Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Nov 1.
Published in final edited form as: J Immunol. 2012 Sep 28;189(9):4305–4312. doi: 10.4049/jimmunol.1200745

The Yaa locus and IFNα fine tune germinal center B cell selection in murine SLE

Ioana Moisini *,†, Weiqing Huang *,†, Ramalingam Bethunaickan *, Ranjit Sahu *, Peta-Gay Ricketts *, Meredith Akerman ‡, Tony Marion §, Martin Lesser ‡, Anne Davidson *,
PMCID: PMC3478483  NIHMSID: NIHMS404831  PMID: 23024275

Abstract

Male NZW/BXSB.Yaa (W/B) mice express two copies of TLR7 and develop pathogenic autoantibodies whereas females with only one copy of TLR7 have attenuated disease. Our goal was to analyze the regulation of the autoantibody response in male and female W/B mice bearing the autoreactive site-directed heavy chain transgene 3H9. Serum anti-dsDNA antibodies appeared in males at 12 weeks and most had high titer IgG anti-dsDNA and anti-cardiolipin antibodies and developed >300mg/dl proteinuria by 8 months. Females had only low titer IgG anti-CL antibodies and none developed proteinuria by 1 year. Males had a smaller marginal zone (MZ) than females with a repertoire that was distinct from the follicular repertoire, indicating that the loss of MZ B cells was not due to diversion to the follicular compartment. Vk5-43 and Vk5-48, that were rare in the naïve repertoire, were markedly overrepresented in the GC repertoire of both males and females but the VJ junctions differed between males and females with higher affinity autoreactive B cells being selected into the GCs of males. Administration of IFNα to females induced anti-cardiolipin and anti-DNA autoantibodies and proteinuria and was associated with a male pattern of junctional diversity in Vk5-43 and Vk5-48. Our studies are consistent with the hypothesis that presence of the Yaa locus, that includes an extra copy of Tlr7, or administration of exogenous IFNα relaxes the stringency for selection in the germinal centers resulting in increased autoreactivity of the antigen driven B cell repertoire.

INTRODUCTION

B cells and antigen presenting cells express intracellular nucleic acid sensing Toll like receptors (TLRs) that may be accessed by self-antigens when apoptotic debris or immune complexes are internalized by B cell receptors or Fc receptors respectively (1). Ligation of these TLRs by nucleic acids results in rapid cell activation and release of inflammatory mediators including Type I IFNs. Genome wide association studies of SLE in humans have highlighted the importance of the TLR and Type 1 IFN signaling pathways in the genetic risk for SLE (2). TLR7 is an innate sensor of single-stranded RNA, helping to protect against RNA viruses; it is also required for the expression of anti-RNA autoantibodies in lupus models (3). Two-fold TLR7 overexpression induces SLE in susceptible mouse strains (4–5) and 4–8 fold TLR7 overexpression induces spontaneous disease even in non-autoimmune C57BL/6 mice (6).

Male BXSB mice bearing the Yaa locus have a duplication of part of the X chromosome that includes the Tlr7 gene, onto the Y chromosome (4–5) and therefore have a two-fold increase in TLR7 expression. Although there are at least 16 genes in the Yaa locus, recent studies suggest that the Tlr7 duplication is the dominant genetic contributor to the Yaa phenotype {Deane, 2007 #3137;Fairhurst, 2008 #3183;Santiago-Raber, 2008 #3165} including the production of antibodies to dsDNA, organomegaly and the development of severe SLE nephritis. More recent studies show that 4–8 fold overexpression of TLR7 is sufficient to induce spontaneous onset of SLE even in non-autoimmune strains (6). NZW/BXSB F1 (W/B) male mice bearing the Yaa locus spontaneously develop high titer anti-cardiolipin (CL) and anti-Sm/RNP antibodies that are associated with both anti-phospholipid syndrome and renal failure, whereas females that express only one copy of Tlr7 develop a much later and milder disease (7). When we administered a small dose of IFNα-expressing adenovirus to female W/B mice they developed high titer anti-CL and anti-Sm/RNP IgG autoantibodies within 6 weeks followed by the onset of nephritis and early mortality (8).

To analyze the mechanisms for dysregulation of the autoantibody response in TLR7 over-expressing W/B males and for the loss of B cell tolerance following exogenous IFNα administration in females we generated W/B mice bearing the site directed anti-CL/DNA autoantibody VH transgene 3H9 (9). VH3H9 is a heavy chain isolated from an anti-DNA antibody spontaneously produced in MRL/lpr mice; it pairs with a wide variety of V light chains to generate DNA and non-DNA binding antibodies as well as low affinity anti-CL antibodies (10). Previous elegant studies by the Weigert lab have shown that both genetic background and strength of BCR signaling influence the stringency of selection of 3H9 B cells (11–12). We found that loss of tolerance to CL and DNA is broken in 3H9 W/B mice as they age but occurs much earlier in males than in females. Analysis of the naive light chain repertoire associated with the 3H9 transgene suggests an increase in stringency of negative selection of naïve B cells in males resulting in depletion of MZ B cells. In contrast, B cell selection and expansion in the germinal centers is dysregulated in males. Female germinal centers are regulated more stringently than those of males but this regulation is disrupted by the administration of IFNα. Our studies are consistent with the hypothesis that either TLR7 overexpression or exogenous IFNα relaxes the stringency for selection in the germinal centers resulting in increased autoreactivity of the antigen driven B cell repertoire.

METHODS

Mice

3H9.NZW female mice were bred with BXSB males (purchased from Jackson Laboratories) and F1 progeny were tested for proteinuria every two weeks (Multistick, Fisher, Pittsburg, PA) and bled periodically for serologic analysis as previously described (7–8). Groups of male and female mice were sacrificed at 8, 22–28, and 56 weeks of age. Groups of female mice 12–14w of age were injected with adenovirus expressing IFNα or control adenovirus expressing LacZ (3.3 × 108 particles) as previously described (8) and were sacrificed 8–10 weeks after IFN induction.

Antibodies to Cardiolipin and dsDNA

Serial sera were analyzed for antibodies to cardiolipin (using FCS in the blocking solution as a source of β2glycoprotein-1) and dsDNA using ELISAs as previously described (7). A high titer positive serum was run in serial dilution on each plate as a quantitation control. 3H9 transgenic mice did not develop anti-Sm/RNP antibodies (data not shown).

Flow Cytometry and sorting

Spleen cells were analyzed for B and T cell markers as previously described (13–14) using antibodies to CD4 (Caltag, Burlingham, CA), CD8 (Caltag), and CD19. CD4 T cell subsets were identified using PE-anti-CD69, Cy-anti-CD44 and PE-anti-CD62L. B cell subsets were identified using biotin-anti-CD23, FITC anti-CD21, PE anti-IgM or FITC anti-IgM (Southern Biotech, Birmingham, AL), FITC-PNA (Vector, Burlingame, CA), PE anti-IgD, PE anti-B220, PE anti-CD43, biotin anti-Fas, PE anti-CD138, and APC anti-CD19. Streptavidin PerCP or PE was used as a second stain for biotinylated antibodies. Except where indicated, all antibodies were purchased from BD Pharmingen, San Diego, CA.

For sorting of single cells or cell pellets from B cell subpopulations, B cells were gated using anti-CD19 as previously described (14–15). T1 cells were CD23lo/IgMhi/CD21−, T2-MZP cells were CD23hi/IgMhi/CD21+, marginal zone (MZ) cells were CD23lo/IgMhi/CD21hi, follicular (FO) cells were IgDhi/IgMint, germinal center (GC) cells were IgM−/IgD−/PNA+/Fas+ and class switched (CS) cells were IgD−/IgM−. Plasma cells were B220int/IgD−/CD138hi (13).

Single cell PCR

Single T1, T2, MZ, FO and GC B cells and plasma cells were sorted into PCR plates and cDNA was synthesized as previously described (16–17). The cDNA mixture from each sorted cell was then used as template for a PCR reaction to identify the presence of the 3H9 heavy chain. Each PCR reaction was performed in a total volume of 20uL containing 2uL of cDNA, 10uL of FastStart PCR master (Roche Applied Science, Indianapolis, IN), 62.5nM of a 5′ primer specific for FR1 of 3H9 (5′ CAGGTTCAACTGCAGCAGTC 3′) and 3′ primers specific for IgM (T1, T2, MZ and FO cells) or IgG2a (GC B cells and plasma cells) constant regions (17). The PCR program was as follows: 4 min at 94°C; 50 cycles of 30 sec at 94°C, 30 sec at 60°C, and 55 sec at 72°C; followed by 10 min at 72°C. A second round was then performed using a 5′ primer specific for CDR1 of 3H9 (5′ AGTAGCTCCTGGATGAACTGG 3′) and a 3′ primer specific for 3H9 CDR3 (5′ CATAACATAGGAATATTTACTCCTCGC 3′). Wells that yielded a product of the correct size were subjected to PCR for Vκ as previously described (17–18). PCR products were sequenced by Genewiz (South Plainfield, NJ) and sequences were identified using the IMGT database. To distinguish Vκ5–43*01 or 5–45*01 that differ by three base pairs at the 5′ end, a 5′ leader primer (5′ GAGATCACCGGTCACCATGGTTTTCACACCTCAGAT 3′) was used to generate the full length light chain for resequencing.

Generation of hybridomas

Spontaneous hybridomas were generated from 4 female (8–12 months of age) and 7 male mice (6–9 months of age) using routine methodology (19). Hybridomas were screened for reactivity to dsDNA and CL by ELISA and for IgM and IgG isotype as previously described (7). 32 autoreactive IgG hybridomas randomly selected from 3 male and one female fusion were successfully subcloned by limiting dilution and the heavy and light chains were subjected to PCR and sequenced as above.

Ig expression studies

The 3H9 heavy chain was cloned into the NheI and EcoRI restriction sites of mouse IgG2a expression vector (pFUSE-CHIg-mG2a, Invivogen - San Diego, CA) using manufacturers’ instructions. Germline-encoded light chain variable regions were synthesized (Genscript, New Piscataway, NJ) or generated by PCR from purified FO or MZ B cells and were cloned into the BstAPI and BstEII restriction sites of mouse kappa expression vector (pFUSE2-CLIg-mk, Invivogen). Heavy and light chain combinations were cotransfected into 293T cells using Lyovec kit (Invivogen) according to manufacturers’ instructions and supernatants were harvested after 48 hours. Supernatants were normalized to 1ug/ml and tested for binding to CL (7), dsDNA (19), ssDNA, histones (10ug/ml) and chromatin (20) and to phosphatidyl serine, phosphatidyl choline, insulin, chymotrypsinogen A, cytochrome C and KLH all plated at.10ug/ml.

Because it has been reported that the 3H9 antibody does not bind to dsDNA when purified away from associated nuclear material that may contaminate the cell supernatants (21), supernatants were diluted 3 fold in 0.01M Tris pH 7.8 and incubated with DNase I (1 μg/ml; Worthington Biochemical, Lakewood, NJ) for 90 min at 37°C in the presence of 2 mM MgCl2. After DNase treatment, the Ab was diluted 4 fold in PBS and passed through a Protein A column. Before elution, the column was washed extensively with 1 M NaCl (in PBS) to disrupt immune complexes by dissociating histones associated with DNA. Bound Ab was eluted with Na citrate pH 4, immediately neutralized and dialyzed against PBS. Eluates were normalized to an IgG2a concentration of 2ug/ml by ELISA and tested in serial dilutions for reactivity to CL, dsDNA, ssDNA, histones and chromatin as above. Purified hybridoma antibodies were similarly subjected to DNAse treatment and purification prior to testing for antigenic specificity.

Statistics

Comparisons shown in Figures 1 and 3 were performed using Wilcoxon Rank Sum Test. Proteinuria and survival data shown in Figure 2 were analyzed using Kaplan Meier curves and Log Rank test. Comparisons in Figure 5 were performed using χ2 analysis. Only significant p values are shown. Statistical analysis of the Vκ repertoire data was performed as previously described (17).

Figure 1.

Figure 1

Open in a new tab

Titers of autoantibodies in male (A and C) and female mice (B and D) at the age ranges shown. Treatment of 12w old females with IFN resulted in an increase in titers of autoantibodies within 6 weeks compared with Ad-LacZ treated (not shown) or untreated controls. * p < 0.05; ‡ p < 0.01; § p < 0.005 vs. 11–14w old gender matched controls.

Figure 3.

Figure 3

Open in a new tab

Flow cytometric analysis of B and T cell subsets: A: Percent and B: number of splenic cells of each B cell subtype. B cell subsets: T1; transitional type 1; T2; transitional type 2; MZ; marginal zone; FO: follicular; CS: class switched. C: Number of total and activated (CD69+) T and B cells and CD11B+ dendritic cells; D: p values for each comparison in B and C: * p < 0.05; † p < 0.01; ‡ p < 0.005 (n = 5–8 per group).

Figure 2.

Figure 2

Open in a new tab

Proteinuria (A) and survival (B) curves of male and female mice. Arrow indicates age at which Ad-IFNα was administered to females. p values: for proteinuria, p < 0.05 males vs. females, p< 0.01 Ad-IFNα treated vs. untreated or Ad-LacZ treated females; for survival, p< 0.001 Ad-IFNα treated vs. untreated or Ad-LacZ treated females (n = 10–25 per group).

Figure 5.

Figure 5

Open in a new tab

Analysis of the Jκ regions associated with (A) Vκ5-43*01 and (B) Vκ5-48*01 light chains in germinal center B cells and hybridomas of male and female 3H9 mice. The amino acid present at the V-J junction (position 116) for each Jκ is shown on the x-axis. Jκ usage of GC B cells from males and IFN treated females, or of autoreactive hybridomas was compared with that of female GC B cells: * p < 0.0001; † p < 0.002 compared with females; ‡ p = NS compared with males. C: Amino acid sequences of the CDR3 region of Vκ5-43*01 and each of the relevant Jκ regions.

RESULTS

Clinical phenotype of 3H9 W/B mice

Male mice developed high titer IgG autoantibodies to both CL and DNA by 6 months of age (Figure 1A and C) whereas females expressed significantly lower titers of autoantibodies than males until 1 year of age (Figure 1B and D). Significantly increased titers of anti-CL and anti-DNA autoantibodies were induced in Ad-IFNα treated mice compared with age matched untreated or Ad-LacZ controls (Figure 1B and D). Males developed proteinuria starting as young as 16 weeks of age whereas females remained proteinuria free until sacrificed at the age of 56 weeks (Figure 2). Proteinuria in the males persisted for many weeks and in some cases was relapsing and remitting. Survival rate for the males was 64% at 1 year. As we have reported for wild type W/B females, a small dose of Ad-IFNα, but not of control virus Ad-LacZ, induced proteinuria in female 3H9 W/B mice within 6–8 weeks; these mice had a high mortality rate (Figure 2).

B cell phenotype of 3H9 W/B mice

Flow cytometric analysis of cell subsets was performed on spleens of 8w, 22–28w and 56w male and female mice (Figure 3). As often observed in Ig transgenic mice, there was an increase in the percentage of MZ B cells in the 3H9 mice; males however, consistently had a lower percentage of MZ B cells than female mice (9.9 +/− 1.5 vs. 16.1 +/− 3.5% and 9.1 +/− 6.7 vs. 16.7 +/− 3.4% at 4w and 56w respectively - Figure 3A) and several male mice had lost their MZ B cells by 56 weeks of age. By the age of 22 weeks male spleens were 3–4 times larger than female spleens resulting in significantly higher total numbers of cells of all lymphocyte subsets except for MZ B cells (Figure 3B). Activation markers on both B and T cells appeared in both males and females with age but activated cell populations expanded earlier in the males (Figure 3C). Similarly, class switched B cells appeared earlier in males than in females (Figure 3A, B). These differences were maintained out to 56 weeks of age. As previously shown in wt female NZW/BXSB mice (8), treatment of 3H9 females with Ad-IFNα resulted in 3 fold splenic enlargement (p <0.01 compared with Ad-LacZ controls) and enhanced activation of B and T cells (data not shown).

Single cell PCR analysis of the B cell repertoire

To determine at what stage of development B cell tolerance was lost and to analyze the differences between males and females, we performed single cell PCR of the various splenic B cell subpopulations from young (8w old) intermediate (22w old) and old (56w old) male and female mice and analyzed the light chain repertoire associated with use of the 3H9 heavy chain. We used the Vκ gene list from the IMGT database for comparison. Of the known Vκ genes, 80 were represented among our dataset (Supplementary Tables I and II) indicating good coverage by our methodology. Of these 80 genes, 32 contributed >5% of the χ2 value (17) and >2.5% of the repertoire in any of the comparisons we performed (Table 1 and bold in Supplementary Tables I and II); these 32 genes are shown in Figure 4.

Table 1.

Comparison of Vκ repertoires between subsets

Mouse Group Comparison B cell Subset Comparison No. Vκ genes* represented Contribution to χ2† Top gene
No. genes contributing >5% No. genes contributing 50% Top gene contributes (%) Top 3 genes contribute (%) Top 5 genes contribute (%) Top 10 genes contribute (%)
YF T1 vs FO 32 6 7 15.1 30.2 40.2 60.6 3_4*01
YF MZ vs FO 25 5 4 23.4 44.3 61.2 78.8 12_46*01
OF T1 vs FO 41 5 8 10.2 23.7 35.9 56.5 12_46*01
OF MZ vs FO 31 3 2 46.3 57.7 64.8 77.8 12_46*01
OF FO vs GC 24w 37 5 7 15.1 34.0 45.1 61.2 5_43/5*01‡
OF FO vs GC 56w 33 6 4 23.8 49.0 60.3 80.8 5_48*01
OF FO vs GC IFN 36 8 8 8.9 23.4 35.5 62.1 13_85*01
OF GC 24w vs GC IFN 37 4 8 13.3 30.0 39.9 57.5 6_23*01
YF vs OF T1 35 2 14 10.1 19.9 27.3 40.2 3_10*01
YF vs OF T2/MZP 27 7 5 14.6 37.1 51.7 74.9 3_2*01
YF vs OF MZ 20 7 5 13.8 35.2 54.3 79.9 1_99*01
YF vs OF FO 29 8 5 17.7 38.1 53.1 78.7 10_94*01
YM T1 vs FO 37 5 8 12.9 27.7 40.2 57.9 12_46*01
YM MZ vs FO 30 3 3 40.8 55.3 63.9 76.1 12_46*01
OM T1 vs FO 31 7 7 11.5 29.8 42.4 65.4 12_46*01
OM MZ vs FO 34 6 5 18.2 38.5 54.4 73.4 12_46*01
OM FO vs GC 24w 38 6 6 17.1 32.9 44.9 63.9 5_43/5*01‡
OM FO vs GC 56w 37 7 5 21.0 38.2 51.7 71.9 5_43/5*01‡
YM vs OM T1 33 5 9 9.3 24.0 35.2 57.8 1_99*01
YM vs OM T2/MZP 25 5 7 17.9 34.2 44.5 65.2 3_4*01
YM vs OM MZ 32 4 9 11.3 25.5 35.8 54.1 12_46*01
YM vs OM FO 30 7 6 11.6 34.7 49.2 72.3 6_25*01
YF vs YM T1 36 5 7 11.6 29.2 42.9 60.5 3_10*01
YF vs YM T2/MZP 23 6 6 14.1 35.7 48.8 72.7 8_19*01
YF vs YM MZ 21 6 6 10.9 32.7 48.9 73.0 3_12*01
YF vs YM FO 30 5 8 11.3 27.9 39.9 60.1 3_4*01
OF vs OM T1 39 2 11 12.6 23.6 32.3 48.1 1_99*01
OF vs OM T2/MZP 39 6 4 18.1 39.8 61.4 83.2 3_4*01
OF vs OM MZ 30 7 7 13.5 30.0 42.1 63.9 12_46*01
OF vs OM FO 30 6 6 11.8 30.1 44.6 66.5 16_104*01
OF vs OM GC 24w 39 4 10 8.7 23.9 33.7 51.2 4_57-1*01
OF vs OM GC 56w 32 2 4 34.7 47.8 56.1 72.3 5_48*01
Open in a new tab
*

in the two subsets being compared

†

See Figure 4 for specific genes

‡

All GC sequences use Vκ43*01

Y: Young (8w); O: Old (24 or 52w); F: female; M: male

B cell subsets: T1: transitional type 1; T2/MZP: transitional type 2 and marginal zone precursors; MZ: marginal zone; FO: follicular; GC: germinal center

Figure 4.

Figure 4

Open in a new tab

Repertoire analysis of 3H9-associated Vκ chains in aged male (A) and female (B) NZW/BXSB mice. Genes that contribute >5% of the χ2 value and constitute >2.5% of the repertoire in any of the comparisons are shown. 39–93 sequences from 3–6 mice were analyzed per subset. The y axis shows percent of the total repertoire for each subset. The complete dataset is shown in Supplementary Tables I and II.

Our first major observation was that the T2-MZ precursor and marginal zone compartments of both males (Figure 4A) and females (Figure 4B) had a highly restricted light chain repertoire with overrepresentation of the Vκ12-46/Jκ2 gene that constituted 30–50% of the repertoire in males and 50–60% in females. This gene was under-represented in the follicular region of both males and females, suggesting that recruitment of MZ B cells into the follicular compartment was not the reason for loss of the marginal zone that occurred in males with age. Furthermore, B cells using Vκ12-46/Jκ2 were not recruited into the germinal centers and did not appear among IgG autoreactive hybridomas indicating that activation and maturation of these cells was not responsible for the loss of tolerance that occurred with age.

Our second major observation was that the germinal center repertoire was also highly restricted in both males and females, with vast overrepresentation of light chain genes from the Vκ5 family, particularly Vκ5-43/5-45 (that differ by only two amino acids, one in FR1 and one in CDR1) and Vκ5-48 (Figure 4). Subsequent PCR and sequencing of the full length light chains from GC B cells showed that all of the Vκ5-43/5-45 encoded light chains used Vκ5-43. Vκ5 encoded light chains were rare in the naïve B cell compartment of both males and females, indicating strong positive selection/clonal expansion of B cells expressing these light chains in the germinal center. Because Vκ5-43, Vκ5-45 and Vκ5-48 were also represented among autoreactive hybridomas, we examined the Jκ regions of GC B cells and hybridomas using these light chains; the Jκ contributes variability to the light chain CDR3. For Vκ5-43 we found that males predominantly used Jκ5, whereas females used Jκ4 and Jκ2. Importantly, 13/14 autoreactive Vκ5-43 encoded hybridomas as well as the single Vκ5-45 encoded autoreactive hybridoma used the “male” Jκ5 with the germline Leu at the CDR3/Jκ junction as in the germinal centers (Figure 5A). For Vκ5-48, males used either Jκ4 or Jκ2 whereas females used Jκ5 almost exclusively. The few autoreactive Vκ5-48 hybridomas generated from males used either Jκ2 or Jκ4 whereas those from females used Jκ5 (Figure 5B).

The light chain repertoire of GC B cells from IFN treated females was more diverse than that of untreated females but still included Vκ5 family members. Importantly, most GC derived Vκ5-43 encoded genes from IFN treated females used the “male” Jκ5 and GC derived Vκ5-48 genes predominantly used the “male” Jκ2 and Jκ4 (Figure 5). Thus the administration of IFNα to females results in altered germinal center selection.

Autospecificity of reconstituted antibodies

To analyze the DNA binding characteristics of the germline encoded 3H9 encoded antibodies that were being selected into the various B cell subsets and into the germinal centers we cotransfected the 3H9 heavy chain using an IgG2a Fc together with germline encoded light chains of interest and the most commonly associated Jκ into 293T cells. 12 light chains from the 32 displayed in Figure 4 and one additional light chain represented among hybridomas from males were chosen for the transfection experiments. For some light chains, including Vκ5-43, Vκ5-45 and Vκ5-48, more than one Jκ region was used. On screening, 7 of the 13 light chains (Vκ1-110, 4-57, 5-43, 5-45, 5-48, 10-94, 12-46) conferred autoreactivity in the germline configuration, with variable binding to the three autoantigens; Vκ1-117, 3-4, 3-12, 4-55, 13-85, 16-104 displayed no reactivity with any of the antigens tested. The autoreactive transfectants were then subjected to treatment with DNAse and purification on Protein A using high salt to dissociate immune complexes.

Several of the autoreactive light chains were of particular interest (Figure 6). Vκ12-46*01/Jκ2, that was found frequently in the T2-MZP and MZ compartments but was negatively selected in the FO compartment and was only rarely found in the germinal centers, conferred weak binding to chromatin and histones. Vκ4-57*01, that reacted only with CL, was found in the GCs of females but not of males. Vκ1-110*01, that was strongly reactive to both DNA and CL was found rarely in the mature repertoire and in germinal centers but was captured among hybridomas derived from males. Only one of the transfectants, 3H9/Vκ10-94, displayed polyreactivity (not shown).

Figure 6.

Figure 6

Open in a new tab

Binding characteristics of reconstituted germline encoded heavy and non-Vκ5 light chain pairs compared with 5 representative autoreactive hybridomas (see Supplementary Table III). Reconstituted antibodies were adjusted to a concentration of 2ug/ml and hybridomas to 1ug/ml and were tested for binding to the antigens shown by ELISA. The light chain Vκ genes associated with the 3H9 heavy chain in each H/L pair are shown on the x-axis.

Strikingly, for antibodies using Vκ5 encoded light chains we found that the antigenic specificity was highly dependent on the Jκ used. For Vκ5-43, Jκ5, the most common Jκ in males, conferred low titer anti-CL activity and anti-histone activity and high titer anti-chromatin activity but not anti-DNA activity, whereas the “female” Jκ2 and Jκ4 did not bind histone and conferred lower titers of anti-CL and anti-chromatin specificity (Figure 7A). Since most of the Vκ5-43 encoded hybridomas were DNA binding, acquisition of this autoreactive specificity as well as of high titer anti-CL activity can therefore be attributed to somatic mutation (Supplementary Table III). For Vκ5-48 the highest titer autoreactivity to chromatin was conferred by the “male” Jκ4 with weak autoreactivity to dsDNA conferred by the “male” Jκ2 and only minimal autoreactivity conferred by the “female” Jκ5 (Figure 7B). Vκ5-45, that was selected only rarely, was highly autoreactive with dsDNA and chromatin regardless of the Jκ, but had the highest binding to cardiolipin when associated with Jκ5 (Figure 7C). The one autoreactive hybridoma encoded by this light chain had only a single somatic mutation in the heavy chain (Supplementary Table III). Thus the male mice have a defect in tolerance in the GC that allows both entry and expansion of autoreactive clones that recognize dsDNA, chromatin and cardiolipin. Survival of clones that acquire autoreactivity as a result of somatic mutation is also dysregulated in the males. Tolerance to DNA at both these checkpoints is maintained in females < 1 year of age but eventually, females lose tolerance as a result of failure to regulate B cells that have acquired autoreactivity as a result of somatic mutation. Finally, tolerance at the GC entry checkpoint can be broken in females by the administration of IFNα.

Figure 7.

Figure 7

Open in a new tab

Binding characteristics of Vκ5 encoded light chains vary with Jκ usage. Serial dilutions of each heavy and light chain pair after DNAse digestion and Protein A purification were tested for the reactivity with dsDNA, ssDNA, CL, histones and chromatin by ELISA. A: 3H9/Vκ5-43; B: 3H9/Vκ5-48; C: 3H9/Vκ5-45.

Of the non-autoreactive light chains, Vκ3-4*01 and Vκ3-12*01/Jκ2 were found in the GCs, particularly in IFNα treated females but they were not as frequent as Vκ5-43 encoded light chains and were not represented among the hybridoma panel.

Hybridomas

Hybridomas were generated from 7 males (>8 months of age) and 4 females (>12 months of age). Approximately two times as many hybridomas were generated per fusion from males as from females (p < 0.02) and the percentage of autoreactive hybridomas per fusion was higher in males than in females (12.4 +/− 4.8% vs. 6.9 +/−3.2%; p = 0.07). 42 and 187 stable autoreactive hybridomas were generated from female and male mice respectively. 21% of the hybridomas bound only dsDNA, 10% bound only CL and 69% bound to both antigens; this distribution was similar in hybridomas from males and females, however IgG hybridomas were more commonly found in males (72% vs 30% p < 0.0001). 32 anti-dsDNA and/or anti-CL IgG randomly selected hybridomas from 3 different male fusions and one aged female fusion were subcloned and the heavy and light chain sequences obtained using PCR. Six of these used VH1 genes other than the 3H9 encoded VH1-82 and three used the 3H9 heavy chain but expressed more than one light chain after multiple subcloning attempts. As observed in germinal centers, the remaining 23 hybridomas had a highly restricted repertoire with predominant use of Vκ5 light chains, consistent with that of the germinal centers. Mutation analysis revealed that both the heavy and light chains of the germinal center B cells and the hybridomas were highly mutated, accounting for the diverse binding characteristics of hybridomas using the same heavy and light chain genes (Supplementary table III). After treatment with DNAse and purification under high salt conditions, antigenic specificity was retained, with considerable variability in binding to the 4 autoantigens tested, conferred by somatic mutations (Supplementary Table III). Binding characteristics of several representative hybridomas are shown in Figure 6.

DISCUSSION

The purpose of these experiments was to analyze mechanisms for loss of tolerance to CL and DNA in NZW/BXSB mice that develop anti-phospholipid antibodies and coronary artery thromboses and nephritis as part of their disease phenotype. We show here that male 3H9 NZW/BXSB mice that carry the Yaa locus develop autoantibodies earlier and in higher titer than females but that females can be induced to produce these antibodies by a low dose of adenovirus secreting IFNα.

The VH3H9 heavy chain used in these studies was isolated from an anti-DNA antibody spontaneously produced in MRL/lpr mice; the heavy chain is a member of the J778 family and the accompanying light chain is from the Vκ4 gene family (Vκ4-81*01). 3H9 can also pair with a wide variety of V light chains; approximately 60% of light chains that associate with 3H9 are permissive for autoreactivity to DNA or cardiolipin (10). Tolerance in non-autoimmune 3H9 mice is maintained by receptor editing of both the heavy (22) and light chains to yield a less autoreactive naïve repertoire (10, 23), by follicular exclusion of autoreactive B cells (24) and by negative selection of autoreactive B cells in the germinal centers (25). In contrast, pathogenic anti-dsDNA antibodies using a wide variety of light chains are detected among spontaneous IgG hybridomas from 3H9 transgenic lupus prone mice (11).

In non-autoimmune C57BL/6 site directed transgenic 3H9 mice, in which class switching and somatic mutations can occur, Vκ12-46 rearranged to Jκ2, is the dominant light chain used by LPS induced hybridomas (26). One of the problems with using LPS induction to study the naïve light chain repertoire is that hybridomas may preferentially reflect the repertoire of marginal zone B cells that are more rapidly activated by 3 days of treatment with LPS than are follicular B cells (27). Indeed, when the unbiased Vκ repertoire of pooled IgM positive B cells from non-autoimmune 3H9 sdtg mice was examined using PCR, Vκ19-93, an editing light chain, was the dominant light chain used (28). Using single cell PCR of separated naïve B cell subsets from SLE prone NZW/BXSB mice we show that Vκ12-46 is relatively confined to the marginal zone of both male and female NZW/BXSB mice whereas the original 3H9 light chain Vκ4-81 and the C57BL/6 dominant Vκ19-93 are not represented in the naïve subsets. These findings indicate major shifts of the naïve B cell repertoire in the autoimmune NZW/BXSB strain compared with C57BL/6. A similar skewing of the light chain repertoire away from Vκ19-93 has been reported in 3H9 C57BL/6 mice that are transgenic for BAFF (28).

Despite the enlarged marginal zone in males and females and the relative loss of the marginal zone in males with age, the marginal zone dominant light chain Vκ12-46/Jκ2, that confers weak chromatin binding, was not significantly represented in follicles or in the germinal centers or among hybridomas from male NZW/BXSB mice. These data are consistent with previous studies suggesting that presence of the Yaa locus causes an intrinsic developmental defect in marginal zone B cell development (29). Furthermore our findings conclusively show that autoreactive effector cells that are generated in the germinal centers of male mice as a result of the Yaa translocation, or are captured as hybridomas, are not derived from the major subpopulation of autoreactive B cells in the marginal zone.

We further show that the loss of tolerance in NZW/BXSB males is due predominantly to germinal center expansion of B cells bearing Vκ5 encoded light chains. In non-autoimmune mice, germline encoded autoreactive B cells are usually excluded from participating in the germinal center (GC) reaction (30) or are regulated within the GC before they clonally expand (31). B cells that newly acquire self reactivity within the GC are removed from the effector repertoire by engagement with soluble self-antigen, by failure to obtain cognate help from T cells, by other unidentified checkpoints within the GC, or by post-GC receptor editing (32–33).

We show here that a significant proportion of 3H9/Vκ5 encoded B cells is autoreactive in the germline configuration; these cells are uncommon in the naïve B cell repertoire of both males and females. They are however selected in the germinal center with exquisite specificity at the level of the V region and the Vκ-Jκ junction such that higher affinity autoreactive B cells are positively selected in males but only low affinity autoreactive B cells are selected in females. Thus abnormal germinal center entry and expansion of rare high affinity germline encoded autoreactive B cells is conferred by the presence of the Yaa locus and/or the consequent activated state of lymphocytes. In the case of the male W/B mouse this tolerance defect occurs spontaneously but, as we show here, a similar loss of tolerance in females with a shift in germinal selection from the Vκ5 encoded “female” pattern of Vκ/Jκ genes to the “male” pattern of Vκ5-43/Jκ5 and Vκ5-48/Jκ4, can result from the extrinsic administration of IFNα that has multiple effects on innate and adaptive immune responses including germinal center responses (34–40). In addition the Vκ5 encoded antibodies found in the germinal centers and among hybridomas have accumulated somatic mutations that can be associated with acquisition of DNA binding and an increase in affinity for other autoantigens. Thus the Yaa translocation is also associated with early failure of regulation of high affinity somatically mutated autoantibody producing B cells. This defect also eventually occurs in aged females.

Most of the SLE phenotype of the Yaa locus is associated with two fold overexpression of the Tlr7 gene (41–42) and is conferred by the expression of Yaa in B cells (43). Exogenous administration of IFNα can also enhance expression of TLR7 in B cells and this is required for initiation of SLE by pristane in non-autoimmune mouse strains (44). Our data in sum show that both expression of the Yaa locus and exogenous administration of IFNα result in failure of exclusion of high affinity autoreactive B cells from the germinal center, with subsequent clonal expansion of these cells, and failure to regulate autoreactive cells generated as a consequence of somatic mutation. Our data suggest that inhibition of IFNα signals or of TLR7 signaling in B cells could regulate selection of the antigen activated B cell repertoire and prevent the generation of high affinity pathogenic autoantibodies. This hypothesis can be tested in the context of human clinical trials.

Supplementary Material

1
2
3

References

  • 1.Marshak-Rothstein A, Rifkin IR. Immunologically active autoantigens: the role of toll-like receptors in the development of chronic inflammatory disease. Annu Rev Immunol. 2007;25:419–441. doi: 10.1146/annurev.immunol.22.012703.104514. [DOI] [PubMed] [Google Scholar]
  • 2.Flesher DL, Sun X, Behrens TW, Graham RR, Criswell LA. Recent advances in the genetics of systemic lupus erythematosus. Expert Rev Clin Immunol. 2010;6:461–479. doi: 10.1586/eci.10.8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Christensen SR, Shupe J, Nickerson K, Kashgarian M, Flavell RA, Shlomchik MJ. Toll-like receptor 7 and TLR9 dictate autoantibody specificity and have opposing inflammatory and regulatory roles in a murine model of lupus. Immunity. 2006;25:417–428. doi: 10.1016/j.immuni.2006.07.013. [DOI] [PubMed] [Google Scholar]
  • 4.Subramanian S, Tus K, Li QZ, Wang A, Tian XH, Zhou J, Liang C, Bartov G, McDaniel LD, Zhou XJ, Schultz RA, Wakeland EK. A Tlr7 translocation accelerates systemic autoimmunity in murine lupus. Proc Natl Acad Sci U S A. 2006;103:9970–9975. doi: 10.1073/pnas.0603912103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Pisitkun P, Deane JA, Difilippantonio MJ, Tarasenko T, Satterthwaite AB, Bolland S. Autoreactive B cell responses to RNA-related antigens due to TLR7 gene duplication. Science. 2006;312:1669–1672. doi: 10.1126/science.1124978. [DOI] [PubMed] [Google Scholar]
  • 6.Deane JA, Pisitkun P, Barrett RS, Feigenbaum L, Town T, Ward JM, Flavell RA, Bolland S. Control of toll-like receptor 7 expression is essential to restrict autoimmunity and dendritic cell proliferation. Immunity. 2007;27:801–810. doi: 10.1016/j.immuni.2007.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kahn P, Ramanujam M, Bethunaickan R, Huang W, Tao H, Madaio MP, Factor SM, Davidson A. Prevention of murine antiphospholipid syndrome by BAFF blockade. Arthritis Rheum. 2008;58:2824–2834. doi: 10.1002/art.23764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ramanujam M, Kahn P, Huang W, Tao H, Madaio MP, Factor SM, Davidson A. Interferon-alpha treatment of female (NZW x BXSB)F(1) mice mimics some but not all features associated with the Yaa mutation. Arthritis Rheum. 2009;60:1096–1101. doi: 10.1002/art.24414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Steeves MA, Marion TN. Tolerance to DNA in (NZB x NZW)F1 mice that inherit an anti-DNA V(H) as a conventional micro H chain transgene but not as a V(H) knock-in transgene. J Immunol. 2004;172:6568–6577. doi: 10.4049/jimmunol.172.11.6568. [DOI] [PubMed] [Google Scholar]
  • 10.Radic MZ, Mascelli MA, Erikson J, Shan H, Weigert M. Ig H and L chain contributions to autoimmune specificities. J Immunol. 1991;146:176–182. [PubMed] [Google Scholar]
  • 11.Li Y, Li H, Ni D, Weigert M. Anti-DNA B cells in MRL/lpr mice show altered differentiation and editing pattern. J Exp Med. 2002;196:1543–1552. doi: 10.1084/jem.20021560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chen C, Prak EL, Weigert M. Editing disease-associated autoantibodies. Immunity. 1997;6:97–105. doi: 10.1016/s1074-7613(00)80673-1. [DOI] [PubMed] [Google Scholar]
  • 13.Liu Z, Bethunaickan R, Huang W, Lodhi U, Solano I, Madaio MP, Davidson A. Interferon-alpha accelerates murine systemic lupus erythematosus in a T cell-dependent manner. Arthritis Rheum. 2011;63:219–229. doi: 10.1002/art.30087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ramanujam M, Wang X, Huang W, Liu Z, Schiffer L, Tao H, Frank D, Rice J, Diamond B, Yu KO, Porcelli S, Davidson A. Similarities and differences between selective and nonselective BAFF blockade in murine SLE. J Clin Invest. 2006;116:724–734. doi: 10.1172/JCI26385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ramanujam M, Wang X, Huang W, Schiffer L, Grimaldi C, Akkerman A, Diamond B, Madaio MP, Davidson A. Mechanism of action of transmembrane activator and calcium modulator ligand interactor-Ig in murine systemic lupus erythematosus. J Immunol. 2004;173:3524–3534. doi: 10.4049/jimmunol.173.5.3524. [DOI] [PubMed] [Google Scholar]
  • 16.Wardemann H, Yurasov S, Schaefer A, Young JW, Meffre E, Nussenzweig MC. Predominant autoantibody production by early human B cell precursors. Science. 2003;301:1374–1377. doi: 10.1126/science.1086907. [DOI] [PubMed] [Google Scholar]
  • 17.Huang W, Moisini I, Bethunaickan R, Sahu R, Akerman M, Eilat D, Lesser M, Davidson A. BAFF/APRIL Inhibition Decreases Selection of Naive but Not Antigen-Induced Autoreactive B Cells in Murine Systemic Lupus Erythematosus. J Immunol. 2011;187:6571–6580. doi: 10.4049/jimmunol.1101784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Tiller T, Busse CE, Wardemann H. Cloning and expression of murine Ig genes from single B cells. J Immunol Methods. 2009;350:183–193. doi: 10.1016/j.jim.2009.08.009. [DOI] [PubMed] [Google Scholar]
  • 19.Mihara M, Tan I, Chuzhin Y, Reddy B, Budhai L, Holzer A, Gu Y, Davidson A. CTLA4Ig inhibits T cell-dependent B-cell maturation in murine systemic lupus erythematosus. J Clin Invest. 2000;106:91–101. doi: 10.1172/JCI9244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ramanujam M, Bethunaickan R, Huang W, Tao H, Madaio MP, Davidson A. Selective blockade of BAFF for the prevention and treatment of systemic lupus erythematosus nephritis in NZM2410 mice. Arthritis Rheum. 2010;62:1457–1468. doi: 10.1002/art.27368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Guth AM, Zhang X, Smith D, Detanico T, Wysocki LJ. Chromatin specificity of anti-double-stranded DNA antibodies and a role for Arg residues in the third complementarity-determining region of the heavy chain. J Immunol. 2003;171:6260–6266. doi: 10.4049/jimmunol.171.11.6260. [DOI] [PubMed] [Google Scholar]
  • 22.Chen C, Nagy Z, Prak EL, Weigert M. Immunoglobulin heavy chain gene replacement: a mechanism of receptor editing. Immunity. 1995;3:747–755. doi: 10.1016/1074-7613(95)90064-0. [DOI] [PubMed] [Google Scholar]
  • 23.Ibrahim SM, Weigert M, Basu C, Erikson J, Radic MZ. Light chain contribution to specificity in anti-DNA antibodies. J Immunol. 1995;155:3223–3233. [PubMed] [Google Scholar]
  • 24.Mandik-Nayak L, Bui A, Noorchashm H, Eaton A, Erikson J. Regulation of anti-double-stranded DNA B cells in nonautoimmune mice: localization to the T-B interface of the splenic follicle. J Exp Med. 1997;186:1257–1267. doi: 10.1084/jem.186.8.1257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Radic MZ, Erikson J, Litwin S, Weigert M. B lymphocytes may escape tolerance by revising their antigen receptors. J Exp Med. 1993;177:1165–1173. doi: 10.1084/jem.177.4.1165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Li H, Jiang Y, Cao H, Radic M, Prak EL, Weigert M. Regulation of anti- phosphatidylserine antibodies. Immunity. 2003;18:185–192. doi: 10.1016/s1074-7613(03)00026-8. [DOI] [PubMed] [Google Scholar]
  • 27.Snapper CM, Yamada H, Smoot D, Sneed R, Lees A, Mond JJ. Comparative in vitro analysis of proliferation, Ig secretion, and Ig class switching by murine marginal zone and follicular B cells. J Immunol. 1993;150:2737–2745. [PubMed] [Google Scholar]
  • 28.Ota M, Duong BH, Torkamani A, Doyle CM, Gavin AL, Ota T, Nemazee D. Regulation of the B Cell Receptor Repertoire and Self-Reactivity by BAFF. J Immunol. 2010;185:4128–4136. doi: 10.4049/jimmunol.1002176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Amano H, Amano E, Moll T, Marinkovic D, Ibnou-Zekri N, Martinez-Soria E, Semac I, Wirth T, Nitschke L, Izui S. The Yaa mutation promoting murine lupus causes defective development of marginal zone B cells. J Immunol. 2003;170:2293–2301. doi: 10.4049/jimmunol.170.5.2293. [DOI] [PubMed] [Google Scholar]
  • 30.Goodnow CC. Multistep pathogenesis of autoimmune disease. Cell. 2007;130:25–35. doi: 10.1016/j.cell.2007.06.033. [DOI] [PubMed] [Google Scholar]
  • 31.Paul E, Lutz J, Erikson J, Carroll MC. Germinal center checkpoints in B cell tolerance in 3H9 transgenic mice. Int Immunol. 2004;16:377–384. doi: 10.1093/intimm/dxh035. [DOI] [PubMed] [Google Scholar]
  • 32.Goodnow CC, Vinuesa CG, Randall KL, Mackay F, Brink R. Control systems and decision making for antibody production. Nat Immunol. 2010;11:681–688. doi: 10.1038/ni.1900. [DOI] [PubMed] [Google Scholar]
  • 33.Wang YH, Diamond B. Receptor Revision Diminishes the Autoreactive B Cell Response after Antigen Activation. J Clin Invest. 2008;118:2896–2907. doi: 10.1172/JCI35618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Le Bon A, Schiavoni G, D’Agostino G, Gresser I, Belardelli F, Tough DF. Type i interferons potently enhance humoral immunity and can promote isotype switching by stimulating dendritic cells in vivo. Immunity. 2001;14:461–470. doi: 10.1016/s1074-7613(01)00126-1. [DOI] [PubMed] [Google Scholar]
  • 35.Le Bon A, Thompson C, Kamphuis E, Durand V, Rossmann C, Kalinke U, Tough DF. Cutting edge: enhancement of antibody responses through direct stimulation of B and T cells by type I IFN. J Immunol. 2006;176:2074–2078. doi: 10.4049/jimmunol.176.4.2074. [DOI] [PubMed] [Google Scholar]
  • 36.Cucak H, Yrlid U, Reizis B, Kalinke U, Johansson-Lindbom B. Type I interferon signaling in dendritic cells stimulates the development of lymph-node-resident T follicular helper cells. Immunity. 2009;31:491–501. doi: 10.1016/j.immuni.2009.07.005. [DOI] [PubMed] [Google Scholar]
  • 37.Herlands RA, William J, Hershberg U, Shlomchik MJ. Anti-chromatin antibodies drive in vivo antigen-specific activation and somatic hypermutation of rheumatoid factor B cells at extrafollicular sites. Eur J Immunol. 2007;37:3339–3351. doi: 10.1002/eji.200737752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Litinskiy MB, Nardelli B, Hilbert DM, He B, Schaffer A, Casali P, Cerutti A. DCs induce CD40-independent immunoglobulin class switching through BLyS and APRIL. Nat Immunol. 2002;3:822–829. doi: 10.1038/ni829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Mathian A, Weinberg A, Gallegos M, Banchereau J, Koutouzov S. IFN-alpha induces early lethal lupus in preautoimmune (New Zealand Black x New Zealand White) F1 but not in BALB/c mice. J Immunol. 2005;174:2499–2506. doi: 10.4049/jimmunol.174.5.2499. [DOI] [PubMed] [Google Scholar]
  • 40.Boule MW, Broughton C, Mackay F, Akira S, Marshak-Rothstein A, Rifkin IR. Toll-like Receptor 9-Dependent and -Independent Dendritic Cell Activation by Chromatin-Immunoglobulin G Complexes. J Exp Med. 2004;199:1631–1640. doi: 10.1084/jem.20031942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Fairhurst A-M, Hwang S, Wang A, Tian X-H, Boudreaux C, Zhou XJ, Casco J, Li Q-Z, Connolly JE, Wakeland EK. Yaa autoimmune phenotypes are conferred by overexpression of TLR7. European J Immunol. 2008 doi: 10.1002/eji.200838138. In press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Santiago-Raber M, Kijuchi S, Borel P, Uematsu S, Akira S, Kotzin B, Izui S. Evidence for Genes in Addition to Tlr7 in the Yaa Translocation Linked with Acceleration of Systemic Lupus Eryuthematosus. J Immunol. 2008 doi: 10.4049/jimmunol.181.2.1556. [DOI] [PubMed] [Google Scholar]
  • 43.Fossati L, Sobel ES, Iwamoto M, Cohen PL, Eisenberg RA, Izui S. The Yaa gene-mediated acceleration of murine lupus: Yaa- T cells from non-autoimmune mice collaborate with Yaa+ B cells to produce lupus autoantibodies in vivo. Eur J Immunol. 1995;25:3412–3417. doi: 10.1002/eji.1830251231. [DOI] [PubMed] [Google Scholar]
  • 44.Thibault DL, Chu AD, Graham KL, Balboni I, Lee LY, Kohlmoos C, Landrigan A, Higgins JP, Tibshirani R, Utz PJ. IRF9 and STAT1 are required for IgG autoantibody production and B cell expression of TLR7 in mice. J Clin Invest. 2008;118:1417–1426. doi: 10.1172/JCI30065. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS404831-supplement-1.docx (23.8KB, docx)
2
NIHMS404831-supplement-2.docx (24.3KB, docx)
3
NIHMS404831-supplement-3.doc (107KB, doc)

RESOURCES