Abstract
Background
This study mapped regions of genomic RNA (gRNA) important for packaging and propagation of mouse mammary tumor virus (MMTV). MMTV is a type B betaretrovirus which preassembles intracellularly, a phenomenon distinct from retroviruses that assemble the progeny virion at cell surface just before budding such as the type C human and feline immunodeficiency viruses (HIV and FIV). Studies of FIV and Mason-Pfizer monkey virus (MPMV), a type D betaretrovirus with similar intracellular virion assembly processes as MMTV, have shown that the 5′ untranslated region (5′ UTR) and 5′ end of gag constitute important packaging determinants for gRNA.
Methodology
Three series of MMTV transfer vectors containing incremental amounts of gag or 5′ UTR sequences, or incremental amounts of 5′ UTR in the presence of 400 nucleotides (nt) of gag were constructed to delineate the extent of 5′ sequences that may be involved in MMTV gRNA packaging. Real time PCR measured the packaging efficiency of these vector RNAs into MMTV particles generated by co-transfection of MMTV Gag/Pol, vesicular stomatitis virus envelope glycoprotein (VSV-G Env), and individual transfer vectors into human 293T cells. Transfer vector RNA propagation was monitored by measuring transduction of target HeLaT4 cells following infection with viral particles containing a hygromycin resistance gene expression cassette on the packaged RNA.
Principal Findings
MMTV requires the entire 5′ UTR and a minimum of ∼120 nucleotide (nt) at the 5′ end of gag for not only efficient gRNA packaging but also propagation of MMTV-based transfer vector RNAs. Vector RNAs without the entire 5′ UTR were defective for both efficient packaging and propagation into target cells.
Conclusions/Significance
These results reveal that the 5′ end of MMTV genome is critical for both gRNA packaging and propagation, unlike the recently delineated FIV and MPMV packaging determinants that have been shown to be of bipartite nature.
Introduction
The flanking long terminal repeats (LTRs) of retroviruses serve as important control regions that are responsible for regulating many aspects of retroviral replication, from gene expression (promoters, enhancers, negative regulatory elements, hormone-inducible elements, and polyadenylation sites) to reverse transcription (strand switching using “Repeat (R)” regions), and integration (attachment- att sites) [1]. In addition, for at least some retroviruses, it has been shown that the R-U5/U3-R regions at the 5′ and 3′ ends of the genomic RNA (gRNA) and their adjoining regions play important roles in RNA packaging (packaging signal- psi, ψ), dimerization (dimerization initiation site-DIS), and gRNA stability and transport (such as the constitutive transport element- CTE) [1]–[8]. Successful and specific gRNA packaging/encapsidation determines the fidelity of viral genome incorporation into the progeny virions. Studies over the past two decades have revealed the importance of the 5′ untranslated region (UTR) and beginning of the gag gene as crucial regions for augmenting retroviral gRNA encapsidation into the assembling particle (reviewed in [4]–[8]). For some retroviruses such as the human and simian immunodeficiency viruses (HIV and SIV), the packaging signal comprises of contiguous sequences within this region [9]–[20], while for others, the packaging signal seems to have a bi-partite nature, as has been observed for feline immunodeficiency virus (FIV) and Mason-Pfizer monkey virus (MPMV) [20]–[24].
Recently, there has been an increasing interest in studying mouse mammary virus (MMTV) replication with the hope of developing MMTV-based vectors for human gene therapy [25]. This is because of the presence of hormone inducible promoters, making it an excellent candidate for tissue-specific and hormone-inducible gene therapy (reviewed in [25], [26]). Being a non-primate retrovirus, MMTV-based vectors are likely to obviate potential safety concerns (that might result from the use of primate retroviral vectors) such as cross- and co-packaging of the transfer vector RNA by related primate retroviruses as has been observed between many retroviruses ([27]–[30] and references therein). However, the recent observation of the cross-packaging abilities of MMTV with a non-human primate retrovirus, MPMV [26], highlights the need to further enhance our understanding of the primary and secondary gRNA packaging determinants among retroviruses to establish their key contributing nature during gRNA packaging and/or cross-packaging processes.
Very little is known about the packaging determinants of MMTV that allow the virus to specifically incorporate its gRNA into the virus particle from a milieu of cellular and spliced RNAs. However, early MMTV studies showed that MMTV genome containing deletion in the envelope gene was competent for gRNA packaging [31], while MMTV vectors in which the 5′ MMTV LTR was swapped by that from Rous sarcoma virus (RSV) LTR [32] were defective for packaging, suggesting the importance of the 5′ region of the MMTV genomic RNA during the packaging process. Recently, we have shown that MMTV gRNA sequences from the first nucleotide (nt) in R up to 400 nts into gag are sufficient to allow efficient MTMV gRNA packaging and propagation, revealing the general significance of this region (R-U5-UTR-GAG) to the MMTV gRNA packaging process [33].
In order to further map the minimum viral sequences important for MMTV gRNA packaging and transfer vector RNA propagation, a systematic deletion approach was employed to delineate the extent of 5′ UTR and gag sequences important in these processes. Using several series of MMTV sub-genomic vectors in a biologically relevant in vivo packaging and transduction assay, our results reveal that unlike retroviruses such as FIV [20], [21], [23] and MPMV [22], [24], but similar to HIV and SIV [9]–[19], the entire 5′ MMTV UTR is critical for both gRNA packaging and propagation. However, the 5′ UTR by itself is not sufficient and requires additional sequences, at least 120 nt of gag, for efficient gRNA packaging and propagation of the packaged transfer vector RNA into the infected cells.
Results
Experimental Approach and in vivo Packaging and Propagation Assay
To study MMTV RNA packaging, the newly developed in vivo RNA packaging and propagation assay for MMTV was employed that utilizes an MMTV gag/pol expression construct (JA10) for the production of viral structural and enzymatic proteins [33], a heterologous vesicular stomatitis virus glycoprotein (VSV-G) expression vector, MD.G, for the infection of target cells with pseudotyped MMTV particles [34], and MMTV sub-genomic transfer vectors serving as substrates for RNA packaging [33]. A commercially available luciferase expression plasmid, pGL3, was added to all the transfections to monitor and normalize for transfection efficiency as described previously [23]. Seventy-two hours post transfection, culture supernatants containing infectious pseudotyped virions carrying the transfer vector RNAs were harvested and a portion was used to infect human HeLaT4 cells to determine their propagation efficiency or pelleted via ultracentrifugation on a sucrose cushion for isolating packaged transfer vector RNA. If the assembling VSV-G-pseudotyped MMTV particles were able to package the transfer vector RNAs with the different deletions, successful transduction events could be scored by the appearance of hygromycin resistant colonies 10–12 days post infection upon hygromycin selection. To calculate the relative packaging efficiency for each transfer vector RNA, the amount of gRNA present in the pelleted virions was quantified by reverse transcriptase (RT) and real time PCR using β -actin as an endogenous control. Finally, the values were normalized with the luciferase expression to control for transfection efficiency.
MMTV gRNA Packaging and Propagation Studies Using Subgenomic Transfer Vectors Containing Wild Type LTRs
Briefly, MMTV-based retroviral vectors were created that contain the wild type 5′ MMTV LTR, a hygromycin resistance gene driven from the simian virus 40 (SV40) promoter as a marker for successful propagation, a truncated MMTV env gene, and the 3′ MMTV LTR (Figure 1A). Different permutations of the 5′ UTR and gag sequences were introduced into the MMTV sub-genomic vector (Figure 1B) and tested using the in vivo packaging and propagation assay. The first series of vectors tested the entire 160 nt of the 5′ UTR in the presence of incremental amounts of gag up to the first 400 nt of gag (Figure 1B). The second series of vectors tested incremental amounts of 5′ UTR in the absence of any gag sequences, while the third series tested the same incremental 5′ UTR sequences in the presence of 400 nt of the gag (Figure 1B).
Initial test of the wild type LTR-based MMTV vectors revealed very low transfer vector RNA propagation efficiency as measured by the transduction of the target cells with hygromycin resistance gene (Figure 1C). This translated to viral titers of ∼1×101–2.5×102 colony forming units/ml (CFU/ml) even with the vector DA07 containing the entire 5′ UTR and 400 nt of gag (Figure 1B). In fact, none of the transfer vector RNAs containing incremental amounts of the 5′ UTR showed any ability to be propagated (<1 CFU/ml) except NS06 with ∼40 ± 20 CFU/ml (Figure 1C).
Next, the packaging ability of the DA vector series (containing the entire 5′ UTR along with incremental amounts of gag) that could be propagated, although inefficiently, was tested. Reverse transcriptase (RT) PCR of the DA series of vector RNAs packaged by the virus particles revealed that the vector RNAs could be packaged, but quite inefficiently with some of the samples requiring Southern blotting for visualization of the packaged RNA (Figure 1D). Southern blotting of the resultant PCR products revealed that at least 120 nt of gag were required to observe efficient RNA packaging (Figure 1D), which corroborated with the RNA propagation data for these vectors (Figure 1C). The inefficient RNA packaging and propagation abilities could be attributed to the low expression of the transfer vector RNAs perhaps due to the use of wild type 5′ MMTV LTR promoter that was used for their transcription in human cells. The MMTV LTR is a well-known hormone inducible promoter that has low basal promoter activity and requires induction with glucocorticoid hormones such as dexamethasone [35], [36]. However, the gRNA packaging and propagation results obtained were following induction of the transfected cultures with 10−6 M dexamethasone (Figure 1C and 1D), suggesting an inherent MMTV promoter caveat while using human cells.
Besides possible promoter restrictions, the poor gRNA packaging and propagation results obtained could have been due to the inefficient export of the transfer vector RNAs out of the nucleus in the absence of an intact Rem/Rem Responsive Element (RmRE) regulatory export pathway. This pathway has recently been described in MMTV [37], [38], and was perturbed during cloning of these subgenomic vectors. Specifically, an intact RmRE is maintained; however, the Rem protein that binds to RmRE (facilitating the efficient export of unspliced MMTV gRNA) is not expressed in these transfer vectors due to a truncation in the Rem open reading frame during the cloning process (Figure 1A). Therefore, it is possible that the poor gRNA packaging and propagation results obtained could also have been in part due to the inefficient export of the transfer vector RNAs out of the nucleus in the absence of an intact Rem/RmRE regulatory export pathway.
Improvement of Transfer Vector Design
To circumvent any potential problems with poor MMTV promoter efficiency in human cells and RNA export defects, the 5′ MMTV LTR was modified by replacing the U3 region (containing the promoter) with the constitutively active human cytomegalovirus (hCMV) promoter that has been classically used as a high efficiency promoter in mammalian cells (Figure 2A). A similarly constructed chimeric CMV/RU5 promoter has been successfully used to express MMTV [33], [39] and FIV-based vectors [20], [21], [23], [40]–[42]. Furthermore, to ensure efficient nucleocytoplasmic transport of transfer vector RNA, the constitutive transport element (CTE) from MPMV [43] was cloned at the 3′ end of the transfer vectors between the truncated envelope sequences and the 3′ LTR (Figure 2A). The MPMV CTE has been successfully shown to work effectively in such heterologous systems for HIV [43], SIV [44] FIV [41], and MMTV [33].
Role of MMTV 5′ UTR and gag Sequences in MMTV gRNA Packaging and Propagation
The modified transfer vectors (Figure 2B) were co-transfected individually along with the packaging construct, JA10 and the env expression vector MD.G for virus production into 293T cells. Following transfection, virus particles were isolated from each transfected cultures to quantify the effect of the introduced mutations on both gRNA packaging and propagation. However, before quantifying the viral RNA contents in the viral particles, it was imperative to determine whether each vector RNA was expressed stably and transported to the cytoplasm successfully.
Stable cytoplasmic expression of all transfer vector RNAs
In order to ascertain stable expression and efficient nuclear export of transfer vector RNAs, nuclear and cytoplasmic RNA fractions were prepared from the transfected cells and DNase-treated to ensure removal of any contaminating plasmid DNA (Figure 2C, panel III). This was followed by their conversion into cDNA by reverse transcriptase to allow amplification of the original transfer vector RNAs. Next the integrity of the RNA fractionation technique was tested to ensure that there was no leakage of the nuclear fraction into the cytoplasmic fraction by taking advantage of differential distribution of the unspliced and spliced β-actin mRNA message in the nuclear and cytoplasmic fractions, respectively [45] as described previously [23]. Attempts to amplify unspliced β-actin mRNA in a multiplex RT-PCR did not show its detectable amplification in the cytoplasmic fractionation (Figure 2C; panel I), in contrast to the presence of spliced β actin and 18S rRNA mRNA in the cytoplasm, as expected (Figure 2C; panels I and II), further authenticating the amplifiability of our cDNA preparations.
Development of a relative quantification assay using real time PCR
The relative expression of the various transfer vector RNAs in the cytoplasm was tested using a custom-made MMTV Taqman real time PCR assay in combination with a commercially-available-endogenous β-actin Taqman assay (Applied Biosystems). The custom MMTV Taqman assay was designed within the U5 region of the transfer vector RNAs, enabling detection of all mutant transfer vector RNAs via a single primer/probe combination. To allow a relative comparison of the transfer vector RNA expression using β-actin as an endogenous control, we determined whether the amplification efficiencies of the two assays were equivalent. This was accomplished by first determining the value of the threshold cycle, Ct (Figure 3A and 3B), followed by ΔCt values (Ct values of the MMTV assay – Ct value of the ß-actin endogenous control) (Figure 3C and 3D). Finally, we analyzed how the ΔCt values varied with the amounts of input template cDNA as a sensitive indicator of relative amplification efficiencies of the two assays. The value of the slope of log input amount verses ΔCT should be approximately zero (<0.1) for the two assays to have similar amplification efficiencies (User Bulletin #2, ABI PRISM 7700 Sequence Detection System). As can be observed from Figure 3E, the slope under our experimental conditions was calculated to be 0.0126, validating the assay for the relative quantification analysis.
Test of the cDNAs prepared from the cytoplasmic RNA fractions revealed that the transfer vector RNAs were stably expressed between Ct values of 23.5–27.5 and efficiently exported to the cytoplasm (Figure 4A). Alongside vector RNA expression in the cytoplasm, the expression of the endogenous β-actin mRNA was also monitored as a control for the amount of the input sample tested in the assay (Figure 4B). As observed, all samples expressed β-actin mRNA at very similar levels, within one Ct value of each other (Figure 4B). Normalization of the transfer vector RNA expression with the level of endogenous β-actin and exogenous luciferase expression revealed that all transfer vector RNAs were expressed in the cytoplasm within approximately 2–3 folds of each other (Figure 4C). These ancillary controls were incorporated into our experimental setup to confirm the integrity of the RNA packaging and propagation assay and to further validate that the results obtained were bonafide.
The Entire MMTV 5′ UTR and ∼ 120 nt of gag are Needed for Optimal MMTV gRNA Packaging
Next, the packaging efficiency of the transfer vector RNAs into the pseudotyped MMTV particles was assessed by the same custom-made real time PCR assay as described above. Towards this end, the first question asked was whether a cellular housekeeping β-actin mRNA could be used as an endogenous control in our assays since it is not a recognized virion-associated mRNA. It has now been well-established that cellular RNAs can be packaged into retroviral particles as has been shown for several RNAs such as 7SL RNA, U6 snRNA, tRNA, or mRNAs for cyclophilin A and for several types of ribosomal proteins, and even ribosomal RNA itself [18], [46]–[51]. Therefore, we tested whether β-actin mRNA could be packaged into the MMTV particles and at similar levels irrespective of the transfer vector packaging efficiency (Figure 5A). As observed, β-actin mRNA could indeed be detected quite consistently inside the virus particles within 2 Ct values of each other, starting from 33.5 Ct-35.5 Ct, irrespective of whether transfer vector RNAs were packaged efficiently or poorly within the virus particles (Figure 5B). This observation is consistent with the finding of Rulli and colleagues who observed that a majority of the cellular RNAs packaged in the MLV and HIV-1 virus particles were packaged non-selectively and merely represented the proportions in which they were found in the cytoplasm of the virus-producing cells [51]. Thus, this enabled the use of β-actin mRNA as an endogenous control while calculating relative packaging efficiency of the transfer vector RNAs in our custom-made real time PCR assay.
As opposed to β-actin mRNA, all transfer vector RNAs were encapsidated with widely different packaging efficiencies, encompassing raw Ct values between 23–36, depending upon the amount and type of sequence present at the 5′ end of the sub-genomic RNAs (see boxed region in Figure 5B). The DA series of vectors (DA19–DA24) were packaged between Ct values of 23 to 28, the FA series of vectors (FA21–FA26) were packaged between Ct values of 30–34, while the NS series of vectors (NS07–NS12) were packaged between Ct values of 32–34 with the exception of NS12 that was packaged at a Ct value of 24 (Figure 5B). The mock-transfected samples obtained following transfection with the Gag/Pol and VSV-G Env expression plasmids along with pGL3 luciferase expression vector but no MMTV transfer vector, showed a Ct value of 37, while the no template control showed a Ct value of 39, revealing the actual background of the assay. These values were then normalized to the amount of endogenous β-actin mRNA observed in each sample.
Further normalization of the transfer vector RNAs packaged into the virus particles was performed to take into account differences in transfection efficiency observed using the luciferase expression vector in each transfected cultures (Figure 5C). The sample from the mock transfection was used to set the threshold value of detection of RNA packaging stringently at ∼1.0 normalized log10 Relative Quantification (RQ) units (∼ three-folds above the mock level).
Normalization of the data revealed that the DA series of transfer vectors with the entire 5′ UTR and incremental amounts of gag were the most efficiently packaged (at least 3–6 folds higher on a log10 scale) compared to vector series with incremental amounts of 5′ UTR either without gag (FA series) or with gag (NS series) except for NS12 (Figure 5C). In fact, compared to the threshold of detection (shown by the horizontal arrow in Figure 5C), packaging of most of the FA and NS series of vectors was barely detectable except for NS12 (the vector with complete 5′ UTR and 400 nt of gag) that was efficiently packaged and comparable to the DA series of vectors. Overall, these results revealed that the intact 5′ UTR is critical for efficient RNA packaging but is not sufficient by itself for this crucial step of MMTV life cycle.
Within the DA series (DA19–DA24), as the incremental amount of gag sequences increased, so did the packaging efficiency with DA24 containing 400 nt gag being the vector packaged most efficiently (Figure 5C). However, there was no difference in the packaging efficiency of DA22 and DA23, vectors containing 120 or 150 nt of gag respectively and these vector RNAs were packaged within < one log of DA24 (p<0.01). These results corroborated well the observations made earlier using MMTV vectors harboring similar sequences and containing wild type MMTV LTR as the promoter (Figure 1) that 120 nt of gag are sufficient along with the entire 5′UTR to allow efficient packaging of MMTV-based vector RNAs, though inclusion of gag sequences upto 400 nt increased that by a third (compare Figures 1D and 5C).
Interestingly, NS12, the vector with the entire 5′ UTR and 400 nt of gag (comparable to DA24), showed lower packaging efficiency (by about 0.7 logs compared to DA24; p<0.01) and was similar to DA22 and DA23, vectors with 120 and 150 nt of gag sequences, respectively (Figures 2B and 5C). The NS vector series was cloned in a different manner and contains an SpeI site that was introduced between the 5′ UTR and beginning of gag sequences for the cloning process that is absent in the DA series. It is possible that presence of the SpeI site may have perturbed the higher order structure, if any, of this important region in some subtle manner, resulting in lower packaging efficiencies. The same may hold true for DA07 and NS06, although we did not directly test the packaging efficiency of NS06 vector RNA (Figure 1). Taken together, these results suggest that the entire 5′ UTR and approximately 120 nt of gag seem to be minimally required for efficient packaging of MMTV transfer vector RNAs.
The 5′ MMTV UTR is Critical but not Sufficient for Efficient MMTV RNA Packaging
Analysis of the FA series of vectors (FA21–FA26 containing incremental amounts of 5′ UTR sequences in the absence of any gag sequences, Figure 2B) revealed that the entire 5′ UTR is not sufficient for efficient RNA packaging since the RNA of FA26 containing the entire 5′ UTR but no gag sequences could be barely packaged within the viral particles (Figure 5C). However, the 5′ UTR was observed to be important for RNA encapsidation since even a 32 nt deletion at the 3′ end of the 5′ UTR in the presence of 400 nt of gag (NS11) resulted in greater than 100-fold (∼2 log) drop in RNA packaging efficiency compared to the vector RNA with the entire 5′ UTR, NS12 (Figure 5C). Similarly, the vector with the entire 5′ UTR in the absence of gag (FA26) was packaged at a greater than 10-fold (1 log) lower efficiency than NS12 and greater than 60-fold (∼1.8 log) lower efficiency than DA24, vectors containing the entire 5′ UTR in the presence of 400 nt of gag (p<0.01), confirming that gag sequences are indeed required during MMTV gRNA packaging (Figure 5C). As observed with MMTV vectors with the wild type LTRs, ∼120 nt of gag were required for improving the RNA packaging efficiency in the presence of the entire 5′ UTR by 10-fold, as opposed to 30–90 nt of gag which did not enhance packaging efficiency significantly (compare FA26 with DA19–DA22 in Figure 5C and DA11 with DA08–DA10 in Figure 1D).
The 5′ MMTV UTR is Critical but not Sufficient for MMTV Transfer Vector RNA Propagation and Requires at least 120 nt of gag as well
Test of the new series of transfer vectors in the propagation assay further revealed that the LTR promoter and CTE modifications resulted in several folds increase in the pseudotyped virion titers as demonstrated by an increased appearance of hygromycin resistant colonies in the infected cultures (compare Table 1 with Figure 1C). However, despite the overall increase in vector RNA propagation (DA series of vectors), most of the vectors with incremental amounts of the 5′ UTR sequences with or without gag (the FA and NS series, Figure 1B) could not be successfully propagated except for NS12 (Table 1). This is a very unusual finding compared to what has been observed in similar vector systems of MPMV and FIV employing a similar deletion approach [20]–[23]. The DA-series of vectors that could be propagated successfully revealed that whereas 120 nt of gag were sufficient for vector RNA propagation, 400 nt increased that efficiency by two-folds (Table 1). These observations revealed that, 1) the 5′ end of MMTV RNA (R-U5-UTR-gag) contains elements critical for proper completion of steps in vector RNA propagation, such as RNA dimerization, encapsidation, reverse transcription, and integration since our readout assay for RNA propagation was dependent on the successful completion of these crucial steps in virus life cycle, and 2) the entire 5′ UTR itself is not sufficient and requires ∼120–400 nt of gag for efficient vector RNA propagation. Overall, these results mimicked the RNA packaging and propagation results obtained with the wild type MMTV LTR vectors and further validated that the intact 5′ UTR is as critical for efficient RNA propagation as it is for successful RNA packaging (Figures 1, 5 and Table 1), but is not sufficient by itself for either of the two processes.
Table 1. Propagation efficiency of MMTV transfer vector RNAs containing chimeric 5′ LTRs.
Vector Name | Description of Transfer Vectors Used in Each Transfection | Other Plasmids Added in Each Transfection* | Normalized** CFU/ml ± SD |
Mock | No transfer vector | JA10 + MD.G + pGL3 | <1 |
DA19 | Entire UTR*** + 30 bp of gag | JA10 + MD.G + pGL3 | 25±6 |
DA20 | Entire UTR +60 bp of gag | JA10 + MD.G + pGL3 | 28±6 |
DA21 | Entire UTR +90 bp of gag | JA10 + MD.G + pGL3 | 133±14 |
DA22 | Entire UTR +120 bp of gag | JA10 + MD.G + pGL3 | 635±48 |
DA23 | Entire UTR +150 bp of gag | JA10 + MD.G + pGL3 | 667±83 |
DA24 | Entire UTR +400 bp of gag | JA10 + MD.G + pGL3 | 1575±207 |
FA21 | PBS only | JA10 + MD.G + pGL3 | <1 |
FA22 | 32 bp of UTR without gag | JA10 + MD.G + pGL3 | <1 |
FA23 | 64 bp of UTR without gag | JA10 + MD.G + pGL3 | <1 |
FA24 | 96 bp of UTR without gag | JA10 + MD.G + pGL3 | <1 |
FA25 | 128 bp of UTR without gag | JA10 + MD.G + pGL3 | <1 |
FA26 | Entire UTR without gag | JA10 + MD.G + pGL3 | <1 |
NS07 | PBS only +400 bp gag | JA10 + MD.G + pGL3 | <1 |
NS08 | 32 bp of UTR +400 bp of gag | JA10 + MD.G + pGL3 | <1 |
NS09 | 64 bp of UTR +400 bp of gag | JA10 + MD.G + pGL3 | <1 |
NS10 | 96 bp of UTR +400 bp of gag | JA10 + MD.G + pGL3 | <1 |
NS11 | 128 bp of UTR +400 bp of gag | JA10 + MD.G + pGL3 | <1 |
NS12**** | Entire UTR +400 bp of gag | JA10 + MD.G + pGL3 | 403±82 |
JA10, MMTV gag/pol packaging expression vector; MD.G, vesicular stomatitis virus (VSV-G) envelope expression vector; pGL3, luciferase expression vector.
Propagation of the transfer vector RNA expressed as hygromycin resistance colony forming units (CFU)/ml of viral supernatant that was used to infect target cells. The data represents the mean of at least three independent transfection and infection experiments testing all mutants and was derived after normalization to the transfection efficiencies observed by luciferase expression from a co-transfected luciferase expression vector. SD, standard deviation.
Entire UTR refers to 160 bp excluding 17 bp of primer binding site (PBS).
The differences observed in the RNA propagation abilities of DA24 and NS12, both containing same amounts of 5′ UTR and gag sequences could be attributed to an artificially introduced SpeI site in NS12 at the junction of 5′ UTR and gag during cloning. This SpeI site may have destabilized some sequence/structural motifs important for MMTV transfer vector RNA packaging and propagation (compare DA24 and NS12 in Figure 5C).
Discussion
It is a well-established fact now that the major determinants of retroviral gRNA packaging lie at the 5′ end of the retroviral genome downstream of R and extending into the gag gene (reviewed in [4]–[8]); however, specific residues within this region and their spatial organization may vary among different retroviruses. We have used a similar deletion analysis of the 5′ UTR and gag in MPMV [22], [24] and FIV [20]–[23] to determine the precise boundaries of their packaging determinants. Our results have revealed that both MPMV, a simple retrovirus, and FIV, a complex lentivirus, have bipartite packaging determinants composed of regions at the flanks of the 5′ UTR and gag sequences tested (Figure 6). These packaging determinants have been shown to assume higher order structures important for RNA packaging and dimerization [24], [42], [52], [53]. This is contrary to what we report here for MMTV where the entire MMTV 5′ UTR was found to be critical for both RNA packaging and propagation. However, our observations with MMTV are similar to what has been observed for HIV-1 and SIV [9]–[19], where most of the 5′ UTR has been shown to be important for packaging of the respective viruses (Figure 6).
The importance of the entire 5′ UTR in retroviral RNA packaging is not surprising and may reflect the presence of cis acting sequences/structural motifs important in other steps in viral life cycle as well such as genomic RNA dimerization, reverse transcription, transcriptional activation, nucleocytoplasmic transport of unspliced RNA, and efficiency of RNA translation [1]–[8], [54], [55]. The presence of so many cis/structural features with critical functions in a small region may make it difficult to identify a unique or minimal packaging determinant. For example, it has been shown that RNA dimerization and packaging are interlinked phenomenon with one dependent upon the other depending upon the different retrovirus [4]–[8], [56]–[59]. Thus, perturbation of one may affect the other phenomena by default. For instance, the FIV DIS is present within its gag gene, a retrovirus in which a bipartite packaging signal has been observed [42], [52], [53], and for this reason parts of the 5′ UTR have been shown to be dispensable for FIV RNA packaging [23]. On the other hand, the HIV-1 DIS is present within the 5′ UTR [60], suggesting the necessity of the presence of the entire UTR for optimal packaging as has recently been shown by Summers and colleagues [19].
Prior to dimerization and packaging, gRNA must be efficiently exported to the cytoplasm and therefore it has been suggested that retroviral gRNA nuclear export, dimerization and packaging mechanisms are also interlinked [6], [61]–[63]. Consistent with this, packaging signal of some retroviruses have been shown to play an important role in the nuclear export of viral gRNA [64], [65]. For example, an internal loop in the packaging signal of HIV-1 closely resembles HIV Rev Responsive Element (RRE) and binds to Rev protein [61], [66]. Mutations in this loop have been shown to reduce nuclear export of viral gRNA and packaging [62]. Similar to HIV-1 Rev/RRE, MMTV also contains a nuclear export pathway (Rem/Rem-Responsive Element (RmRE), facilitating the transport of gRNA, but not partially spliced env RNA [67]–[69]. Furthermore, MMTV RmRE can also assume a higher order structure with multiple loops where its cognate counterpart, Rem, can bind and multimerize to mediate RNA export [37], [38], [68], [69]. Based on their mutual similarity, it has been hypothesized that MMTV may also contain two RmREs; one at the 5′ end (encompassing packaging sequences of MMTV gRNA) present only in unspliced RNA and the second one at the 3′ end present in all MMTV RNAs, facilitating nuclear export of the gRNA and translation of all mRNAs, respectively [69]. The recent study by Hohenadl et al., looking at the effects of 5′ UTR deletions on MMTV env mRNA expression, supports the existence of such an element at the 3′ half of the MMTV 5′ UTR [39]. Deletion of this region in our assay severely impacted RNA packaging (Figures 5C); however, we cannot assess its effect on mRNA transport since all our vector RNAs contained CTE which could have compensated for such transport defects, leading to the efficient export of these vector RNAs to the cytoplasm (Figure 4C). Experiments are currently underway to delineate the overlapping nature of MMTV packaging sequences with those of the recently hypothesized additional nucleocytoplasmic export regulatory element, RmRE.
The present study reveals that the MMTV region starting from R at the 5′ end up to ∼120 bp in the gag gene is important for genomic RNA packaging. One of the earliest studies on MMTV RNA packaging tested the role of the 5′ LTR by substituting the 5′ MMTV LTR with that of the Rous sarcoma virus (RSV) LTR [32]. Genomic RNAs encoded by this recombinant virus were defective for RNA packaging despite the fact that they contained the entire 5′ UTR and the remaining viral genome. It is plausible that the impaired packaging observed could have been due to: 1) the role of R/U5 sequences, if any, in packaging in addition to 5′ UTR and gag sequences, 2) the insensitivity of the assays used to study RNA packaging. In their assay, RNA from a 100 ml of a wild type virus stock containing 2×107 virions/ml (2×109 virus particles total) was required to observe packaging efficiently on a dot blot assay. In contrast, in our real time-based PCR assay, we could efficiently observe packaged retroviral subgenomic RNAs from vectors that gave rise to even 25 CFU/ml (Figure 5C and Table 1). Since we did not investigate the R/U5 sequences in our mutational analysis, we cannot rule out the role of MMTV R and U5 sequences independently on MMTV RNA packaging (all our constructs contained this region unaltered). It has been well-established that R/U5 can harbor retroviral RNA packaging determinants ([70] and references therein). However, given the observation that our vectors that contained even a 32 nt deletion at the 3′ end of the 5′ UTR (FA25 and NS11, Figures 2B and 5C) were essentially defective for RNA packaging despite containing R/U5 suggests that the role of R/U5 on RNA packaging is not significant at the primary sequence level, though its independent effect as part of a larger secondary structural element, if any, cannot be ruled out.
Interestingly, our similar and systematic deletion analysis of the 5′ UTR and gag regions of three different retroviruses, FIV [20], [21], [23], [42], [52], [53], MPMV [22], [24], and MMTV (the present study), has revealed that not only gag sequences are required for packaging, but that the amount of gag sequences needed are quite similar (100–120 nt) (Figure 6). Considering that 100–120 nt are enough to only code for peptides, it is plausible that the presence of gag residues either folds into cis-acting structural motif(s) or provide stability to the RNA higher order structure that the 5′ region may assume. Consistent with this, it has recently been shown that at least for FIV and MPMV, the gag sequences are involved in long range interaction (LRI) with sequences at the 5′ end of the gRNA [24], [52], [53]. In the case for FIV, any perturbations in the LRI involving the gag sequences results in destabilization of the overall RNA secondary structure and consequently, RNA packaging and propagation [42]. The role of gag sequences is not so clear in the case of SIV since most of the studies conducted on SIV RNA packaging have maintained gag sequences [13]–[17]. However, the same may be true for HIV where even a shorter gag region (9 nts) may be required for efficient RNA packaging without affecting RNA dimerization or nucleocapsid binding [19]. These 9 nucleotides have been shown to be involved in maintaining the U5:AUG base pairing important for maintaining the overall RNA secondary structure of the 5′ end of the gRNA [19]. This region may function as a riboswitch, allowing the genomic RNA to switch between a form that promotes translation to a form that promotes RNA dimerization, packaging, and nucleocapsid binding [71]. The structural significance of this region may also explain why the Spe I restriction site insertion between the end of 5′ UTR and gag AUG had resulted in lower packaging efficiency of the NS12 vector compared to the DA24 (Figure 5C).
Over the years, it is becoming increasingly clear that retroviral RNA packaging and dimerization, regardless of the primary sequence, are dependent on RNA structural motifs of the packaging determinants and their interaction(s) at the structural level (RNA-RNA interactions during dimerization and RNA-protein interactions during packaging) (reviewed in [4]–[8]). This could provide an explanation for the RNA cross- and co-packaging observed among molecularly and phylogenetically divergent retroviruses ([27]–[30] and references therein). Consistent with this, we have recently shown that MMTV and MPMV RNAs could be reciprocally cross-packaged by the heterologous viral particles, suggesting that pseudotyping between two divergent retroviruses can take place at the RNA level [26] and conceivably RNA structural motifs of these viruses facilitate this process. Therefore, it will be important to investigate whether the sequences responsible for augmenting MMTV gRNA packaging assumes any RNA secondary structure that is similar or distinct from other retroviruses, and if so, which particular structural motifs are essential during the MMTV RNA packaging process. Delineation of MMTV gRNA packaging determinants presented in this study should enhance our understanding of MMTV replication, which is imperative if MMTV vectors are to be used successfully for inducible and targeted human gene therapy.
Materials and Methods
Plasmid Construction
MMTV packaging construct, JA10, and the transfer vector, DA24, have been derived from HYBMTV, the molecular clone of MMTV [72] and their design and cloning strategies have been described earlier [33]. Briefly, JA10 expresses the MMTV gag/pol genes in the presence of the MPMV CTE using the hCMV promoter and the bovine growth hormone (BGH) poly A sequences. The transfer vectors were created as three series: the DA series with incremental deletions of gag sequences in the presence of the entire 5′ UTR, the FA series with incremental deletions of the 5′ UTR sequences in the absence of gag, and the NS series with incremental deletions of the 5′ UTR sequences in the presence of 400 nt of gag (Figures 1B and 2B). Both the vector series with the wild type MMTV LTR (Figure 1B) and the chimeric CMV/RU5 LTR (Figure 2B) were created through several stages of cloning using PCR amplification of the 5′ end of the HYBMTV clone, from the first nucleotide in R to the various regions specified in the constructs using specific primers listed in Table 2. Initially, the three series of transfer vectors maintained the MMTV wild type LTR (Figure 1B); however, due to their low expression in human cells despite hormone induction, the U3 region of the LTR containing the MMTV promoter was replaced by the hCMV promoter via PCR-based cloning, as described earlier [33]. Specific details of the plasmid construction can be obtained from the authors upon request.
Table 2. Description of primers used for cloning of the DA, FA, and NS series of vectors, with either the MMTV LTR or the chimeric 5′ LTR containing CMV/R/U5.
Oligo Name | Genomic Location | Size | S/AS* | Sequence (5′ to 3′) | Description |
OTR 551 | From the start of HYBMTV 5′ U3 | 28 | S | GCATCGATAATGCCGCGCCTGCAGCAGA | 2 extra bp/ClaI/nt 1–20 of 5′ U3 of HYBMTV |
OTR 552 | Initial 400 bp of HYBMTV Gag | 33 | AS | CGACTAGTGATATCGTTCCCCTGGTCCCATAAG | 2 extra bp/SpeI/EcoRV/nt 1885–1867 HYBMTV Gag |
OTR 553 | HYBMTV Env | 40 | S | GCACTAGTGCTAGCCCTACATGGTTCTGGGAAAATTCTCC | 2 extra bp/SpeI/NheI/nt 7485–7509 HYBMTV Env |
OTR 554 | End of HYBMTV (at the end of 3′ U5) | 29 | AS | CAGGGTACCGCTGCCGCAGTCGGCCGACC | 3 extra bp/KpnI/nt 9877–9857 HYBMTV 3′ U5 end |
OTR 555 | HYBMTV 160 bp 5′ UTR (entire 5′ UTR) | 28 | AS | CGACTAGTTTCCAATGGCTCACCGTAAC | 2 extra bp/SpeI/nt 1485–1468 of HYBMTV 5′ UTR |
OTR 556 | HYBMTV 30 bp Gag | 28 | AS | CGACTAGTTTTCTGCCCTTTTGAGCCCG | 2 extra bp/SpeI/nt 1515–1495 of HYBMTV Gag |
OTR 557 | HYBMTV 60 bp Gag | 28 | AS | CGACTAGTGAGGAGCCTTTGTAAAACAG | 2 extra bp/SpeI/nt 1544–1525 of HYBMTV Gag |
OTR 558 | HYBMTV 90 bp Gag | 28 | AS | CGACTAGTACTCTCTTTCACATGAAGAC | 2 extra bp/SpeI/nt 1574–1555 of HYBMTV Gag |
OTR 559 | HYBMTV 120 bp Gag | 29 | AS | CGACTAGTTATTAGAAACTGATAAAATTC | 2 extra bp/SpeI/nt 1604–1585 of HYBMTV Gag |
OTR 560 | HYBMTV 150 bp Gag | 28 | AS | CGACTAGTTCCTTCTTCGGGAAACCAAG | 2 extra bp/SpeI/nt 1634–1615 of HYBMTV Gag |
OTR 561 | HYBMTV PBS only | 28 | AS | CGACTAGTTCCCTGTTCGGGCGCCAGCT | 2 extra bp/SpeI/nt 1324–1305 of HYBMTV PBS |
OTR 562 | HYBMTV 32 bp 5′ UTR | 28 | AS | CGACTAGTAGAAATAGAGACAAGGGTCA | 2 extra bp/SpeI/nt 1354–1337of HYBMTV 5′ UTR |
OTR 563 | HYBMTV 64 bp 5′ UTR | 28 | AS | CGACTAGTAAAGAGACAATACAAGACAA | 2 extra bp/SpeI/nt 1388–1369 of HYBMTV 5′ UTR |
OTR 564 | HYBMTV 96 bp 5′ UTR | 28 | AS | CGACTAGTCCGTTCCGCTCTTGTGATGA | 2 extra bp/SpeI/nt 1420–1401 of HYBMTV 5′ UTR |
OTR 565 | HYBMTV 128 bp 5′ UTR | 28 | AS | CGACTAGTCGTAGGCGGGACTGCAGCTC | 2 extra bp/SpeI/nt 1452–1433 of HYBMTV 5′ UTR |
OTR 617 | Start of HYBMTV 5′ R | 35 | S | CGCAAGCTTGAGCTCGAGTAAACTTGCAACAGTCC | 3 extra bp/HindIII site/nt 1163–1182 of HYBMTV R |
S/AS, sense or antisense.
Transfection and Infection of Cells
The human epithelial kidney cell line, 293T, was used for the production of VSV-G-pseudotyped-MMTV virus particles containing RNA from the various constructs using a modified calcium phosphate method as described [73]. The transfections for each mutant transfer vector were carried out in 6-well plates with 1–2 plates per vector (depending upon the experiment) along with the control luciferase expression vector, pGL3 (Promega, USA), to monitor transfection efficiency as described earlier [23]. Transduction by the marker hygromycin resistance gene present on the transfer vector RNA was observed by infection of the human cervical cancer cell line (HeLaT4) by the pseudotyped virus particles and selection for hygromycin-resistant colonies, as described previously [41].
RNA Isolation, Nucleocytoplasmic Fractionation of Cells and RT PCR
Transfected cells were fractionated into nuclear and cytoplasmic fractions to allow separate analysis of RNA residing within the two cellular compartments as described earlier [23]. RNA from each fraction was isolated from transfected cells using the Trizol reagent, as per manufacturer's directions (Invitrogen, USA). Integrity of the nucleocytoplasmic fractionation was monitored by the absence of the nuclear-only unspliced ß-actin mRNA in the cytoplasmic RNA fractions by reverse transcriptase PCR (RT-PCR). Briefly, following DNase treatment, equal RNA amounts (2.5 ug per sample for each fractions) were tested for DNA contamination by PCR amplification for 30 cycles using primers specific for a house keeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Figure 2C, panel III). Lack of any amplifiable signal confirmed that the RNA preparations were not contaminated with DNA carried over from the transfected cultures. Next, the DNased RNA fractions were reverse transcribed and amplified using primers specific for unspliced and spliced ß-actin mRNA to confirm whether nuclear membrane integrity was maintained during fractionation or not. As an additional control, multiplex amplifications were performed in the presence of primers/competimer for 18S ribosomal RNA, ensuring that each sample in the unspliced ß-actin PCRs contained amplifiable cDNAs.
Southern Blot Analysis
Some of the packaged viral RNA samples were subjected to Southern blot analysis as described earlier [70] for which the probe was prepared by PCR amplification using primers within the 5′ R/U5/PBS region common to all the transfer vectors as follows: OTR671 (+) GTC CTA ATA TTC ACG TCT CGT GTG, nt 1179–1202 and OTR 672 (−) CTG TTC GGG CGC CAG CTG CCG CAG, nt 1298–1321. Hybridization was performed using the AlkPhos Direct Labeling Kit (Amersham, USA) as per manufacturer's directions.
Real Time PCR Analysis of Transfer Vector Expression
To test the relative levels of transfer vector RNAs expressed within the cytoplasm and packaged into the viral particles, a real time PCR custom expression assay was developed using the minor groove binding (MGB)/FAM and MGB/VIC chemistry from Applied Biosystems, USA. Additionally, the ABI real time PCR assays use ROX as an internal fluorescence reference dye to which the target reporter dye signal (either FAM or VIC, in our case) is normalized to during data analysis, to correct for fluorescence fluctuations caused by changes in concentration or volume. The PCR primers were designed to anneal within a region at the beginning of the MMTV U5 region (nt 1192–1259), a 68 nt region common to all the constructs, enabling their relative quantitative assessment using the same probe/primer combination concomitantly. The sequence of the probe and primers were as follows: Probe (MTV-1LTR-SITEM1 FAM): TCGCCATCCCGTCTCC (16-mer; nt 1214–1229); Forward primer (MTV-1LTR-SITEF): CGTCTCGTGTGTTTGTGTTTGTGTCTGT (22-mer; nt 1192–1213); Reverse primer (MTV-1LTR-SITER): CCTCTGGAAAGTGAAGGATAAGTGA (25-mer; nt 1259-1235). The assay was validated in silico using the Primer Express tool as well as the ABI design pipeline bioinformatic tools that ensure specificity, reproducibility, and amplification efficiency of the assay performance. Further validation of the PCR amplification efficiency was conducted by testing the assay using the online web tool “pcrEfficiency” [74] that confirmed it to be over 100%. As an endogenous control, the optimized ß-actin MGB VIC-labeled assay (no 4326315E with limited primer concentration) from ABI was used (Applied Biosystems, USA).
To determine which method to use for the Relative Quantification analysis, the standard curve or the comparative (ΔΔCt) method, a 10- and serial 2-fold dilutions of a cDNA prepared from 293T cells expressing DA24 were tested in non-multiplex RT-PCRs in triplicates assuming conservatively that 1 ug of input RNA results in ∼100 ng of single stranded cDNA using random hexamers as primers and MMLV RT (Promega; Figure 3A and 3B). The resultant Ct values were plotted on a scatter plot against the pg of cDNA tested in each dilution in triplicates to generate standard curves for both assays (Figure 3C and 3D). This was followed by calculating the ΔCt values (Ct values from MMTV assay – Ct value of ß-actin endogenous control) which were plotted against the input cDNA to determine the slope of the curve (Figure 3E).
For the final relative quantification analysis, each viral RNA sample was tested in triplicates in multiple assays using the Taqman Universal Master Mix (Applied Biosystems and the 7500 Real Time PCR System (Applied Biosystems, USA), while the cytoplasmic RNA was tested in duplicates. As mentioned earlier for the cytoplasmic RNA fractions, 1/5th of the total viral RNA preparations were first DNase-treated, confirmed for the absence of DNA by PCR using vector RNA specific primers, and then reverse transcribed into cDNA, as previously described [73]. Equal amounts of the resulting cDNAs were tested for vector expression in the cytoplasmic fractions as well as their packaging in the viral particles using the real time PCR assay and the following cycling conditions: an initial denaturation step of 10 minutes at 94°C followed by 40 cycles of denaturation and annealing/extension steps at 95°C for 15 secs and 60°C for 1 min. The relative packaging efficiency for each mutant transfer vector RNA was determined after normalization of the data with the endogenous control, ß-actin, as well as the control for transfection efficiency, luciferase expression.
Statistical Analysis
To determine whether the observed differences in the normalized packaging efficiencies were statistically significant, a standard, paired, two-tailed Student's ttest was performed between various constructs using the Microsoft Excel software. A value of p<0.01 was considered statistically significant.
Acknowledgments
We would like to thank Dr. Didier Trono (Ecole Polytechnique Fédérale de Lausanne, Switzerland) for providing MD.G and Dr. Jaquelin Dudley (University of Texas at Austin, Austin, TX, USA) for providing HYBMTV molecular clone.
Funding Statement
This work was supported by a grant from the Research Affairs at the United Arab Emirates University under contract # 02-03-8-11/06 to FM and Terry Fox Fund for Cancer Research grant # 2009-06 to TAR. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Coffin JM (1996) Retroviridae: the viruses and their replication. In: Fields Virology. Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, Roizman B, Straus SE, editors. Philadelphia: Lippincott-Raven Publishers. pp. 1767–1846.
- 2. Cullen BR (2005) Nuclear RNA export unwound. Nature 433: 26–27. [DOI] [PubMed] [Google Scholar]
- 3. Swanson CM, Malim MH (2006) Retrovirus RNA trafficking: from chromatin to invasive genomes. Traffic 7: 1440–1450. [DOI] [PubMed] [Google Scholar]
- 4. D'Souza V, Summers MF (2005) How retroviruses select their genomes. Nat Rev Microbiol 8: 643–655. [DOI] [PubMed] [Google Scholar]
- 5. Lever AML (2007) HIV RNA packaging. Adv Pharmacol 55: 1–32. [DOI] [PubMed] [Google Scholar]
- 6. Johnson SF, Telesnitsky A (2010) Retroviral RNA dimerization and packaging: the what, how, when, where, and why. PLoS Pathog 6: e1001007 doi:10.1371/journal.ppat.1001007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Lu K, Heng X, Summers MF (2011) Structural determinants and mechanism of HIV-1 genome packaging. J Mol Biol 410: 609–633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Miyazaki Y, Miyake A, Nomaguchi M, Adachi A (2011) Structural dynamics of retroviral genome and the packaging. Frontiers Micb doi:10.3389/fmicb.2011.00264. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Rizvi TA, Panganiban A (1993) Simian immunodeficiency virus RNA is efficiently encapsidated by human immunodeficiency virus type 1 particles. J Virol 67: 2681–2688. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Berkowitz RD, Hammarskjold ML, Helga-Maria C, Rekosh D, Goff SP (1995) 5′ regions of HIV-1 RNAs are not sufficient for encapsidation: implications for the HIV-1 packaging signal. Virology 212: 718–723. [DOI] [PubMed] [Google Scholar]
- 11. McBride MS, Panganiban AT (1997) Position dependence of functional hairpins important for human immunodeficiency virus type 1 encapsidation in vivo . J Virol 71: 2050–2058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Clever JL, Parslow TG (1997) Mutant human immunodeficiency virus type 1 genomes with defects in RNA dimerization or encapsidation. J Virol 71: 3407–3414. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Guan Y, Whitney JB, Diallo K, Wainberg MA (2000) Leader sequences downstream of the primer binding site are important for efficient replication of simian immunodeficiency virus. J Virol 74: 8854–8860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Guan Y, Whiteny JB, Liang C, Wainberg MA (2001) Novel, live attenuated simian immunodeficiency virus constructs containing major deletions in leader RNA sequences. J Virol 75: 2776–2785. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Patel J, Wang SW, Izmailova E, Aldovini A (2003) The simian immunodeficiency virus 5′ untranslated leader sequence plays a role in intracellular viral protein accumulation and in RNA packaging. J Virol 77: 6284–6292. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Strappe PM, Greatorex J, Thomas J, Biswas P, McCann E, et al. (2003) The packaging signal of simian immunodeficiency virus is upstream of the major splice donor at a distance from the RNA cap site similar to that of human immunodeficiency virus types 1 and 2. J Gen Virol 84: 2423–2430. [DOI] [PubMed] [Google Scholar]
- 17. Whitney JB, Wainberg MA (2006) Impaired RNA incorporation and dimerization in live attenuated leader variants of SIVmac239. Retrovirology 3: 96. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Houzet L, Paillart JC, Smagulova F, Maurel S, Morichaud Z, et al. (2007) HIV controls the selective packaging of genomic, spliced viral and cellular RNAs into virions through different mechanisms. Nucleic Acids Res 35: 2695–2704. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Heng X, Kharytonchyk S, Garcia EL, Lu K, Divakaruni SS, et al. (2012) Identification of a minimal region of the HIV-1 5′ leader required for RNA dimerization, NC binding, and packaging. J Mol Biol 417: 224–239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Browning MT, Mustafa F, Schmidt RD, Lew KA, Rizvi TA (2003a) Delineation of sequences important for efficient FIV RNA packaging. J Gen Virol 84: 621–627. [DOI] [PubMed] [Google Scholar]
- 21. Browning MT, Mustafa F, Schmidt RD, Lew KA, Rizvi TA (2003b) Sequences within the gag gene of feline immunodeficiency virus (FIV) are important for efficient RNA encapsidation. Virus Res 93: 199–209. [DOI] [PubMed] [Google Scholar]
- 22. Schmidt RD, Mustafa F, Lew KA, Browning MT, Rizvi TA (2003) Sequences within both the 5′ untranslated region and the gag gene are important for efficient encapsidation of Mason-Pfizer monkey virus RNA. Virology 309: 166–178. [DOI] [PubMed] [Google Scholar]
- 23. Mustafa F, Ghazawi A, Jayanth P, Phillip PS, Ali J, et al. (2005) Sequences intervening between the core packaging determinants are dispensable for maintaining the packaging potential and propagation of feline immunodeficiency virus transfer vector RNAs. J Virol 79: 13817–13821. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Jaballah SA, Aktar SJ, Ali J, Phillip PS, Al Dhaheri NS, et al. (2010) A G–C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason–Pfizer monkey virus (MPMV) genomic RNA. J Mol Biol 401: 996–1014. [DOI] [PubMed] [Google Scholar]
- 25. Klein R, Ruttkowski B, Schwab S, Peterbauer T, Salmons B, et al. (2008) Mouse mammary tumor virus promoter- containing retroviral promoter conversion vectors for gene-directed enzyme prodrug therapy are functional in vitro and in vivo. J Biomed Biotechnol 2008: 683505 doi:10.1155/2008/683505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Al Dhaheri N, Phillip PS, Ghazawi A, Ali J, Beebi E, et al. (2009) Cross-packaging of genetically distinct mouse and primate retroviral RNAs. Retrovirology 6: 66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Yin PH, Hu W-S (1997) RNAs from genetically distinct retroviruses can copackage and exchange genetic information in vivo. J Virol 71: 6237–6242. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Kaye JF, Lever AM (1998) Nonreciprocal packaging of human immunodeficiency virus type 1 ad type 2 RNA: a possible role for the p2 domain of Gag in RNA encapsidation. J Virol 72: 5877–5885. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Motomura K, Chen J, Hu W-S (2008) Genetic recombination between human immunodeficiency virus type 1 (HIV-1) and HIV-2, two distinct human lentiviruses. J Virol 82: 1923–1933. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Al Shamsi IR, Al Dhaheri NS, Phillip PS, Mustafa F, Rizvi TA (2011) Reciprocal cross-packaging of primate lentiviral (HIV-1 and SIV) RNAs by heterologous non-lentiviral MPMV proteins. Virus Res 155: 352–7. [DOI] [PubMed] [Google Scholar]
- 31. Günzburg WH, Salmons B (1986) Mouse mammary tumor virus mediated transfer and expression of neomycin resistance to infected cultured cells. Virology 155: 236–248. [DOI] [PubMed] [Google Scholar]
- 32. Salmons B, Moritz-Legrand S, Garcha I, Günzburg WH (1989) Construction and characterization of a packaging cell line for MMTV-based conditional retroviral vectors. Biochem Biophys Res Comm 159: 1191–1198. [DOI] [PubMed] [Google Scholar]
- 33. Rizvi TA, Ali J, Phillip PS, Ghazawi A, Jayanth P, et al. (2009) Role of a heterologous retroviral transport element in the development of genetic complementation assay for mouse mammary tumor virus (MMTV) replication. Virology 385: 464–472. [DOI] [PubMed] [Google Scholar]
- 34. Naldini L, Blomer U, Gallay P, Ory D, Mulligan R, et al. (1996) In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272: 263–267. [DOI] [PubMed] [Google Scholar]
- 35. Buetti E, Diggelmann H (1983) Glucocorticoid regulation of mouse mammary tumor virus: identification of a short essential DNA region. EMBO J 2: 1423–1429. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Ham A, Thomson M, Needham P, Parker WM (1988) Characterization of response elements for androgens, glucocorticoids and progestins in mouse mammary tumour virus. Nucleic Acids Res 16: 5263–5276. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Indik S, Günzburg WH, Salmons B, Rouault F (2005) A novel, mouse mammary tumor virus encoded protein with Rev-like properties. Virology 337: 1–6. [DOI] [PubMed] [Google Scholar]
- 38. Mertz JA, Simper MS, Lozano MM, Payne SM, Dudley JP (2005) Mouse mammary tumor virus encodes a self-regulatory RNA export protein and is a complex retrovirus. J Virol 79: 14737–14747. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Hohenadl C, Gunzburg WH, Salmons B, Indik S (2012) The 5′ leader sequence of mouse mammary tumor virus enhances expression of the envelope and reporter genes. J Gen Virol 93: 308–318. [DOI] [PubMed] [Google Scholar]
- 40. Poeschla EM, Wong-Staal F, Looney DJ (1998) Efficient transduction of nondividing cells by feline immunodeficiency virus lentiviral vectors. Nat Med 4: 354–357. [DOI] [PubMed] [Google Scholar]
- 41. Browning MT, Schmidt RD, Lew KA, Rizvi TA (2001) Primate and feline lentivirus vector RNA packaging and propagation by heterologous lentivirus virions. J Virol 75: 5129–5140. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Rizvi TA, Kenyon JC, Ali J, Aktar SJ, Phillip PS, et al. (2010) Optimal packaging of FIV genomic RNA depends upon a conserved long-range interaction and a palindromic sequence within gag. J Mol Biol 403: 103–119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Bray M, Prasad S, Dubay JW, Hunter E, Jeang KT, et al. (1994) A small element from the Mason-Pfizer monkey virus genome makes human immunodeficiency virus type 1 expression and replication Rev-independent. Proc Natl Acad Sci U S A 91: 1256–1260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Rizvi TA, Schmidt RD, Lew KA, Keeling ME (1996) Rev/RRE-independent Mason-Pfizer monkey virus-constitutive transport element-dependent propagation of SIVmac239 vectors using a single round of replication assay. Virology 222: 457–463. [DOI] [PubMed] [Google Scholar]
- 45. Tan W, Felber BK, Zolotukhin AS, Pavlakis GN, Schwartz S (1995) Efficient expression of the human papillomavirus type 16 L1 protein in epithelial cells by using Rev and the Rev-responsive element of human immunodeficiency virus or the cis-acting transactivation element of simian retrovirus type 1. J Virol 69: 5607–5620. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Ott DE, Coren LV, Johnson DG, Sowder RCII, Arthur LO, et al. (1995) Analysis and localization of cyclophilin A found in the virions of human immunodeficiency virus type 1 MN strain. AIDS Res Hum Retrovir 11: 1003–1006. [DOI] [PubMed] [Google Scholar]
- 47. Muriaux D, Mirro JD, Harvin D, Rein A (2001) RNA is a structural element in retrovirus particles. Proc Natl Acad Sci U S A 98: 5246–5251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Muriaux D, Mirro JD, Nagashima K, Harvin D, Rein A (2002) Murine leukemia virus nucleocapsid mutant particles lacking viral RNA encapsidate ribosomes. J Virol 76: 11405–11413. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Giles KE, Caputi M, Beemon KL (2004) Packaging and reverse transcription of snRNAs by retroviruses may generate pseudogenes. RNA 10: 299–307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Onafuwa-Nuga AA, Telesnitsky A, King SR (2006) 7SL RNA, but not the 54-kD signal recognition particle protein, is an abundant component of both infectious HIV-1 and minimal virus-like particles. RNA 12: 542–546. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Rulli SJ Jr, Catherine S, Hibbert, Mirro J, Pederson T, et al. (2007) Selective and Nonselective Packaging of Cellular RNAs in Retrovirus Particles. J Virol 81: 6623–6631. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Kenyon JC, Ghazawi A, Cheung WKS, Phillip PS, Rizvi TA, et al. (2008) The secondary structure of the 5′ end of the FIV genome reveals a long-range interaction between R/U5 and gag sequence, and a large, stable stem loop. RNA 14: 2597–2608. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. Kenyon JC, Tanner SJ, Legiewicz M, Phillip PS, Rizvi TA, et al. (2011) SHAPE analysis of the FIV leader RNA reveals a structural switch potentially controlling viral packaging and genome dimerization. Nucleic Acids Res 39: 6692–6704. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Balvay L, Lopez LM, Sargueil B, Darlix JL, Ohlmann T (2007) Translational control of retroviruses. Nat Rev Microbiol 5: 128–140. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Bolinger C, Boris-Lawrie K (2009) Mechanisms employed by retroviruses to exploit host factors for translational control of a complicated proteome. Retrovirolgoy 6: 8 doi:10.11186/1742-4690-6-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. Lanchy JM, Ivanovitch JD, Lodmell JS (2003) A structural linkage between the dimerization and encapsidation signals in HIV-2 leader RNA. RNA 9: 1007–1018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Greatorex J (2004) The retroviral RNA dimer linkage: different structures may reflect different roles. Retrovirology 1: 22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58. Paillart JC, Shehu-Xhilaga M, Marquet R, Mak J (2004) Dimerization of retroviral RNA genomes: an inseparable pair. Nat Rev Microbiol 2: 461–472. [DOI] [PubMed] [Google Scholar]
- 59. Russell RS, Liang C, Wainberg MA (2004) Is HIV-1 RNA dimerization a prerequisite for packaging? Yes, no, probably? Retrovirology 1: 23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60. Berkhout B, van Wamel JLB (1996) Role of the DIS hairpin in replication of human immunodeficiency virus type 1. J Virol 70: 6723–6732. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Gallego J, Greatorex J, Zhang H, Yang B, Arunachalam S, et al. (2003) Rev binds specifically to a purine loop in the SL1 region of the HIV-1 leader RNA. J Biol Chem 278: 40385–40391. [DOI] [PubMed] [Google Scholar]
- 62. Greatorex JS, Palmer EA, Pomerantz RJ, Dangerfield JA, Lever AM (2006) Mutation of the Rev-binding loop in the human immunodeficiency virus 1 leader causes a replication defect characterized by altered RNA trafficking and packaging. J Gen Virol 87: 3039–3044. [DOI] [PubMed] [Google Scholar]
- 63. Moore MD, Nikolaitchik OA, Chen J, Hammarskjöld ML, Rekosh D, et al. (2009) Probing the HIV-1 genomic RNA trafficking pathway and dimerization by genetic recombination and single virion analyses. PLoS Pathog 5: e1000627. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64. Simpson SB, Zhang L, Craven RC, Stoltzfus CM (1997) Rous sarcoma virus direct repeat cis elements exert effects at several points in the virus life cycle. J Virol 71: 9150–9156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Basyuk E, Boulon S, Pedersen FS, Bertrand E, Rasmussen SV (2005) The packaging signal of MLV is an integrated module that mediates intracellular transport of genomic RNAs. J Mol Biol 354: 330–339. [DOI] [PubMed] [Google Scholar]
- 66. Greatorex J, Gallego J, Varani G, Lever A (2002) Structure and stability of wild-type and mutant RNA internal loops from the SL-1 domain of the HIV-1 packaging signal. J Mol Biol 322: 543–557. [DOI] [PubMed] [Google Scholar]
- 67. Müllner M, Salmons B, Günzburg WH, Indik S (2008) Identification of the Rem-responsive element of mouse mammary tumor virus. Nucleic Acids Res 36: 6284–6294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68. Mertz JA, Chadee AB, Byun H, Russell R, Dudley JP (2009) Mapping of the functional boundaries and secondary structure of the mouse mammary tumor virus Rem-responsive element. J Biol Chem 284: 25642–25652. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69. Mertz JA, Lozano MM, Dudley JP (2009) Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element. Retrovirology 6: 10–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70. Ghazawi A, Mustafa F, Phillip PS, Jayanth P, Ali J, et al. (2006) Both the 5′ and 3′ LTRs of FIV contain minor RNA encapsidation determinants compared to the two core packaging determinants within the 5′ untranslated region and gag. Microbes Infect 3: 767–778. [DOI] [PubMed] [Google Scholar]
- 71. Lu K, Heng X, Garyu L, Monti S, Garcia EL, et al. (2011) NMR detection of structures in the HIV-1 5′-leader RNA that regulate genome packaging. Science 334: 242–245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72. Shackleford GM, Varmus HE (1988) Construction of a clonable, infectious, and tumorigenic mouse mammary tumor virus provirus and a derivative genetic vector. Proc Natl Acad Sci U S A 85: 9655–9659. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73. Mustafa F, Jayanth P, Phillip PS, Ghazawi A, Schmidt RD, et al. (2005) Relative activity of the feline immunodeficiency virus promoter in feline and primate cell lines. Microbes Infect 7: 233–239. [DOI] [PubMed] [Google Scholar]
- 74. Mallons I, Eridd J (2011) Egea-Cortines (2011) pcrEfficiency: a Web tool for PCR amplification efficiency prediction. BMC Bioinformatics 12: 404 doi:10.1186/1471-2105-12-404. [DOI] [PMC free article] [PubMed] [Google Scholar]