Skip to main content
PLOS One logoLink to PLOS One
. 2012 Oct 23;7(10):e47690. doi: 10.1371/journal.pone.0047690

Inhibition of Cell Division Induced by External Guide Sequences (EGS Technology) Targeting ftsZ

Carol Davies Sala 1, Alfonso J C Soler-Bistué 1,2,¤, Leeann Korprapun 1,2, Angeles Zorreguieta 1,*, Marcelo E Tolmasky 2,*
Editor: Anne Wertheimer3
PMCID: PMC3479136  PMID: 23110089

Abstract

EGS (external guide sequence) technology is a promising approach to designing new antibiotics. EGSs are short antisense oligoribonucleotides that induce RNase P-mediated cleavage of a target RNA by forming a precursor tRNA-like complex. The ftsZ mRNA secondary structure was modeled and EGSs complementary to two regions with high probability of being suitable targets were designed. In vitro reactions showed that EGSs targeting these regions bound ftsZ mRNA and elicited RNase P-mediated cleavage of ftsZ mRNA. A recombinant plasmid, pEGSb1, coding for an EGS that targets region “b” under the control of the T7 promoter was generated. Upon introduction of this plasmid into Escherichia coli BL21(DE3)(pLysS) the transformant strain formed filaments when expression of the EGS was induced. Concomitantly, E. coli harboring pEGSb1 showed a modest but significant inhibition of growth when synthesis of the EGSb1 was induced. Our results indicate that EGS technology could be a viable strategy to generate new antimicrobials targeting ftsZ.

Introduction

Bacterial cell division is a complex process that occurs following the replication and segregation of chromosomal DNA to the two halves of the growing cell. In the case of Gram negative bacteria, the division process requires at least 14 cytoplasmic, membrane and periplasmic proteins, of which 10 are essential [1][5]. These proteins form a structure known as the divisome, a ring-like cell division complex located at midcell that constricts during division and disappears when the cells separate [1][5]. Assembly of the divisome starts with the formation of the proto-ring, a complex formed by FtsZ, FtsA, and ZipA, and continues with the assembly of other proteins and protein complexes [6], [7]. The temporal events of the assembly of the divisome have recently been established with high resolution in Caulobacter crescentus [8]. The most conserved of all known bacterial cell division genes is the proto-ring protein FtsZ, which functions as scaffold for the divisome and generates the constrictive force to initiate division of the cell [6], [9], [10]. These properties, together with the fact that it does not share significant sequence similarity to the eukaryotic cytoskeletal protein tubulin made FtsZ an ideal choice as target for drug discovery [11]. Numerous reports have been published proposing novel cell division inhibitors that act by blocking FtsZ and hold high therapeutic potential but none of them have been fully developed and released to the market to date [11][18].

A promising approach to design new antimicrobial agents is based on the properties of the ribozyme RNase P, a ribonucleoprotein composed of an RNA component (M1) that is the catalytic subunit and a cofactor protein (C5). RNase P plays an essential role in the cell by directing maturation of RNA species by precise cleavage of molecules such as precursor t-RNAs or some polycistronic mRNAs [19]. The finding that RNase P can be induced to digest target RNA molecules that are not natural substrates by addition of an appropriate complementary oligoribonucleotide, known as “external guide sequence” (EGS), led to development of what is known as EGS technology [20]. For efficient degradation of the target RNA, the EGS must form a duplex that results in the appropriate stem-like structure required to serve as substrate of RNase P [21]. EGS technology has been used to inhibit expression of several genes coding for essential housekeeping functions, virulence factors, and antibiotic resistance enzymes [20], [22][29]. In the first demonstration that EGSs could be used to turn off bacterial genes, oligoribonucleotides encoded by plasmids elicited about 50% reduction in expression levels of β-galactosidase and alkaline phosphatase [30]. Later on, phenotypic conversion to susceptibility was shown targeting resistance genes such as cat, bla, and aac(6′)-Ib in E. coli [26][28]. Examples of essential and virulence genes whose expression has been successfully reduced by using EGS technology are the E. coli gyrA and rnpA genes [25], the Salmonella Typhimurium invB and invC genes, which resulted in diminished secretion of proteins that are exported using the type III secretion system and impairment of the ability to invade host cells [24], the Francisella tularensis mglB gene [22], and the Yersinia pestis yscN, and yscS genes [23]. In the present study we designed an EGS complementary to the Escherichia coli ftsZ mRNA that interferes with cell division.

Materials and Methods

Bacterial Strains and Plasmids

E. coli BL21(DE3)(pLysS) F dcm ompT hsdS(rB mB ) gal λ(DE3) pLysS [31] was used as host for the recombinant plasmids coding for the EGSs. E. coli DH5α was used for regular cloning experiments. Bacterial cultures were carried out in Lennox Luria (L) broth [32]. Recombinant plasmids pEGSb1 and pEGSb1S were generated by inserting a DNA fragment including the T7 promoter (GCGAAATTAATACGACTCACTATAGGG) followed by the EGS sequence (EGSb1 or EGSb1S) (Table 1), the consensus ACCA sequence, a hammerhead core [30], and a T7 terminator sequence (TAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG) into the XbaI and BamHI sites of the cloning vehicle pUC57 (GenBank/EMBL accession no. Y14837).

Table 1. EGS sequences.

EGS name Sequence ftsZ region targeted
EGSa1 AUAGUGAUCAGAGACCA 697–709
EGSa2 GAUAGUGAUCAGAGAACCA 696–710
EGSb1 CCGUUUCGAACUCACCA 1041–1053
EGSb1S GAGUUCGAAACGGACCA Not applicable (control)
EGSAP AGGCATCTATACCACCA Not applicable (control)

EGSAP targets the phoA gene. EGSb1S is the sequence complementary to EGSb1.

General Procedures

Plasmid DNA preparations were carried out using the Wizard® Plus SV Minipreps DNA Purification System (Promega). Polymerase chain reactions (PCR) were carried out using the HotStar Taq master mix kit (QIAGEN). All endonuclease restriction and ligase treatments were performed according to the supplier’s recommendations (New England Biolabs). In vitro synthesis of RNA molecules to generate the ftsZ mRNA was done using a MEGAshortscript high-yield transcription T7 kit (Life Technologies) according to the protocols provided by the supplier. RNase P was prepared by mixing in vitro synthesized M1 RNA and purified C5 as described previously [28]. Denaturing polyacrylamide gel electrophoresis (PAGE) was performed as described previously [33] on 6% polyacrylamide 16∶1 (acrylamide-bis-acrylamide) gels using a glycerol-tolerant gel (GTG) buffer containing, 7 M urea, 89 mM Tris, 29 mM taurine, and 0.5 mM EDTA (USB Corp.). Electrophoretic mobility shift assays were carried out using 6% polyacrylamide native (non-denaturing) gels prepared with TBE buffer (89 mM Tris Base, 89 mM boric acid, 2 mM EDTA pH 8.0) [33]. Radioactivity was visualized using a STORM 840 PhosphorImager (Molecular Dynamics). M1 RNA, ftsZ mRNA, and C5 protein were synthesized or purified as described before [28]. Oligoribonucleotides were obtained from a commercial source (IDT Technologies). The computer-predicted secondary structure of the ftsZ mRNA was generated by using the m-fold program (version 3.1) [34], [35].

In vitro RNase P Assays

The nucleotide sequences of the EGSs are shown in Table 1. EGSs were tested to determine their ability to elicit RNase P-mediated cleavage by preincubating 5′-end-radiolabeled ftsZ mRNA (0.25 pmol) and the EGS (50 pmol) at 25°C for 2 h in a volume of 3 µl before adding this mixture to a solution containing 2.5 pmol of M1 RNA, 70 pmol of C5 protein, 20 mM HEPES-KOH (pH 8.0), 400 mM ammonium acetate, 10 mM magnesium acetate, and 5% glycerol that had been preincubated at 37°C for 15 min in a final volume of 7 µl [36]. After combining both solutions the mix was incubated at 37°C for 90 minutes, the reaction was stopped by the addition of 1 volume of gel loading buffer, and analyzed by 6% denaturing GTG-PAGE as described before [27].

Binding Assays

Gel shift assays were carried out mixing 5′-end-labeled oligoribonucleotides (1 µM) with (1, 10, 100, or 500 ng) or without ftsZ mRNA in binding buffer (150 mM NaCl, 10 mM Tris-HCl pH 8.0, 1 mM EDTA) in a final volume of 10 µl. The mix was incubated for 1 h at 25°C and after addition of 10 µl of 10% glycerol and 4 µl of gel loading buffer the samples were analyzed on native TBE-PAGE (acrylamide-bisacrylamide [19∶1]).

In vivo Activities of EGSs

Each E. coli BL21(DE3)(pLysS) harboring a recombinant plasmid strain was cultured in L broth containing 100 µg/ml ampicillin and 20 µg/ml chloramphenicol at 37°C until the optical density at 600 nm (OD600) reached 0.15–0.2. At this moment expression of the EGS was induced by addition of 100 µM or 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and the culture was incubated for 60 or 90 minutes before the cells were examined by microscopy or were plated to determine colony forming units (CFU). For regular optical microscopy examination, the cells were spread on a slide, fixed by heat and stained with violet crystal (magnification 1000X). For laser scanning confocal microscopy bacteria were washed and resuspended in 20 µl saline buffer; then FM 5–95 was added to a final concentration of 6.5 µg/ml and placed on ice for 5 minutes. Cells were then poured on 2% agar, covered, and examined (magnification 400X). For CFU determination, cells in culture were serially diluted, spread on LB plates and colonies were counted after overnight incubation at 37 °C. The experiments were repeated 3 times (twice by sextuplicate and once by quadruplicate) and the results are expressed as mean log10(CFU/ml) ± SD. Statistical significance was analyzed by an unpaired two-tailed t-test. P<0.01 was considered statistically significant.

Results

In vitro EGS/ftsZ mRNA Binding and RNase P-mediated Cleavage of ftsZ mRNA

The E. coli ftsZ gene is located towards the distal end of the dcw cluster, a group of 16 genes involved in cell division and cell wall synthesis [37]. This cluster possesses a complex genetic organization and several promoters within the immediately upstream ddlB, ftsQ and ftsA genes as well as distant upstream promoters contribute to ftsZ expression (Figure 1) [38]. About one third of the ftsZ transcripts are originated at the promoters located closely upstream of this gene (Figure 1) [38][40]. Regardless of the promoter they are transcribed from, the bulk of the ftsZ encoding mRNAs are precisely processed by RNAse E at specific sites close to the location of translation initiation. Two species, originated at digestion sites E1 and E3, are required for appropriate cell division (Figure 1) [38], [40][44]. Therefore, to identify EGSs that elicit RNase P-mediated cleavage of the ftsZ mRNA we synthesized a molecule that includes 221 nucleotides of the 5′-UTR for our analysis.

Figure 1. Genetic organization of the relevant region of the dcw cluster.

Figure 1

The grey arrows represent genes, the black arrows represent mRNA molecules, and the white P inside a black circle represent locations of the promoters within ddlB, ftsQ, and ftsA. The long mRNAs originated at promoters upstream of ddlB are represented by a black arrow with arrowheads at the beginning. The diagram shows that about 1/3 of the transcription of ftsZ originates at the promoters located within ddlB, ftsQ, and ftsA and about 2/3 of the transcription is initiated at the far upstream promoters [38][40]. The E1 and E3 RNase E cleavage sites are indicated by curved arrows. The asterisk shows the RNA molecule utilized in this work to identify EGSs that elicit RNase P-mediated cleavage of the ftsZ mRNA [40]. The regions (“a” and “b”) used to design EGSs are shown in the same colors used in Figure 2.

We first identified regions within the ftsZ mRNA that may be accessible for interaction with complementary oligoribonucleotides by m-fold analysis (Figure 2A and Figure S1, the regions are also indicated in Figure 1). We selected two ftsZ mRNA regions containing numerous nucleotides that are predicted to have high probability of existing as single stranded and their structures resemble those we found in the past to be good candidates as EGSs (Figure 2B) (27,28). We then designed EGSs to target these regions; their sequences as well as the sequences of control EGSs are shown in Table 1. Electrophoretic mobility shift assays using the EGSs and ftsZ mRNA showed that all three EGSs targeting regions “a” or “b” bound the ftsZ mRNA (Figure 3A). The efficiency of these EGSs to elicit RNase P-mediated cleavage of ftsZ mRNA was determined in vitro incubating the oligoribonucleotides and labeled mRNA with the components of RNase P, M1 RNA and C5 protein. Figure 3B shows that both regions are efficient targets for RNase P in the presence of EGSa1, EGSa2, or EGSb1. All three EGSs induced significant cleavage of the ftsZ mRNA at the expected locations (Figure 3B). In the case of region “a” we tested two different sizes of the antisense portion of the EGSs: EGSa1, 13 nucleotides, and EGSa2, 15 nucleotides. No significant differences were observed in RNase P cleavage eliciting activity (Figure 3B). As expected, negative controls consisting of incubation in the absence of an EGS or RNase P, or in the presence of an EGS targeting the phoA gene showed no ftsZ mRNA-degradation activity (Figure 3B).

Figure 2. Secondary structure of ftsZ mRNA and regions targeted by EGSs.

Figure 2

A. Secondary structure of the ftsZ mRNA (nucleotides 105083–106456, accession number NC_000913.2) generated with m-fold software [34]. B. Zoom in the two regions selected as targets. Colors of the dots indicate the probability that they exist as single stranded. In decreasing order: red, orange, yellow, green, cyan, blue, violet and black. The sequences targeted by the EGSs are shown shadowed. EGSa2 includes an extra nucleotide at each end with respect to EGSa1, this is indicated by two short lines.

Figure 3. Analysis of the activity of EGSs.

Figure 3

A. Binding of EGSs to ftsZ mRNA. The oligoribonuclotides were 5′-end labeled, mixed with different amounts of ftsZ mRNA (from left to right 0, 1, 10, 100, or 500 ng) and analyzed by electrophoresis in 6% native polyacrylamide gel. B. RNase P-mediated cleavage of 32P-labeled ftsZ mRNA. The RNase P components, M1 RNA and C5 protein were preincubated at 37°C for 15 min, and a mix containing the radiolabeled ftsZ mRNA and the indicated EGS was preincubated 25°C for 2 h. After preincubation both solutions were combined, incubated at 37°C for 90 minutes, and analyzed on 6% denaturing PAGE. The location and size of the expected products of cleavage are shown to the left.

EGS-induced Filamentation

We selected EGSb1 to test its ability to interfere with cell division. We generated a recombinant plasmid with an insert that includes a T7 promoter followed by the EGSb1 coding region, the ACCA sequence, which enhances RNase P-substrate recognition; and a sequence required to generate a hammerhead ribozyme to generate the correct 3′ terminus of the EGSb1 by cis cleavage as described before [26]. E. coli BL21(DE3)(pLysS) was transformed with pEGSb1 or the control plasmid pEGSb1S, which codes for EGSb1S, whose sequence is complementary to EGSb1. IPTG was added to cultures in exponential growth phase followed by incubation for 60 or 90 minutes and cell analysis by microscopy. We consistently observed filamentation in the cultures of cells harboring pEGSb1 (Figure 4A). However, the proportion of filaments varied in different cultures. Although we still do not know the reason behind these differences, our results show a clear effect mediated by EGSb1 (see Figure 4A). Staining the filaments with FM5-95 suggested that the filaments are individual cells as no evidence of septa was detected (Figure 4B). Further experiments will permit us to confirm if there is complete or partial lack of septa. The CFU/ml were determined for cultures of both E. coli BL21(DE3)(pLysS) harboring pEGSb1 or pEGSb1S. Figure 4C shows that there was a significant reduction in the CFU/ml in the cultures of cells producing EGSb1 confirming that this EGS has a detrimental effect, most probably due to the observed inhibition of cell division.

Figure 4. Effect of EGSb1 on cell division.

Figure 4

A. The inducer IPTG (1 mM) was added to cultures of E. coli BL21(DE3)(pLysS) harboring the recombinant plasmids pEGSb1 or pEGSb1S when their OD600 reached 0.2. The cultures were then incubated for 60 more minutes and cells were examined by microscopy. B. Cells were stained with FM5-95 as described in Materials and Methods and examined by laser scanning confocal microscopy. C. Effect of the expression of EGSb1 or EGSb1S on cell survival. Results are expressed as log10 of mean CFU/ml ± SD. Similar results were observed in 3 independent assays. *: p<0.01.

Discussion

Antimicrobial resistance has been identified as one of the greatest threats to human health [45]. The quick increase in resistant strains observed among a number of bacterial pathogens together with the low number of candidate compounds existing in the pipeline warrant the need to look for alternatives to design new antibiotics [45], [46]. FtsZ has been proposed and used numerous times as target for developing new antimicrobials [12], [13], [15][17]. However, to our best knowledge EGS inhibition of expression had not been tried on this cell division gene. EGSs were designed to target two regions within the ftsZ mRNA and tested to determine their mRNA binding properties, as well as their efficiency to induce RNase P-mediated degradation in vitro. The EGSs that target regions “a” and “b” showed significant binding capabilities and ability to elicit RNase P-mediated degradation of the ftsZ mRNA. EGSb1 showed activity in vivo as the presence of pEGSb1 within E. coli resulted in filamentation upon addition of IPTG to the culture, a phenotype that was observed when other strategies were used to target FtsZ [12], [13], [47], [48]. As expected, induction of expression of EGSb1 also resulted in growth impairment. Although EGS technology is still at an early stage, development of appropriate EGSs that can inhibit expression of resistance genes [26][28] or act themselves as antibiotics [23][25], [29] could be a way to keep ahead of the race between availability of antibiotics and development of multiresistance. Here we show that EGSs could be developed to interfere with cell division. However, since recombinant clones coding for EGSs do not represent a realistic recourse for their practical application we are presently developing nuclease resistance alternatives with the EGSb1 sequence that will induce impairment of cell division through interference with proper FtsZ expression. We have recently shown that hybrid oligomers consisting on locked nucleic acids (LNA) and DNA residues (LNA/DNA) have activities comparable to those shown by isosequential oligoribonucleotides [27]. Another hurdle for reducing to practice the utilization of LNA/DNA EGSs as antibacterial treatment is the lack of a viable methodology for their uptake by bacterial cells. Some encouraging results have recently been reported on gymnotic delivery of LNA containing oligomers and cell internalization of oligonucleotides and analogs using strategies such as liposome encapsulation or attachment of cell-permeabilizing peptides to peptide nucleic acids or phosphorodiamidate morpholino oligomers [29], [49][52]. Unfortunately, attempts to conjugate cell-permeabilizing peptides to LNA/DNA oligomers have so far been unsuccessful, most probably due to the negatively charged nature of these compounds. However, other solutions such as gymnotic delivery [52][54] in appropriate conditions or co-administration with lipopeptide transfection agents remain to be explored [55][60].

In conclusion, the results shown in the present study indicate that, after overcoming existing stumbling blocks, the development of RNase P-mediated ftsZ mRNA degradation could contribute to the need for developing new antibiotics.

Supporting Information

Figure S1

ss count plot. The ss count plot is the propensity of a base to be single stranded as determined by the number of times it is single stranded in a group of predicted foldings, in this case 33, (http://mfold.rna.albany.edu/?q=mfold/documentation). To simplify the interpretation, the length of the untranslated region (black bar) and the coding region of ftsZ (arrow) has been superimposed to the plot.

(ZIP)

Acknowledgments

We thank S. Altman for the gift of plasmids coding for the C5 protein and for his helpful guidance at various stages of this project. We thank Susana Raffo and Marta Bravo for DNA sequencing and technical support. We also thank Maximiliano Neme for assistance with confocal microscopy. This paper is dedicated to the memory of J. H. Crosa.

Funding Statement

This study was supported by a Public Health Service grant 2R15AI047115 (to M.E.T.) from the National Institutes of Health and X-240 Universidad de Buenos Aires (to A.Z.). A.Z. is a career member of Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). C.D.S. and A.J.C.S.B. were supported by fellowships from CONICET. L.K. was supported by grant MHIRT 2T37MD001368 from the National Institute on Minority Health and Health Disparities, National Institutes of Health. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Goehring NW, Beckwith J (2005) Diverse paths to midcell: assembly of the bacterial cell division machinery. Curr Biol 15: R514–526. [DOI] [PubMed] [Google Scholar]
  • 2. Vicente M, Rico AI (2006) The order of the ring: assembly of Escherichia coli cell division components. Mol Microbiol 61: 5–8. [DOI] [PubMed] [Google Scholar]
  • 3. Vicente M, Rico AI, Martinez-Arteaga R, Mingorance J (2006) Septum enlightenment: assembly of bacterial division proteins. J Bacteriol 188: 19–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Margolin W (2005) FtsZ and the division of prokaryotic cells and organelles. Nat Rev Mol Cell Biol 6: 862–871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Corbin BD, Wang Y, Beuria TK, Margolin W (2007) Interaction between cell division proteins FtsE and FtsZ. J Bacteriol 189: 3026–3035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Mingorance J, Rivas G, Velez M, Gomez-Puertas P, Vicente M (2010) Strong FtsZ is with the force: mechanisms to constrict bacteria. Trends Microbiol 18: 348–356. [DOI] [PubMed] [Google Scholar]
  • 7. de Boer PA (2010) Advances in understanding E. coli cell fission. Curr Opin Microbiol 13: 730–737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Goley ED, Yeh YC, Hong SH, Fero MJ, Abeliuk E, et al. (2011) Assembly of the Caulobacter cell division machine. Mol Microbiol 80: 1680–1698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Erickson HP, Anderson DE, Osawa M (2010) FtsZ in bacterial cytokinesis: cytoskeleton and force generator all in one. Microbiol Mol Biol Rev 74: 504–528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Vivancos AP, Guell M, Dohm JC, Serrano L, Himmelbauer H (2010) Strand-specific deep sequencing of the transcriptome. Genome research 20: 989–999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Wang J, Galgoci A, Kodali S, Herath KB, Jayasuriya H, et al. (2003) Discovery of a small molecule that inhibits cell division by blocking FtsZ, a novel therapeutic target of antibiotics. J Biol Chem 278: 44424–44428. [DOI] [PubMed] [Google Scholar]
  • 12. Goh S, Boberek JM, Nakashima N, Stach J, Good L (2009) Concurrent growth rate and transcript analyses reveal essential gene stringency in Escherichia coli . PLoS One 4: e6061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Haydon DJ, Stokes NR, Ure R, Galbraith G, Bennett JM, et al. (2008) An inhibitor of FtsZ with potent and selective anti-staphylococcal activity. Science 321: 1673–1675. [DOI] [PubMed] [Google Scholar]
  • 14. Huang Q, Tonge PJ, Slayden RA, Kirikae T, Ojima I (2007) FtsZ: a novel target for tuberculosis drug discovery. Curr Top Med Chem 7: 527–543. [DOI] [PubMed] [Google Scholar]
  • 15. Sass P, Josten M, Famulla K, Schiffer G, Sahl HG, et al. (2011) Antibiotic acyldepsipeptides activate ClpP peptidase to degrade the cell division protein FtsZ. Proc Natl Acad Sci U S A 108: 17474–17479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Jaiswal R, Beuria TK, Mohan R, Mahajan SK, Panda D (2007) Totarol inhibits bacterial cytokinesis by perturbing the assembly dynamics of FtsZ. Biochemistry 46: 4211–4220. [DOI] [PubMed] [Google Scholar]
  • 17. Schaffner-Barbero C, Martin-Fontecha M, Chacon P, Andreu JM (2012) Targeting the assembly of bacterial cell division protein FtsZ with small molecules. ACS Chem Biol 7: 269–277. [DOI] [PubMed] [Google Scholar]
  • 18. Haydon DJ, Bennett JM, Brown D, Collins I, Galbraith G, et al. (2010) Creating an antibacterial with in vivo efficacy: synthesis and characterization of potent inhibitors of the bacterial cell division protein FtsZ with improved pharmaceutical properties. J Med Chem 53: 3927–3936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Altman S (2011) Ribonuclease P. Philos Trans R Soc Lond B Biol Sci. 366: 2936–2941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Lundblad EW, Altman S (2010) Inhibition of gene expression by RNase P. Nature Biotechnol. 27: 212–221. [DOI] [PubMed] [Google Scholar]
  • 21. Gopalan V, Vioque A, Altman S (2002) RNase P: variations and uses. J Biol Chem 277: 6759–6762. [DOI] [PubMed] [Google Scholar]
  • 22. Xiao G, Lundblad EW, Izadjoo M, Altman S (2008) Inhibition of expression in Escherichia coli of a virulence regulator MglB of Francisella tularensis using external guide sequence technology. PLoS One 3: e3719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Ko JH, Izadjoo M, Altman S (2008) Inhibition of expression of virulence genes of Yersinia pestis in Escherichia coli by external guide sequences and RNase P. RNA. 14: 1656–1662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. McKinney JS, Zhang H, Kubori T, Galan JE, Altman S (2004) Disruption of type III secretion in Salmonella enterica serovar Typhimurium by external guide sequences. Nucleic Acids Res 32: 848–854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. McKinney J, Guerrier-Takada C, Wesolowski D, Altman S (2001) Inhibition of Escherichia coli viability by external guide sequences complementary to two essential genes. Proc Natl Acad Sci U S A 98: 6605–6610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Guerrier-Takada C, Salavati R, Altman S (1997) Phenotypic conversion of drug-resistant bacteria to drug sensitivity. Proc Natl Acad Sci U S A 94: 8468–8472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Soler Bistue AJ, Martin FA, Vozza N, Ha H, Joaquin JC, et al. (2009) Inhibition of aac(6′)-Ib-mediated amikacin resistance by nuclease-resistant external guide sequences in bacteria. Proc Natl Acad Sci U S A 106: 13230–132235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Soler Bistue AJ, Ha H, Sarno R, Don M, Zorreguieta A, et al. (2007) External guide sequences targeting the aac(6′)-Ib mRNA induce inhibition of amikacin resistance. Antimicrob Agents Chemother 51: 1918–1925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Shen N, Ko JH, Xiao G, Wesolowski D, Shan G, et al. (2009) Inactivation of expression of several genes in a variety of bacterial species by EGS technology. Proc Natl Acad Sci U S A 106: 8163–8168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Guerrier-Takada C, Li Y, Altman S (1995) Artificial regulation of gene expression in Escherichia coli by RNase P. Proc Natl Acad Sci U S A. 92: 11115–11119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Studier FW, Rosenberg AH, Dunn JJ, Dubendorff JW (1990) Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol 185: 60–89. [DOI] [PubMed] [Google Scholar]
  • 32.Sambrook J, Russell D (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
  • 33. Sarno R, Ha H, Weinsetel N, Tolmasky ME (2003) Inhibition of aminoglycoside 6′-N-acetyltransferase type Ib-mediated amikacin resistance by antisense oligodeoxynucleotides. Antimicrob Agents Chemother 47: 3296–3304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Zuker M, Mathews DH, Turner DH (1999) Algorithms and thermodynamics for RNA secondary structure prediction: a practical guide. In: Barciszewski J, Clark B, editors. RNA biochemistry and Biotechnology: Kluwer Academic Publishers. 11–43.
  • 35. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31: 3406–3415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Li Y, Guerrier-Takada C, Altman S (1992) Targeted cleavage of mRNA in vitro by RNase P from Escherichia coli . Proc Natl Acad Sci U S A 89: 3185–3189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ayala J, Garrido T, de Pedro M, Vicente M (1994) Molecular biology of bacterial septation. In: Ghuysen J, Hakenbeck R, editors. Bacterial Cell Wall. Amsterdam: Elsevier Science. 73–101.
  • 38. Flardh K, Garrido T, Vicente M (1997) Contribution of individual promoters in the ddlB-ftsZ region to the transcription of the essential cell-division gene ftsZ in Escherichia coli . Molecular Microbiol 24: 927–936. [DOI] [PubMed] [Google Scholar]
  • 39. Selinger DW, Saxena RM, Cheung KJ, Church GM, Rosenow C (2003) Global RNA half-life analysis in Escherichia coli reveals positional patterns of transcript degradation. Genome research 13: 216–223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Cam K, Rome G, Krisch HM, Bouche JP (1996) RNase E processing of essential cell division genes mRNA in Escherichia coli . Nucleic Acids Res 24: 3065–3070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Benders GA, Powell BC, Hutchison CA, 3rd (2005) Transcriptional analysis of the conserved ftsZ gene cluster in Mycoplasma genitalium and Mycoplasma pneumoniae . J Bacteriol 187: 4542–4551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Goldblum K, Apririon D (1981) Inactivation of the ribonucleic acid-processing enzyme ribonuclease E blocks cell division. J Bacteriol 146: 128–132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. de la Fuente A, Palacios P, Vicente M (2001) Transcription of the Escherichia coli dcw cluster: evidence for distal upstream transcripts being involved in the expression of the downstream ftsZ gene. Biochimie 83: 109–115. [DOI] [PubMed] [Google Scholar]
  • 44. Tamura M, Lee K, Miller CA, Moore CJ, Shirako Y, et al. (2006) RNase E maintenance of proper FtsZ/FtsA ratio required for nonfilamentous growth of Escherichia coli cells but not for colony-forming ability. J Bacteriol 188: 5145–5152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Infectious Diseases Society of America (2010) The 10×′20 Initiative: pursuing a global commitment to develop 10 new antibacterial drugs by 2020. Clin Infect Dis 50: 1081–1083. [DOI] [PubMed] [Google Scholar]
  • 46. Rice LB (2010) Progress and challenges in implementing the research on ESKAPE pathogens. Infect Control Hospital Epidemiol 31 Suppl 1S7–10. [DOI] [PubMed] [Google Scholar]
  • 47. Boberek JM, Stach J, Good L (2010) Genetic evidence for inhibition of bacterial division protein FtsZ by berberine. PLoS One 5: e13745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Czaplewski LG, Collins I, Boyd EA, Brown D, East SP, et al. (2009) Antibacterial alkoxybenzamide inhibitors of the essential bacterial cell division protein FtsZ. Bioorg Med Chem Lett 19: 524–527. [DOI] [PubMed] [Google Scholar]
  • 49. Meng J, Wang H, Hou Z, Chen T, Fu J, et al. (2009) Novel anion liposome-encapsulated antisense oligonucleotide restores susceptibility of methicillin-resistant Staphylococcus aureus and rescues mice from lethal sepsis by targeting mecA . Antimicrob Agents Chemother 53: 2871–2878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Mellbye BL, Weller DD, Hassinger JN, Reeves MD, Lovejoy CE, et al. (2010) Cationic phosphorodiamidate morpholino oligomers efficiently prevent growth of Escherichia coli in vitro and in vivo . J Antimicrob Chemother 65: 98–106. [DOI] [PubMed] [Google Scholar]
  • 51. Eriksson M, Nielsen PE, Good L (2002) Cell permeabilization and uptake of antisense peptide-peptide nucleic acid (PNA) into Escherichia coli . J Biol Chem 277: 7144–7147. [DOI] [PubMed] [Google Scholar]
  • 52.Traglia G, Davies Sala C, Fuxman Bass J, Soler Bistué A, Zorreguieta A, et al. (2012) Internalization of locked nucleic acids/DNA hybrid oligomers into Escherichia coli. BioResearch Open Access, in press. [DOI] [PMC free article] [PubMed]
  • 53. Stein CA, Hansen JB, Lai J, Wu S, Voskresenskiy A, et al. (2010) Efficient gene silencing by delivery of locked nucleic acid antisense oligonucleotides, unassisted by transfection reagents. Nucleic Acids Res 38: e3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Torres AG, Threlfall RN, Gait MJ (2011) Potent and sustained cellular inhibition of miR-122 by lysine-derivatized peptide nucleic acids (PNA) and phosphorothioate locked nucleic acid (LNA)/2′-O-methyl (OMe) mixmer anti-miRs in the absence of transfection agents. Artif DNA PNA XNA 2: 71–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Lehto T, Abes R, Oskolkov N, Suhorutsenko J, Copolovici DM, et al. (2010) Delivery of nucleic acids with a stearylated (RxR)4 peptide using a non-covalent co-incubation strategy. J Control Release 141: 42–51. [DOI] [PubMed] [Google Scholar]
  • 56. Mae M, El Andaloussi S, Lundin P, Oskolkov N, Johansson HJ, et al. (2009) A stearylated CPP for delivery of splice correcting oligonucleotides using a non-covalent co-incubation strategy. J Control Release 134: 221–227. [DOI] [PubMed] [Google Scholar]
  • 57. Takara K, Hatakeyama H, Ohga N, Hida K, Harashima H (2010) Design of a dual-ligand system using a specific ligand and cell penetrating peptide, resulting in a synergistic effect on selectivity and cellular uptake. Int J Pharm 396: 143–148. [DOI] [PubMed] [Google Scholar]
  • 58. Anko M, Majhenc J, Kogej K, Sillard R, Langel U, et al. (2012) Influence of stearyl and trifluoromethylquinoline modifications of the cell penetrating peptide TP10 on its interaction with a lipid membrane. Biochim Biophys Acta 1818: 915–924. [DOI] [PubMed] [Google Scholar]
  • 59. Said Hassane F, Saleh AF, Abes R, Gait MJ, Lebleu B (2010) Cell penetrating peptides: overview and applications to the delivery of oligonucleotides. Cell Mol Life Sci 67: 715–726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Holm T, Andaloussi SE, Langel U (2011) Comparison of CPP uptake methods. Methods Mol Biol 683: 207–217. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

ss count plot. The ss count plot is the propensity of a base to be single stranded as determined by the number of times it is single stranded in a group of predicted foldings, in this case 33, (http://mfold.rna.albany.edu/?q=mfold/documentation). To simplify the interpretation, the length of the untranslated region (black bar) and the coding region of ftsZ (arrow) has been superimposed to the plot.

(ZIP)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES