice, Bmp10 being a direct downstream target of repression by Irx3 and Irx5. In addition, we analyzed the postnatal redundancy of Irx3 and Irx5 in the cardiac conduction system by generating a postnatal deletion of both genes in the cardiac tissue. The spectrum of electrophysiological defects in these mice suggests redundant and unique roles for Irx3 and Irx5 in the conduction of the ventricular electrical influx. These results reveal new and partially redundant roles for Irx3 and Irx5 during heart development and postnatal function.
MATERIALS AND METHODS
Gene targeting and mice
Generation of the Irx3flox Irx5EGFP/Irx3flox Irx5EGFP mice was achieved by sequential gene targeting in embryonic stem cells (R.S. and C.-C.H., unpublished). Briefly, a conditional allele for Irx3 was generated by flanking exons 2 to 4 with loxP sites. This line was then retargeted to replace Irx5 exon 1 by EGFP cDNA, followed by a polyadenylation signal sequence. A PGK-puro cassette was also introduced in place of Irx5 exon 2, thereby deleting the homeobox domain. Genotyping was carried out using the following primers (5′-3′): Irx3flox allele, CAAGAAGGGGTGATGAGAGTCGCTGGGCG and GGAGAGGGAACCACGGCGAGAAAGGCCTA; Irx3KO allele, CTCGGATACCAGTACATCCGCCCTCTCTA and GGAGAGGGAACCACGGCGAGAAAGGCCTA; Irx5EGFP allele, GGTCCCGAAGGGCCAGAATCAGAATTGGGG, GCATTCTTCCGGTACGCGGGGTCCCCATA and CCGGTGGATGTGGAATGTGTGCGAGGCCA. Complete deletion of Irx3 was obtained by crossing with Mef2cAHF::Cre female mice, which have germline Cre activity (Verzi et al., 2005). Irx3TaulacZ, Wnt1::Cre, Mef2cAHF::Cre, Nkx2.5::Cre, Tie2::Cre, Isl1::Cre, Myh6::MerCreMer and ca-Bmpr1a have been described (Brault et al., 2001; Kisanuki et al., 2001; Sohal et al., 2001; McFadden et al., 2004; Verzi et al., 2005; Yang et al., 2006; Kamiya et al., 2008; Zhang, S. S. et al., 2011). Animals were cared for in accordance with national and institutional requirements.
Histology
Embryos were harvested from timed matings and fixed in 4% paraformaldehyde (PFA) overnight, followed by embedding in paraffin and staining with Hematoxylin and Eosin (H&E). Optical projection tomography (OPT) imaging of hearts was performed as described (Sharpe et al., 2002; Lickert et al., 2004).
Protein expression analysis
For immunofluorescence analysis, 8 μm cryosections were stained with primary antibodies against β-galactosidase (Cappel), green fluorescent protein (GFP) (Abcam), phospho-Smad1/5/8 (Cell Signaling Technology), Cx40 (Alpha Diagnostic), Nav1.5 (Alomone) and Kv4.2 (Abcam). Secondary antibody staining was performed using Alexa 488- and Alexa 594-conjugated antibodies (Invitrogen). Vectashield Mounting Media with DAPI was used for DNA counterstaining and mounting (Vector Laboratories).
Gene expression analysis
For microarray analysis, ventricles and OFT were dissected from E12.5 hearts and digested with 0.2 mg/ml trypsin (Invitrogen) and 50 U/ml type II collagenase (Worthington) in calcium- and magnesium-free Hanks' buffer with Hepes at 37°C. Irx5EGFP-positive cells were isolated using FACSDiva. RNA was isolated using the PicoPure RNA Isolation Kit (Arcturus Bioscience). For each sample, 1 ng RNA was amplified using the FFPE Kit (NuGEN) and hybridized on Mouse Gene ST 1.0 microarrays (Affymetrix). For quantitative (q) real-time RT-PCR, 20 ng amplified cDNA was used. Primers (TaqMan assay, Applied Biosystems) for Tgfbr3, Runx1t1, Isl1, Fgf10, Fgfr2, Bmp2, Bmp5, Bmp10 and Irx3 were as follows: Mm00803538_m1, Mm00486771_m1, Mm00627860_m1, Mm00433275_m1, Mm01275521_m1, Mm01340178_m1, Mm00432091_m1, Mm01183889_m1 and Mm00500463_m1. β-actin (Mm00607939_s1) was used as internal control (Applied Biosystems). In situ hybridization was performed according to a standard protocol using 10 μm paraffin sections.
Luciferase assays, co-immunoprecipitation and chromatin immunoprecipitation
Transfections and luciferase assays were performed using published methods (Bruneau et al., 2001). Cos7 cells were transfected with 250 ng of each plasmid using Fugene (Roche). Co-immunoprecipitation was performed using the ExactaCruz Kit (Santa Cruz) following the manufacturer's instructions. Primary antibody against Irx5 (Sigma WH0010265M1) was used for immunoprecipitation and antibody against Irx3 (Abcam AB25703) was used for immunoblot analysis. For chromatin immunoprecipitation, chromatin was isolated from wild-type E12.5 and E14.5 hearts, sonicated and incubated with antisera against Irx3 (Abcam AB25703) or Irx5 (Sigma WH0010265M1). DNA fragments were analyzed by custom TaqMan assay for the Bmp10 promoter: 5′-CTGTGGCAGTTGCACGTACT-3′ and 5′-ATGCTTTTTGGAACCTCGTG-3′.
Electrophysiology
Surface ECG was obtained at 8-10 weeks as described (Bruneau et al., 2001). Telemetry devices (Data Sciences International, St Paul, MN, USA) were implanted dorsally with electrodes in lead II configuration. After 60 hours of recovery post-surgery, data were collected and analyzed using Dataquest A.R.T. (DSI) and Chart (ADInstruments).
Data analysis
Statistical comparisons were performed by Student's t-test with P<0.05 considered significant. Microarrays were normalized for array-specific effects using Affymetrix Robust Multi-Array (RMA) normalization. Normalized arrays values were reported on a log2 scale. For statistical analyses, we removed array probesets where no experimental groups had an average log2 intensity greater than 3.0. Linear models were fitted for each gene using the Bioconductor limma package in R. Moderated t-statistics, fold-change and the associated P-values were calculated for each gene. To account for testing thousands of genes, we reported false discovery rate (FDR)-adjusted values, calculated using the Benjamini-Hochberg method (Benjamini and Hochberg, 1995). FDR values indicate the expected fraction of falsely declared differentially expressed genes among the total set of declared differentially expressed genes. Two-way hierarchical agglomerative clustering was applied to the gene expression matrix consisting of Irx3het, Irx3KO;Irx5het, Irx5KO and Irx3;Irx5 DKO samples (horizontally) and the 458 statistically differentially expressed genes (vertically). Input consists of replicate expression values for each gene and sample. We applied average linkage clustering with uncentered correlation using Cluster software (Eisen et al., 1998). For each gene, expression values were centered to the median. Clusters were visualized using TreeView software. Microarray data are available in GEO with accession number GSE38826.
RESULTS
Expression pattern of Irx3 and Irx5 in the embryonic heart
Irx3 and Irx5 are expressed in complementary domains, at least up until E12.5 (Christoffels et al., 2000). We analyzed the expression pattern of Irx3 and Irx5 at E12.5 and E14.5, with Irx3taulacZ and Irx5EGFP alleles and immunostaining for β-gal and EGFP, to define cell types that express either one of these factors. At E12.5, Irx3-expressing cells were detected in the ventricular trabeculae (Fig. 1Aa, arrowheads) and in the interventricular septum, at the level of the bundle of His (BH) and bundle branches (BBs) (Fig. 1Ad). These cells colocalize with a marker of cardiomyocytes, tropomyosin (Fig. 1Ba), but not with the endocardial marker PECAM (Pecam1) (Fig. 1Bb). Irx5 was detected in PECAM-positive cells lining the ventricular trabeculae and septum (Fig. 1Ab,e,Bc,d, arrowheads) that did not express Irx3 (Fig. 1Ac,f). In addition, we identified a set of PECAM+ cells lining the AV cushions that coexpressed Irx3 and Irx5 (Fig. 1Af,Bb,d, arrows). Fig. 1C illustrates the expression profile of Irx3 and Irx5 at E12.5. By E14.5, coexpression of Irx3 and Irx5 broadens to include tropomyosin+ cells of the ventricular trabeculae (Fig. 1Da-c, arrowheads) as well as BH and BBs (Fig. 1Dd-f,Ea,b). Fig. 1F summarizes the expression pattern of Irx3 and Irx5 at E14.5.
Fig. 1.
Expression pattern of Irx3 and Irx5 during heart development. (A-C) Immunofluorescence colocalization of Irx3taulacZ and Irx5EGFP expression in the heart of Irx3taulacZ/+;Irx5EGFP/+ mouse embryos at E12.5. Irx3 is uniquely expressed in the myocardium of the trabeculae (arrowheads, Aa) and in the ventricular conduction system (Ad), where it colocalizes with tropomyosin (Ba) but not with PECAM (Bb) or Irx5 (Ac,f). Irx5 is expressed in the endocardium lining the ventricular septum and trabeculae (arrowheads, Ab,e), where it colocalizes with PECAM (arrowhead, Bd) but not tropomyosin (Bc) or Irx3 (Ac,f). Irx3 and Irx5 are coexpressed in the endocardium lining the AV endocardial cushions (arrow, Af) and colocalize at that level with PECAM (arrow, Bb,d). (C) Summary of the expression pattern of Irx3 and Irx5 at E12.5. (D-F) Immunofluorescence colocalization of Irx3taulacZ and Irx5EGFP expression in the heart of Irx3taulacZ/+;Irx5EGFP/+ embryos at E14.5. Irx3 and Irx5 are expressed in the ventricular trabeculae (arrowheads, Da-c) and conduction system, bundle of His (BH) and bundle branches (Dd-f), and they colocalize with tropomyosin (Ea) but not PECAM (Eb). Expression in the atria is restricted to Irx5 (Da-c). (F) Summary of the expression pattern of Irx3 and Irx5 at E14.5. RA, right atrium; LA, left atrium; RV, right ventricle; LV, left ventricle; OFT, outflow tract; IVS, interventricular septum; AVC, atrioventricular cushions; LBB, left bundle branch.
Cardiac defects in Irx3;Irx5 DKO embryos
Irx3 and Irx5 are located within 600 kb of each other on mouse chromosome 8. To create DKOs, the two genes must be targeted in cis. We used an allele that included a replacement of Irx5 with EGFP and a conditional deletion of Irx3 by flanking exons 2-4 with loxP sites. Crossing the Irx3flox Irx5EGFP/Irx3flox Irx5EGFP to a mouse line that expresses Cre recombinase in the germ line, we obtained heterozygous mice (Irx3+ Irx5+/Irx3KO Irx5EGFP) that were viable and fertile. The mating of these mice did not yield homozygous offspring, suggesting that the Irx3;Irx5 DKO was embryonic lethal. Western blot analysis confirmed the absence of Irx3 and Irx5 proteins in the DKO embryos at E11.5 (R.S. and C.-C.H., unpublished). To determine the onset of embryonic lethality, we collected and genotyped embryos from Irx3+ Irx5+/Irx3KO Irx5EGFP matings at different stages of development. At E14.5, the ratio of the expected genotypes showed normal Mendelian transmission (Table 1). However, from E15.5 onwards, the Irx3KO Irx5EGFP/Irx3KO Irx5EGFP genotype was not represented, suggesting lethality of Irx3;Irx5 DKO embryos after E14.5.
Table 1.
Lethality of Irx3;Irx5 DKO embryos after E14.5
Given that Irx3 and Irx5 are coexpressed in the heart and regulate cardiac function, we determined whether embryonic lethality of the Irx3;Irx5 DKO mice was associated with cardiac structural defects. We produced 3D reconstructions of embryonic hearts by optical projection tomography (OPT) and examined serial transverse sections of wild-type and DKO embryos at several developmental stages. Cardiac malformations were first observed at E11.5. OPT analysis showed an improper orientation of the OFT (Fig. 2A,B). By E12.5, transverse sections revealed a misalignment of the OFT, such that the aorta was abnormally oriented toward the right ventricle (RV) (Fig. 2C,D). Although the growth of the muscular ventricular septum was normal at this stage (Fig. 2E,F), a defect was observed at the level of the atrial septum, with an absence of the dorsal mesenchymal protrusion (DMP) and septum primum (Fig. 2G,H, asterisk). At E14.5, DKO hearts demonstrated an abnormal arrangement of the aorta alongside the pulmonary artery, leading to a double-outlet right ventricle (DORV) (Fig. 2I-L). In addition, we observed a membranous ventricular septal defect (VSD) at the level of the AV canal (Fig. 2M,N, arrowhead) at E12.5, a defect in DMP formation, an atrial septal defect (ASD), and defects in the growth of septa primum and secundum (Fig. 2O,P, asterisk).
Fig. 2.
Abnormal cardiac morphology of Irx3;Irx5 DKO embryos. (A,B) Cardiac morphology at E11.5. OPT analysis showing views of the heart surface (top row) and of the inner lumens at the level of the OFT (bottom row) revealing abnormal orientation (arrows) of the OFT in the DKO (Irx3KO Irx5EGFP/Irx3KO Irx5EGFP) as compared with the wild-type (Irx3+ Irx5+/Irx3+ Irx5+) mouse heart. (C-H) Cardiac morphology at E11.5. Serial sections with Hematoxylin and Eosin (H&E) staining at the level of the OFT (C,D), showing that the RV and aorta appear to be abnormally aligned. At the level of the AV canal (E-H), the Irx3;Irx5 DKO embryos have normal growth of the muscular ventricular septum (E,F) but exhibit a defect in atrial septation with absence of the DMP (asterisk, G,H). (I-P) Cardiac morphology at E14.5. OPT analysis (I,J) at the surface (top row) and inner lumen (bottom row) as well as sections (K,L) show a double-outlet right ventricle (DORV) in the mutant heart. The dashed line indicates internal path of the aorta. Sections at the level of the AV canal show a membranous ventricular septal defect (arrowhead, M,N) and atrial septation defect with lack of DMP (asterisk, O,P). Genotypes apply to columns. RA, right atrium; LA, left atrium; RV, right ventricle; LV, left ventricle; OFT, outflow tract; Ao, aorta; IVS, interventricular septum; SP, septum primum; DMP, dorsal mesenchymal protrusion; PA, pulmonary artery; SS, septum secundum; AVC, atrioventricular cushions.
These findings demonstrate that Irx3 and Irx5 function redundantly in cardiac formation. The location and timing of Irx3 and Irx5 activity required for OFT development are not known. Although it is unclear whether the morphological defects alone result in lethality, altered cardiac function is a possible contributing factor.
Cardiac morphogenesis requires endocardial Irx3 and Irx5 expression
Our data demonstrate that Irx3 and Irx5 are coexpressed in myocardial and endocardial cells at different embryonic stages. In addition, they might also be expressed in cardiac neural crest cells (Houweling et al., 2001). To determine the cellular origin of the DKO heart defects, we deleted Irx3 in each of these cardiac subdomains, in the background of an Irx5 deletion. We employed the cis-targeted alleles of Irx3flox Irx5EGFP/Irx3flox Irx5EGFP to delete Irx3 conditionally with different Cre-expressing mouse lines, and compared the phenotypes at the level of the OFT and AV canal, with those of Irx3+ Irx5+/Irx3+ Irx5+ (Fig. 3A,B) and Irx3KO Irx5EGFP/Irx3KO Irx5EGFP embryos (Fig. 3C,D). Cre-mediated deletion results in complete loss of Irx3 protein 36-48 hours after the onset of Cre activity (R.S. and C.-C.H., unpublished).
Fig. 3.
Determination of the cellular origin of the Irx3;Irx5 DKO defects in various Cre-expressing mouse lines. Serial H&E-stained sections at the level of the OFT (top row) and AV canal (bottom row). (A,B) Sections of a wild-type embryo (Irx3+ Irx5+/Irx3+ Irx5+). (C,D) Sections of an Irx3;Irx5 DKO embryo (Irx3KO Irx5EGFP/Irx3KO Irx5EGFP). (E-N) Sections of Irx3flox Irx5EGFP/Irx3flox Irx5EGFP embryos crossed with different Cre-expressing mouse lines, showing that the deletion of Irx3 and Irx5 in the endocardium recapitulates the phenotype of the DKO embryos. The expression domain of each Cre line is described above each set of panels. Asterisks indicate an AV canal defect. The presence (+) or absence (−) of DORV and AV canal defect are indicated. RA, right atrium; LA, left atrium; RV, right ventricle; LV, left ventricle; OFT, outflow tract; Ao, aorta; PA, pulmonary artery; SHF, second heart field.
Crossing with Wnt1::Cre (Brault et al., 2001), which deletes in the neural crest cells that populate the heart and contribute to the development of the OFT, did not result in any structural abnormalities in the heart (Fig. 3E,F). The OFT but not the AV canal defect was recapitulated using Mef2cAHF::Cre mice, which express Cre in the myocardial and endocardial cells of anterior heart field derivatives (Verzi et al., 2005), which have been linked to OFT defects, such as DORV (Fig. 3G,H) (Park et al., 2006). To further delineate the specific cell type in which Irx3 and Irx5 are required, we used the Nkx2.5::Cre transgene to delete these genes in the ventricular myocardium (McFadden et al., 2004; Takeuchi et al., 2011) and Tie2::Cre (Tie2 is also known as Tek – Mouse Genome Informatics) to delete in the endocardium (Kisanuki et al., 2001). Whereas the myocardial-specific deletion resulted in no morphological defects (Fig. 3I,J), deletion of Irx3 and Irx5 in the endocardium phenocopied the DKO mutant (Fig. 3K,L), with the exception of the DMP defect (Fig. 3L, dashed line). Indeed, the ASD observed using Tie2::Cre (Fig. 3L, asterisk) seemed to be due to a defect in the fusion between the AV endocardial cushions and the DMP. In an attempt to understand the cellular origin of the DMP defect and given that the DMP derives from Isl1-expressing second heart field derivatives (Goddeeris et al., 2008), we used Isl1::Cre mice, which effectively delete within all second heart field derivatives (Yang et al., 2006). Interestingly, this conditional mutant recapitulated the DKO phenotype, including the lack of DMP, with an additional defect in the tissues targeted in this Cre line in the form of a persistent truncus arteriosus (Fig. 3M, arrowhead), suggesting a genetic interaction between Irx3, Irx5 and Isl1 (Fig. 3M,N) or that deletion by Isl1::Cre in neural crest cells (Engleka et al., 2012) results in an additional phenotype.
Our data demonstrate that the deletion of Irx3 and Irx5 in endocardial cells leads to defects in septum formation and OFT alignment, and that there is an additional function for Irx3 and Irx5 in the development of DMP.
BMP signaling is misregulated in Irx3;Irx5 mutant hearts
To identify genes that are misregulated in the Irx3;Irx5 DKO mutant, we used DNA microarrays to analyze mRNA expression in E12.5 embryonic hearts. At this developmental stage, Irx3 and Irx5 are coexpressed in the endocardium lining the AV cushions, and there are no detectable cardiac abnormalities, such that altered gene expression is therefore likely to reflect early molecular events in altered OFT development. EGFP-positive cells were isolated from dissected hearts using fluorescence-activated cell sorting (FACS) and analyzed for four groups of mice: Irx3+ Irx5EGFP/Irx3+ Irx5+ (Irx5het), Irx3KO Irx5EGFP/Irx3KO Irx5+(Irx3KO;Irx5het), Irx3+ Irx5EGFP/Irx3+ Irx5EGFP (Irx5KO) and Irx3KO Irx5EGFP/Irx3KO Irx5EGFP (Irx3;Irx5 DKO) (Fig. 4A). Owing to the need for FACS sorting from the Irx5EGFP allele, all genotypes must be at least heterozygous for loss of Irx5.
Fig. 4.
Dysregulation of cardiac genes in Irx3 and Irx5 mutant embryos. (A) Genotypes used for microarray. EGFP-positive cells were isolated by FACS. (B) Number of genes statistically (P<0.01) upregulated (orange) and downregulated (blue) in each mutant as compared with wild type. (C) Unsupervised two-way hierarchal clustering applied to the wild type, Irx3KO, Irx5KO and Irx3;Irx5 DKO samples (horizontally) and the 458 statistically differentially expressed genes (vertically). Input consists of replicate expression values for each gene and sample. Gene expression values were centered to the median. Therefore, each color patch represents fold change between expression value and the median, with a continuum from bright blue (lowest) to bright yellow (highest). Two clusters (A and B) containing genes relevant to the discrimination between Irx3;Irx5 DKO and the other genotypes are shown on the right. (D) qPCR confirmation of a number of genes identified by microarray as either downregulated, upregulated or unchanged in the Irx3;Irx5 DKO. Values are mean ± s.d. a, P<0.05; b, P<0.01; c, P<0.001; in Irx3;Irx5 DKO versus wild type. (E) The BMP pathway and genes described as upstream or downstream components of this pathway. Red arrows illustrate how these genes are misregulated in the Irx3;Irx5 DKO embryos according to the microarray data.
We found 859 genes that were differentially expressed in at least one group versus the wild-type group, with the largest number of misregulated genes in the DKO group. Irx3 and Irx5 act mainly as transcriptional repressors (Costantini et al., 2005; Zhang, S. S. et al., 2011). Accordingly, almost two-thirds of the genes misregulated in DKO hearts are upregulated compared with the Irx5het group (Fig. 4B). Unsupervised two-way hierarchal clustering used to group samples based on their gene expression similarities (Fig. 4C) clearly separated DKOs from other samples, showing that they have a distinct transcriptional expression signature. Two discriminatory gene clusters were identified. Cluster A grouped genes downregulated in DKO samples as compared with the other samples and cluster B grouped upregulated genes. Within these two clusters, ten genes are known to be implicated in OFT and vascular defects: Eln, Efnb2, Flk1 (Kdr – Mouse Genome Informatics), Flt1, Angpt2, Slit2, Ecscr, Adamts9, Bmp10 and Vcan. Several genes that have been linked to AV canal defects, including Bmp2, Bmp5, Bmp10, Tgfbr3 and Runx1t1, were also significantly changed (Fig. 4C). Misexpression was confirmed by qPCR. Bmp10 was the most overexpressed (Fig. 4D). Interestingly, several genes linked to the BMP signaling pathway, such as Sfrp2, Tbx20 and Fosb, were also misexpressed, consistent with BMP upregulation (Fig. 4E).
Irx3 and Irx5 coordinately regulate Bmp10 expression
To define the mechanism responsible for misregulation of Bmp10 in the Irx3;Irx5 DKO heart, we performed in situ hybridization for Bmp10 at E12.5 and E14.5. At E12.5, Bmp10 was restricted to the ventricular trabecular myocardium, where Irx3 alone is expressed. Indeed, expression of Bmp10 was increased in ventricular trabecular myocardium of the Irx3KO but not the Irx5KO (Fig. 5Aa). In Irx3;Irx5 DKO hearts, we observed upregulation of Bmp10 in tissues that express either Irx3 or Irx5, including myocardium and endocardium (arrowheads) of ventricular trabeculae (Fig. 5Aa). We also observed Bmp10 upregulation in the cardiac domain that coexpresses Irx3 and Irx5, including the endocardium lining the AV cushions, consistent with the observation that the endocardial-specific DKO recapitulates the cardiac phenotype (Fig. 5Aa). At E14.5, Irx3 and Irx5 are coexpressed in the ventricular conduction system and trabeculae, and concordantly Bmp10 expression is increased in these cellular compartments in Irx3;Irx5 DKO hearts (Fig. 5Ab).
Fig. 5.
Regulation of Bmp10 by Irx3 and Irx5. (A) Bmp10 expression was examined by in situ hybridization on transverse sections of wild-type, Irx3KO, Irx5KO and Irx3;Irx5 DKO mouse hearts at E12.5 and E14.5 (Aa,b). Summaries of the expression pattern of Irx3 and Irx5 at E12.5 and E14.5 are shown to the right. Immunofluorescence of Smad1/5/8 on wild-type and Irx3;Irx5 DKO E14.5 hearts (Ac,d). Arrows indicate areas of increased Bmp10 expression. Arrowheads indicate Bmp10-expressing endocardium. (B) Change in Bmp10-luciferase reporter construct activity by transfection of Irx3 and/or Irx5 and/or Tbx5 expression constructs into Cos7 cells. Values are mean ± s.d. b, P<0.01; c, P<0.001; versus Luc alone. ***P<0.001, versus Tbx5 (ANOVA). Tbx5 BS, Tbx5 binding site. (C) SYBR Green PCR amplification (red arrows indicate primers) of an intergenic region and of the Iroquois binding site of the Bmp10 promoter, after chromatin immunoprecipitation of Irx3 (left) or Irx5 (right) on E12.5 and E14.5 wild-type hearts. a, P<0.05; c, P<0.001; versus intergenic region (t-test). (D) Serial sections stained with H&E at the level of the OFT (top row), interventricular septum (middle row) and AV canal (bottom row). Sections of a wild-type embryo and of two ca-Bmpr1a embryos crossed with either Isl1::Cre or Tie2::Cre. Arrowhead indicates ventricular septal defect. RA, right atrium; LA, left atrium; RV, right ventricle; LV, left ventricle; OFT, outflow tract; Ao, aorta; PA, pulmonary artery; IVS, interventricular septum; AV, atrioventricular; DMP, dorsal mesenchymal protrusion.
We investigated whether the pathway downstream of Bmp10 was affected in Irx3;Irx5 DKO heart. Bmp10 induces Smad1/5/8 phosphorylation (pSmad1/5/8), which leads to Smad translocation to the nucleus to mediate its signaling. By immunofluorescence, we found that the amount and intensity of nuclear pSmad1/5/8 were higher in the DKO ventricular trabeculae, suggesting that Bmp10 activates Smad1/5/8 in the Irx3;Irx5 DKO hearts (Fig. 5Ac,d).
We then investigated the function of Irx3 and Irx5 in Bmp10 transcription. We analyzed a 1.1 kb region of the Bmp10 promoter, located ~1.7 kb upstream of the ATG, that contains a putative consensus Irx binding site (Bilioni et al., 2005). Luciferase analysis showed that Irx3 and Irx5 reduced the baseline activity of this promoter. We also identified two T-box binding sites within the 1.1 kb Bmp10 promoter. Tbx5 activated the promoter and cotransfection of Irx3 and Irx5 expression constructs prevented this activation. These results show that Irx3 and Irx5 individually or cooperatively repress the expression of Bmp10 and that they prevent activation of this promoter by Tbx5 (Fig. 5B).
To explore the possibility that Irx repression of Bmp10 occurs via direct binding, we performed chromatin immunoprecipitation of Irx3 and Irx5 in E12.5 and E14.5 hearts. We tested for enrichment of Irx3 and Irx5 at the putative Irx binding site located in the 1.1 kb promoter region used for the luciferase assay. Irx3 levels at the Bmp10 promoter were double those at an intergenic region at E12.5 and E14.5 and there was 5-fold and 32-fold more Irx5 in E12.5 and E14.5 hearts, respectively (Fig. 5C). These results show that Irx3 and Irx5 directly bind the Bmp10 promoter to regulate its expression.
We then further investigated the role of the ectopic endocardial expression of Bmp10 in the Irx3;Irx5 DKO phenotype. Knowing that Bmp10 signals through the Bmpr1a receptor (Mazerbourg et al., 2005), we used a genetic manipulation that would be a proxy for increased Bmp10 expression: we induced cell-specific constitutive activation of Bmpr1a by crossing ca-Bmpr1a mice (Kamiya et al., 2008) with Isl1::Cre or Tie2::Cre mice. At E14.5, the mutant embryos did not display any gross physical abnormalities (data not shown). However, in both cases, expression of ca-Bmpr1a led to a membranous VSD similar to that observed in the Irx3;Irx5 DKO (Fig. 5Db). Conversely, the orientation of the aorta (Fig. 5Da) and the formation of DMP (Fig. 5Dc) appeared normal in these mutants. Together, these data further support the proposal that the endocardial transcriptional repression of Bmp10 by Irx3 and Irx5 is necessary for proper ventricular septation.
Irx3 and Irx5 are coexpressed in the adult heart
The effect of the combined deletion of Irx3 and Irx5 on embryonic heart development clearly indicates overlapping and redundant functions of these two transcription factor genes. As both genes have demonstrated roles in postnatal cardiac physiology, we addressed their roles independent of defective embryonic development. We first analyzed their expression pattern in the adult heart and found that Irx3 and Irx5 are coexpressed in the ventricular conduction system, BH and BBs (Fig. 6A-C), as identified by acetylcholinesterase staining (Fig. 6D). The domain of coexpression of Irx3 and Irx5 in the ventricular conduction system extends to the lower nodal cells (LNCs) that connect the AV node to the BH (Fig. 6E-H) (Aanhaanen et al., 2009). This suggests a shared role for Irx3 and Irx5 in the function of the conduction system. Within the ventricular septum, Irx3 and Irx5 were expressed in a gradient, specifically in myocardial cells, as shown by their coexpression with tropomyosin (Fig. 6I-L). This gradient of expression was found in the myocardium of the right and left ventricular walls, with highest expression in the endocardial region (Fig. 6M-T).
Fig. 6.
Expression of Irx3 and Irx5 in the adult heart. (A-C) Immunofluorescence colocalization of Irx3taulacZ (red) and Irx5EGFP (green) in the ventricular conduction system of Irx3taulacZ/+;Irx5EGFP/+ adult mouse heart. (E-G) Coexpression of Irx3 and Irx5 in the lower nodal cells (LNCs) that connect the AV node to the BH. (D,H) Acetylcholinesterase staining (brown) of serial sections marks the conducting cells and confirms the expression of Irx3 and Irx5 in the ventricular conduction system. (I-L) In the interventricular septum, Irx3 and Irx5 are expressed in a gradient and colocalize with tropomyosin (L). (M-T) Immunofluorescence at the level of the left ventricular wall (M-P) and the right ventricular wall (Q-T) showing a gradient of expression of Irx3 and Irx5, with higher expression in the endocardial region that colocalizes with tropomyosin. BH, bundle of his; RBB, right bundle branch; LBB, left bundle branch; RV, right ventricle; LV, left ventricle; IVS, interventricular septum; MV, mitral valves; TV, tricuspid valves; RVC, right ventricular chamber; LVC, left ventricular chamber.
Coexpression of Irx3 and Irx5 is necessary for cardiac function
To address the combinatorial roles of Irx3 and Irx5 in the adult heart, we bypassed the embryonic lethality and cardiac structural defects by inducing the deletion of Irx3 in the postnatal heart with concomitant loss of Irx5 function. We used the Myh6-Cre/Esr1 mouse strain, which expresses the Cre-estrogen receptor fusion protein under control of the cardiac myocyte-specific Myh6 promoter (Sohal et al., 2001), and activated the Cre with five consecutive tamoxifen injections. We confirmed that our protocol reduced the number of Irx3 transcripts (Fig. 7A). Telemetry electrocardiogram analysis of 9-week-old WT (Irx3+ Irx5+/Irx3+ Irx5+/Myh6::Cre+), Irx3KO, Irx5KO and Irx3;Irx5 DKO mice showed a prolonged QRS and an RR′ shape in the Irx3;Irx5 DKO mice, similar to the Irx3KO mice (Fig. 7B,C, black arrow), suggesting that this phenotype is due to the lack of Irx3 only. Intriguingly, the loss of the T wave normally observed in Irx5KO mice was restored to normal in the inducible DKO (Fig. 7B, red arrow), suggesting a counterbalance of Irx3 and Irx5 function in regulating the ventricular repolarization. The DKO mice were uniquely characterized by a prolonged PR interval, reflecting a conduction delay through the proximal part of the ventricular conduction system, at the level of the AV node, BH and/or BBs (Fig. 7C). No spontaneous arrhythmias were observed in any of the genotypes throughout the telemetry traces (data not shown). These results clearly show a postnatal genetic interaction between Irx3 and Irx5.
Fig. 7.
Electrophysiological analysis of Irx3 and Irx5 mutant adult mice. (A) Protocol of tamoxifen injection of Irx3flox Irx5EGFP/Irx3flox Irx5EGFP/Myh6::MerCreMer 6-week-old mice. Two weeks after injections for five consecutive days, electrocardiograms are recorded using six leads and telemetry. qPCR analysis shows successful reduction of Irx3 expression in Irx3flox Irx5EGFP/Irx3+ Irx5+/Myh6::MerCreMer and Irx3flox Irx5EGFP/Irx3flox Irx5EGFP/Myh6::MerCreMer hearts. Values are fold WT level, mean ± s.e.m. (B) Representative six-lead ECG analysis from WT (Irx3+ Irx5+/Irx3+ Irx5+/Myh6::Cre+), Irx3KO (Irx3taulacZ/taulacZ), Irx5KO (Irx3flox Irx5EGFP/Irx3flox Irx5EGFP/Myh6::Cre−) and Irx3;Irx5 DKO (Irx3flox Irx5EGFP/Irx3flox Irx5EGFP/Myh6::Cre+) showing prolongation and RR′ shape of the QRS in both Irx3KO and Irx5KO (black arrow), recovery of the T wave in Irx3;Irx5 DKO as compared with Irx5KO (red arrow), and prolongation of the PR interval in Irx3;Irx5 DKO mice as compared with the other genotypes. (C) PR interval and QRS complex measurements in the four genotypes. Values are mean ± s.e.m.; n=4-6; *P<0.05. (D-F) Immunofluorescence of (D) Cx40 and (E) Nav1.5 (red) at the level of the ventricular conduction system, as confirmed by the EGFP staining of the BH and BBs (green), and (F) Kv4.2 (red) at the level of the right ventricular wall, with EGFP staining showing the endocardium-to-epicardium gradient of Irx5 expression (green). IVS, interventricular septum; RVW, right ventricular wall; RVC, right ventricular chamber; LBB, left bundle branch.
Cardiac electrophysiological activity is a reflection of the combined function of multiple ion channels and gap junctions. Thus, failure in their normal activity leads to changes in the ECG waveforms and ultimately to various types of inherited arrhythmia syndromes. We analyzed the expression pattern of several ion channel and gap junction proteins that sculpt the ECG features affected in the DKO mice. The prolongation of the QRS in the Irx3KO mice is associated with reduced Cx40 (Gja5 – Mouse Genome Informatics) expression in the VCS (Zhang, S. S. et al., 2011). Whereas its expression was unaltered in Irx5KO hearts, Cx40 levels were markedly reduced in the BH of the Irx3KO and Irx3;Irx5 DKO mice (Fig. 7D). This result supports our hypothesis that the QRS prolongation in the DKO mice is due to the deletion of Irx3 only. Reduction in the levels of the sodium channel protein Nav1.5 have been implicated in PR prolongation (Papadatos et al., 2002; Smits et al., 2002; Royer et al., 2005; Pfeufer et al., 2010), and we found that its expression was much reduced in the BH in DKO mice compared with the other genotypes (Fig. 7E). Therefore, Irx3 and Irx5 have individual roles in some aspects of the conduction system, as well as redundant functions in regulating Nav1.5 expression.
Restoration of the repolarization wave in the ECG of the DKOs indicated a more complicated relationship between Irx3 and Irx5. This was borne out by molecular analysis of components of the repolarization gradient. As reported, loss of the T wave in the Irx5KO was associated with the loss of gradient in the potassium channel Kv4.2 (Kcnd2 – Mouse Genome Informatics) within the ventricular wall. We found that this gradient was maintained in the Irx3KO and was recovered in Irx3;Irx5 DKO mice, in which the T wave is present (Fig. 7F). This indicates that Irx5 normally prevents Irx3 from activating the expression of Kv4.2 and that, in the absence of both Irx factors, the normal pattern of Kv4.2 expression is maintained, suggesting the existence of additional activating or repressing factors that control the repolarization gradient.
DISCUSSION
We showed essential redundant roles of Irx3 and Irx5 in the developing mouse heart. Their overlapping expression and functional redundancy in the endocardium ensure completion of atrial and ventricular septation and proper positioning of the great arteries. In addition, our data show that continued expression of Irx3 and Irx5 in adult cardiomyocytes is necessary for proper cardiac electrophysiological activity. Thus, we found two temporal-specific roles for Irx3 and Irx5 in the heart: control of embryonic morphogenesis and regulation of adult heart function.
Functional redundancy of mammalian Irx transcription factors during embryogenesis
We demonstrated genetic redundancy of Irx factors, as the combined deletion of Irx3 and Irx5 leads to striking structural heart defects not observed in the Irx3 or Irx5 singly deficient mice. Recapitulation of the abnormal septation phenotype with the endothelial-specific Tie2::Cre strongly suggests functional significance for both Irx3 and Irx5 in the endothelial cell lineage. This indicates a sensitive subset of cardiac cells within which the redundancy between Irx3 and Irx5 is most apparent, and suggests that other Irx genes expressed in myocardium might compensate for their combined loss in the myocardium.
The Irx3;Irx5 DKO mice also have a DMP defect. DMP derives from Isl1-expressing progenitors but is not endothelial-derived (Mommersteeg et al., 2006), suggesting that the DMP deficiency is not directly due to the Irx3 and Irx5 deficiency in the AV cushion endocardium. As expected, the DMP is present when endocardial Irx3 expression is removed using Tie2::Cre, but it fails to fuse to the AV cushions, leading to an ASD. Conversely, the use of Isl1::Cre recapitulates the absence of the DMP.
Dysregulation of a broad transcriptional program in the DKOs further demonstrates the functional redundancy between Irx3 and Irx5. Among these genes, we identified several that are implicated in OFT and AV canal formation, including members of the BMP family, which are upregulated in the Irx3;Irx5 DKO hearts. These growth factors have crucial roles in the embryonic development of several organs, including the heart: their overexpression, deletion or mutation leads to various cardiac defects (Evans et al., 2010). A link between Iroquois genes and BMPs was reported in Xenopus, in which the ortholog of mouse Irx1 inhibits Bmp4 expression during neural differentiation (Gomez-Skarmeta et al., 2001).
Here we show that, in the mammalian heart, Irx3 and/or Irx5 directly inhibits the expression of Bmp10. In the Irx3;Irx5 DKO E12.5 hearts, Bmp10 is misexpressed in the endocardial cells that line the ventricular trabeculae and the endocardial cushions. The ectopic expression of Bmp10 in the endocardium supports our model of redundancy between Irx3 and Irx5 in repressing expression of this gene. By E14.5, however, Bmp10 returns to its myocardial-specific pattern, consistent with the restricted expression of Irx3 and Irx5 to myocardium at this stage. Bmp10 regulates cardiac morphogenesis. Bmp10-deficient mice do not survive past E10.5 due to a range of cardiovascular defects, including abnormal OFT and AV endocardial cushion development (Chen et al., 2004). Myocardial-specific Bmp10 overexpression leads to normal embryonic development but abnormal postnatal cardiomyocyte hypertrophic growth and subaortic narrowing (Chen et al., 2006). As proxy for the overexpression of Bmp10, we tested the effect of activating BMP signaling in the endocardium, and found a defect in cardiac ventricular septation, suggesting that ectopic endocardial expression of Bmp10 in the Irx3;Irx5 DKO contributes to the phenotype. This effect is specific, as we found that activation of BMP signaling within a tissue that is not known to be directly dependent on BMP signaling (in the DMP using Isl1::Cre) does not lead to defects in its formation.
The T-box transcription factor Tbx20 is a direct target of the Bmp10/Smad1 signaling pathway, and is upregulated in the myocardium of αMHC-BMP10 transgenic mice (Mandel et al., 2010; Zhang, W. et al., 2011). During embryonic development, Tbx20 is strongly expressed in the atria and the endocardium lining the AV cushions and exhibits more modest expression in the ventricular myocardium (Zhang, W. et al., 2011). A TBX20 gain-of-function mutation in human causes AV canal defects including ASD (Posch et al., 2010), and TBX20 is upregulated in patients with tetralogy of Fallot (Hammer et al., 2008). We observed an increase in nuclear staining of Smad1/5/8 in Irx3;Irx5 DKO hearts and upregulation of Tbx20 in the endocardial sorted cells of the Irx3;Irx5 DKO hearts as compared with control hearts. This suggests that, during cardiac development, Irx3 and Irx5 might participate in a BMP-dependent pathway that represses Tbx20 expression in the endocardium, ensuring proper OFT and AV canal formation.
Redundant and unique regulation of adult electrophysiological activity by Irx genes
Irx3 and Irx5 singly deficient mice are characterized by specific defects in adult electrophysiological activity of the heart, suggesting that, unlike their role in embryonic heart morphogenesis, these transcription factors are not fully redundant in the regulation of postnatal electrical activity. The deletion of Irx3 slows and disorganizes the ventricular conduction of the electrical influx through reduction of Cx40 and ectopic expression of Cx43 (Gja1 – Mouse Genome Informatics) in the proximal BBs (Zhang, S. S. et al., 2011). Irx5-deficient mice exhibit abnormal cardiac ventricular repolarization due to a defect in the establishment of the epicardium-to-endocardium gradient of the ion channel Kv4.2 and its current Ito,f (Costantini et al., 2005).
Bypassing the embryonic cardiac structural heart defects, we created a postnatal Irx3- and Irx5-deficient mouse and observed several electrophysiological defects. The prolongation of the QRS complex was found in both Irx3KO and Irx3;Irx5 DKO hearts, and, accordingly, expression of Cx40 was reduced in the BH in these two genotypes. This suggests that the prolongation of the QRS is due specifically to the lack of Irx3 and that Irx5 does not significantly contribute to regulation of Cx40 expression. One characteristic of the DKO ECG that has not been observed in the single KOs is the prolongation of the PR interval, and, together with this result, we found a DKO-specific reduction in expression in the sodium channel Nav1.5 in the BH. This PR prolongation might be due to a delay in conduction through the atria, the AV node and/or the BH. Increase in duration of the PR interval has been described previously in mice heterozygous for a deletion of the Nav1.5 (Scn5a) gene (Papadatos et al., 2002; Royer et al., 2005). Furthermore, Brugada syndrome patients carrying a loss-of-function mutation in SCN5A have a prolonged PR interval associated with a delay in BH to ventricular conduction (Smits et al., 2002). In the adult, Irx3 and Irx5 are coexpressed in the ventricular conduction system, including LNCs and BH, but are not expressed in the AV node, suggesting that the PR prolongation is due to the downregulation of Scn5a in the BH domain. The additional reduction of expression of Cx40 might also contribute to this phenotype.
Surprisingly, the lack of a T wave in the Irx5-deficient mice was not observed in Irx3;Irx5 DKO mice, suggesting a rescue of the cardiac repolarization gradient. We analyzed the expression pattern of Kv4.2, which underlies the Ito,f current essential for the formation of the T wave. Whereas its ventricular gradient of expression was lost in the Irx5KO mice, it was present in Irx3KO mice and recovered in the Irx3;Irx5 DKO mice. This suggests antagonistic effects between Irx3 and Irx5 in the regulation of this ion channel. Consistent with this notion, an in vitro study in the rat showed that Iroquois genes have antagonistic effects in the regulation of the Kv4.2 gene, as Irx4 suppresses the effect of Irx5 on its promoter (He et al., 2009). The present expression analysis suggests that, in the subendocardial myocardium, Kv4.2 expression is regulated by several factors, with different levels of control. Concordant with previous reports, in wild-type and Irx3KO mice, the dominant regulator, Irx5, inhibits Kv4.2 expression to create the gradient (Costantini et al., 2005). A possible explanation for this phenotype is that, in the Irx5KO mice, Irx3 is the transcriptional regulator that is likely to take over, upregulating this ion channel in the subendocardial myocardium, abolishing its expression gradient.
When both Irx3 and Irx5 are absent, we propose that another, as yet unidentified, factor with a similar endocardium-to-epicardium gradient of activity inhibits the expression of Kv4.2, recreating its gradient. In pathological situations, other transcription factors regulate the expression of Kv4 ion channels, such as Gata4- and Gata6-Fog2 (Zfpm2) and Calcineurin/NFATc3 (Jia and Takimoto, 2003; Rossow et al., 2004). It will be interesting to investigate whether one of these pathways inhibits Kv4.2 expression and recreates its gradient of expression in the absence of Irx5 and Irx3.
Summary
We have shown that Irx3 and Irx5 function redundantly in heart development and both redundantly and antagonistically in regulating postnatal cardiac electrophysiology. Recessive IRX5 mutations result in cardiac structural and electrophysiological defects as part of Hamamy syndrome (Bonnard et al., 2012). It is not clear whether the human IRX5 mutations lead to simple loss of IRX5 function or whether they cause a broader dominant effect, but the disparity between mutations in IRX5 and the mouse Irx5 loss of function might also be explained by differences in the function of Irx5 in mouse and human. Nonetheless, the similarities in phenotype between the Irx3;Irx5 DKO mice described here and the cardiac features of Hamamy syndrome provide a direct link to human disease and might lead to new insights into the as yet poorly understood etiology of congenital heart defects (Bruneau, 2008).
Acknowledgements
We thank Linda Ta (Gladstone Genomics Core), Alex Williams (Gladstone Bioinformatics Core) and Caroline Miller (Gladstone Histology Core) for technical support and G. Howard for editorial assistance.
Footnotes
Funding
N.G. was funded by American Heart Association fellowships. This work was funded by grants from the Canadian Institutes of Health Research (C.-C.H.), the National Institutes of Health (NIH) National Heart, Lung, and Blood Institute (NHLBI) [R01 HL93414 ARRA to B.G.B.]; and the Lawrence J. and Florence A. DeGeorge Charitable Trust/American Heart Association Established Investigator Award [to B.G.B.]. This work was also supported by an NIH National Center for Research Resources (NCRR) grant [C06 RR018928] to the J. David Gladstone Institutes and by William H. Younger, Jr [B.G.B.]. Deposited in PMC for release after 12 months.
Competing interests statement
The authors declare no competing financial interests.
References
- Aanhaanen W. T., Brons J. F., Dominguez J. N., Rana M. S., Norden J., Airik R., Wakker V., de Gier-de Vries C., Brown N. A., Kispert A., et al. (2009). The Tbx2+ primary myocardium of the atrioventricular canal forms the atrioventricular node and the base of the left ventricle. Circ. Res. 104, 1267-1274 [DOI] [PubMed] [Google Scholar]
- Benjamini Y., Hochberg Y. (1995). Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. Royal Stat. Soc. Series B 57, 289-300 [Google Scholar]
- Bilioni A., Craig G., Hill C., McNeill H. (2005). Iroquois transcription factors recognize a unique motif to mediate transcriptional repression in vivo. Proc. Natl. Acad. Sci. USA 102, 14671-14676 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bonnard C., Strobl A. C., Shboul M., Lee H., Merriman B., Nelson S. F., Ababneh O. H., Uz E., Guran T., Kayserili H., et al. (2012). Mutations in IRX5 impair craniofacial development and germ cell migration via SDF1. Nat. Genet. 44, 709-713 [DOI] [PubMed] [Google Scholar]
- Brault V., Moore R., Kutsch S., Ishibashi M., Rowitch D. H., McMahon A. P., Sommer L., Boussadia O., Kemler R. (2001). Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development 128, 1253-1264 [DOI] [PubMed] [Google Scholar]
- Bruneau B. G. (2008). The developmental genetics of congenital heart disease. Nature 451, 943-948 [DOI] [PubMed] [Google Scholar]
- Bruneau B. G., Bao Z. Z., Fatkin D., Xavier-Neto J., Georgakopoulos D., Maguire C. T., Berul C. I., Kass D. A., Kuroski-de Bold M. L., de Bold A. J., et al. (2001). Cardiomyopathy in Irx4-deficient mice is preceded by abnormal ventricular gene expression. Mol. Cell. Biol. 21, 1730-1736 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Burglin T. R. (1997). Analysis of TALE superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals. Nucleic Acids Res. 25, 4173-4180 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cavodeassi F., Modolell J., Gomez-Skarmeta J. L. (2001). The Iroquois family of genes: from body building to neural patterning. Development 128, 2847-2855 [DOI] [PubMed] [Google Scholar]
- Chen H., Shi S., Acosta L., Li W., Lu J., Bao S., Chen Z., Yang Z., Schneider M. D., Chien K. R., et al. (2004). BMP10 is essential for maintaining cardiac growth during murine cardiogenesis. Development 131, 2219-2231 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen H., Yong W., Ren S., Shen W., He Y., Cox K. A., Zhu W., Li W., Soonpaa M., Payne R. M., et al. (2006). Overexpression of bone morphogenetic protein 10 in myocardium disrupts cardiac postnatal hypertrophic growth. J. Biol. Chem. 281, 27481-27491 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Christoffels V. M., Keijser A. G., Houweling A. C., Clout D. E., Moorman A. F. (2000). Patterning the embryonic heart: identification of five mouse Iroquois homeobox genes in the developing heart. Dev. Biol. 224, 263-274 [DOI] [PubMed] [Google Scholar]
- Costantini D., Arruda E. P., Agarwal P., Kim K.-H., Zhu Y., Zhu W., Lebel M., Cheng C., Park C. Y., Pierce S. A., et al. (2005). The homeodomain transcription factor Irx5 establishes the mouse cardiac ventricular repolarization gradient. Cell 123, 347-358 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Eisen M. B., Spellman P. T., Brown P. O., Botstein D. (1998). Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA 95, 14863-14868 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Engleka K. A., Manderfield L. J., Brust R. D., Li L., Cohen A., Dymecki S. M., Epstein J. A. (2012). Islet1 derivatives in the heart are of both neural crest and second heart field origin. Circ. Res. 110, 922-926 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Evans S. M., Yelon D., Conlon F. L., Kirby M. L. (2010). Myocardial lineage development. Circ. Res. 107, 1428-1444 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goddeeris M. M., Rho S., Petiet A., Davenport C. L., Johnson G. A., Meyers E. N., Klingensmith J. (2008). Intracardiac septation requires hedgehog-dependent cellular contributions from outside the heart. Development 135, 1887-1895 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gomez-Skarmeta J., de La Calle-Mustienes E., Modolell J. (2001). The Wnt-activated Xiro1 gene encodes a repressor that is essential for neural development and downregulates Bmp4. Development 128, 551-560 [DOI] [PubMed] [Google Scholar]
- Gomez-Skarmeta J. L., del Corral R. D., de la Calle-Mustienes E., Ferre-Marco D., Modolell J. (1996). Araucan and caupolican, two members of the novel iroquois complex, encode homeoproteins that control proneural and vein-forming genes. Cell 85, 95-105 [DOI] [PubMed] [Google Scholar]
- Hammer S., Toenjes M., Lange M., Fischer J. J., Dunkel I., Mebus S., Grimm C. H., Hetzer R., Berger F., Sperling S. (2008). Characterization of TBX20 in human hearts and its regulation by TFAP2. J. Biol. Chem. 104, 1022-1033 [DOI] [PubMed] [Google Scholar]
- He W., Jia Y., Takimoto K. (2009). Interaction between transcription factors Iroquois proteins 4 and 5 controls cardiac potassium channel Kv4.2 gene transcription. Cardiovasc. Res. 81, 64-71 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Houweling A. C., Dildrop R., Peters T., Mummenhoff J., Moorman A. F., Ruther U., Christoffels V. M. (2001). Gene and cluster-specific expression of the Iroquois family members during mouse development. Mech. Dev. 107, 169-174 [DOI] [PubMed] [Google Scholar]
- Itoh M., Kudoh T., Dedekian M., Kim C. H., Chitnis A. B. (2002). A role for iro1 and iro7 in the establishment of an anteroposterior compartment of the ectoderm adjacent to the midbrain-hindbrain boundary. Development 129, 2317-2327 [DOI] [PubMed] [Google Scholar]
- Jia Y., Takimoto K. (2003). GATA and FOG2 transcription factors differentially regulate the promoter for Kv4.2 K(+) channel gene in cardiac myocytes and PC12 cells. Cardiovasc. Res. 60, 278-287 [DOI] [PubMed] [Google Scholar]
- Kamiya N., Ye L., Kobayashi T., Mochida Y., Yamauchi M., Kronenberg H. M., Feng J. Q., Mishina Y. (2008). BMP signaling negatively regulates bone mass through sclerostin by inhibiting the canonical Wnt pathway. Development 135, 3801-3811 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kisanuki Y. Y., Hammer R. E., Miyazaki J., Williams S. C., Richardson J. A., Yanagisawa M. (2001). Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev. Biol. 230, 230-242 [DOI] [PubMed] [Google Scholar]
- Lickert H., Takeuchi J. K., von Both I., Walls J. R., McAuliffe F., Adamson S. L., Henkelman R. M., Wrana J. L., Rossant J., Bruneau B. G. (2004). Baf60c is essential for function of BAF chromatin remodelling complexes in heart development. Nature 432, 107-112 [DOI] [PubMed] [Google Scholar]
- Mandel E. M., Kaltenbrun E., Callis T. E., Zeng X. X., Marques S. R., Yelon D., Wang D. Z., Conlon F. L. (2010). The BMP pathway acts to directly regulate Tbx20 in the developing heart. Development 137, 1919-1929 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mazerbourg S., Sangkuhl K., Luo C. W., Sudo S., Klein C., Hsueh A. J. (2005). Identification of receptors and signaling pathways for orphan bone morphogenetic protein/growth differentiation factor ligands based on genomic analyses. J. Biol. Chem. 280, 32122-32132 [DOI] [PubMed] [Google Scholar]
- McFadden D. G., Barbosa A. C., Richardson J. A., Schneider M. D., Srivastava D., Olson E. N. (2004). The Hand1 and Hand2 transcription factors regulate expansion of the embryonic cardiac ventricles in a gene dosage-dependent manner. Development 132, 189-201 [DOI] [PubMed] [Google Scholar]
- Mommersteeg M. T., Soufan A. T., de Lange F. J., van den Hoff M. J., Anderson R. H., Christoffels V. M., Moorman A. F. (2006). Two distinct pools of mesenchyme contribute to the development of the atrial septum. Circ. Res. 99, 351-353 [DOI] [PubMed] [Google Scholar]
- Mummenhoff J., Houweling A. C., Peters T., Christoffels V. M., Ruther U. (2001). Expression of Irx6 during mouse morphogenesis. Mech. Dev. 103, 193-195 [DOI] [PubMed] [Google Scholar]
- Olson E. N. (2006). Gene regulatory networks in the evolution and development of the heart. Science 313, 1922-1927 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Papadatos G. A., Wallerstein P. M., Head C. E., Ratcliff R., Brady P. A., Benndorf K., Saumarez R. C., Trezise A. E., Huang C. L., Vandenberg J. I., et al. (2002). Slowed conduction and ventricular tachycardia after targeted disruption of the cardiac sodium channel gene Scn5a. Proc. Natl. Acad. Sci. USA 99, 6210-6215 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Park E. J., Ogden L. A., Talbot A., Evans S., Cai C. L., Black B. L., Frank D. U., Moon A. M. (2006). Required, tissue-specific roles for Fgf8 in outflow tract formation and remodeling. Development 133, 2419-2433 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peters T., Ausmeier K., Dildrop R., Ruther U. (2002). The mouse Fused toes (Ft) mutation is the result of a 1.6-Mb deletion including the entire Iroquois B gene cluster. Mamm. Genome 13, 186-188 [DOI] [PubMed] [Google Scholar]
- Pfeufer A., van Noord C., Marciante K. D., Arking D. E., Larson M. G., Smith A. V., Tarasov K. V., Muller M., Sotoodehnia N., Sinner M. F., et al. (2010). Genome-wide association study of PR interval. Nat. Genet. 42, 153-159 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Posch M. G., Gramlich M., Sunde M., Schmitt K. R., Lee S. H., Richter S., Kersten A., Perrot A., Panek A. N., Al Khatib I. H., et al. (2010). A gain-of-function TBX20 mutation causes congenital atrial septal defects, patent foramen ovale and cardiac valve defects. J. Med. Genet. 47, 230-235 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rossow C. F., Minami E., Chase E. G., Murry C. E., Santana L. F. (2004). NFATc3-induced reductions in voltage-gated K+ currents after myocardial infarction. Circ. Res. 94, 1340-1350 [DOI] [PubMed] [Google Scholar]
- Royer A., van Veen T. A., Le Bouter S., Marionneau C., Griol-Charhbili V., Leoni A. L., Steenman M., van Rijen H. V., Demolombe S., Goddard C. A., et al. (2005). Mouse model of SCN5A-linked hereditary Lenegre's disease: age-related conduction slowing and myocardial fibrosis. Circulation 111, 1738-1746 [DOI] [PubMed] [Google Scholar]
- Sharpe J., Ahlgren U., Perry P., Hill B., Ross A., Hecksher-Sorensen J., Baldock R., Davidson D. (2002). Optical projection tomography as a tool for 3D microscopy and gene expression studies. Science 296, 541-545 [DOI] [PubMed] [Google Scholar]
- Smits J. P., Eckardt L., Probst V., Bezzina C. R., Schott J. J., Remme C. A., Haverkamp W., Breithardt G., Escande D., Schulze-Bahr E., et al. (2002). Genotype-phenotype relationship in Brugada syndrome: electrocardiographic features differentiate SCN5A-related patients from non-SCN5A-related patients. J. Am. Coll. Cardiol. 40, 350-356 [DOI] [PubMed] [Google Scholar]
- Sohal D. S., Nghiem M., Crackower M. A., Witt S. A., Kimball T. R., Tymitz K. M., Penninger J. M., Molkentin J. D. (2001). Temporally regulated and tissue-specific gene manipulations in the adult and embryonic heart using a tamoxifen-inducible cre protein. Circ. Res. 89, 20-25 [DOI] [PubMed] [Google Scholar]
- Srivastava D. (2006). Making or breaking the heart: from lineage determination to morphogenesis. Cell 126, 1037-1048 [DOI] [PubMed] [Google Scholar]
- Takeuchi J. K., Lou X., Alexander J. M., Sugizaki H., Delgado-Olguin P., Holloway A. K., Mori A. D., Wylie J. N., Munson C., Zhu Y., et al. (2011). Chromatin remodeling complex dosage modulates transcription factor function in heart development. Nat. Commun. 2, 187 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Verzi M. P., McCulley D. J., De Val S., Dodou E., Black B. L. (2005). The right ventricle, outflow tract, and ventricular septum comprise a restricted expression domain within the secondary/anterior heart field. Dev. Biol. 287, 437-449 [DOI] [PubMed] [Google Scholar]
- Yang L., Cai C. L., Lin L., Qyang Y., Chung C., Monteiro R. M., Mummery C. L., Fishman G. I., Cogen A., Evans S. (2006). Isl1Cre reveals a common Bmp pathway in heart and limb development. Development 133, 1575-1585 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang S. S., Kim K. H., Rosen A., Smyth J. W., Sakuma R., Delgado-Olguin P., Davis M., Chi N. C., Puviindran V., Gaborit N., et al. (2011). Iroquois homeobox gene 3 establishes fast conduction in the cardiac His-Purkinje network. Proc. Natl. Acad. Sci. USA 108, 13576-13581 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang W., Chen H., Wang Y., Yong W., Zhu W., Liu Y., Wagner G. R., Payne R. M., Field L. J., Xin H., et al. (2011). Tbx20 transcription factor is a downstream mediator for bone morphogenetic protein-10 in regulating cardiac ventricular wall development and function. J. Biol. Chem. 286, 36820-36829 [DOI] [PMC free article] [PubMed] [Google Scholar]