Skip to main content
NCBI home page
UKPMC Funders Author Manuscripts logoLink to UKPMC Funders Author Manuscripts
. Author manuscript; available in PMC: 2013 May 1.
Published in final edited form as: J Immunol. 2012 Sep 28;189(9):4459–4469. doi: 10.4049/jimmunol.1201915

The inducible tissue-specific expression of the human IL-3/GM-CSF locus is controlled by a complex array of developmentally regulated enhancers

Euan W Baxter 1, Fabio Mirabella 1,2, Sarion R Bowers 1,3, Sally R James 1, Aude-Marine Bonavita 1, Elisabeth Bertrand 1, Ruslan Strogantsev 4,5, Abbas Hawwari 6,7, Andrew G Bert 6, Andrea Gonzalez de Arce 1, Adam G West 4, Constanze Bonifer 1,8, Peter N Cockerill 1,9,*
PMCID: PMC3480713  EMSID: UKMS49879  PMID: 23024272

Abstract

The closely linked human IL-3 and GM-CSF genes are tightly regulated and are expressed in activated T cells and mast cells. Here we used transgenic mice to study the developmental regulation of this locus and to identify DNA elements required for its correct activity in vivo. Because these two genes are separated by a CTCF-dependent insulator, and the GM-CSF gene is regulated primarily by its own upstream enhancer, the main aim was to identify regions of the locus required for correct IL-3 gene expression. We initially found that the previously identified proximal upstream IL-3 enhancers were insufficient to account for the in vivo activity of the IL-3 gene. However, an extended analysis of DNase I hypersensitive sites (DHSs) spanning the entire upstream IL-3 intergenic region revealed the existence of a complex cluster of both constitutive and inducible DHSs spanning the −34 to −40 kb region. The tissue specificity of these DHSs mirrored the activity of the IL-3 gene, and included a highly inducible CyclosporinA-sensitive enhancer at −37 kb which increased IL-3 promoter activity 40 fold. Significantly, inclusion of this region enabled correct in vivo regulation of IL-3 gene expression in T cells, mast cells and myeloid progenitor cells.

Keywords: Transcription, chromatin, enhancer, IL-3, GM-CSF

INTRODUCTION

The closely linked Interleukin-3 (IL-3) and Granulocyte-Macrophage Colony-Stimulating-Factor (GM-CSF) genes are tightly regulated and are both expressed in a highly inducible and tissue-specific fashion (1). IL-3 and GM-CSF are closely related cytokines that activate the same signaling pathways and have similar functions (2, 3). However, they also have important unique roles in vivo. IL-3 has more wide-ranging functions as it regulates the proliferation, differentiation, activation and survival of hematopoietic progenitor cells, and it promotes the differentiation of mast cells, eosinophils, basophils, neutrophils, monocytes, megakaryocytes and erythroid cells (2, 3). Although IL-3 is not essential for adult hematopoiesis, it can function as a pro-inflammatory cytokine in vivo, and as a colony-stimulating factor in vitro. During embryogenesis, IL-3 is known to play an important role in mobilizing and amplifying the earliest hematopoietic stem cells (HSCs) emerging from the endothelium of the developing aorta, and it has been shown that IL-3 mutant embryos are deficient in HSCs (4). Within the lumen of the aorta-gonad-mesonephros (AGM) region of the embryo, IL-3 is expressed by cells adhering to the endothelial wall, but the identity of these cells remains unknown (4). IL-3 is also required for expansion of hemangioblasts in the AGM region at an even earlier stage of embryogenesis (5). GM-CSF functions primarily as a powerful pro-inflammatory cytokine (3, 6), acting more specifically on granulocyte-macrophage lineage cells and mediating some of the key actions of TNFα (7).

The IL-3, GM-CSF and IL-5 genes all evolved from a common ancestor and remain linked within a 1 Mb cluster of cytokine genes (8). The human IL-3 and GM-CSF genes remain just 10.5 kb apart as a single compact locus, whereas the IL-5 gene lies 465 kb downstream. Although they are co-induced upon activation in some cell types, such as Th2 cells and mast cells, they are differentially expressed in other cells types, and are likely to have independent mechanisms of regulation. Furthermore, the IL-5 gene is functionally linked to the IL-4/IL-13 locus as part of a region known as the Th2 cluster which is regulated by a shared Locus Control Region (LCR) (9, 10).

Despite their close proximity within the same locus, the human IL-3 and GM-CSF genes appear to be regulated independently of each other as two distinct genes. While they are co-expressed in T cells and mast cells, just GM-CSF is expressed in many types of non-hematopoietic cells such as endothelial and epithelial cells (2, 3). This distinct expression pattern is made possible by a CTCF-dependent insulator located between the two genes (11). The human IL-3 gene is associated with at least two upstream enhancer elements. The most significant of these is a conserved inducible enhancer at −4.5 kb upstream that functions in both mast cells and T cells, and can therefore help to account for the inducible and tissue-specific regulation of IL-3 expression (1, 12). An additional non-conserved T cell-specific enhancer of unknown function exists 14 kb upstream of the IL-3 gene (1, 13, 14). However, there have never been any in vivo studies performed to determine just which regulatory elements in this locus are actually either necessary or sufficient for correct IL-3 gene expression in vivo.

The independent expression of the human GM-CSF gene is controlled by a conserved −3 kb enhancer that supports its efficient inducible expression in a transgenic mouse model containing just a 10 kb segment of the human GM-CSF locus (1, 15-17). The GM-CSF gene is also associated with additional highly conserved far downstream sequences, one of which is known to function as a BRG1/NF-kB-dependent enhancer in the mouse (CNSa) (18). This element is at +34 kb in the mouse and at +30 kb in the human genome relative to the start of the GM-CSF gene.

The IL-3 −4.5 and −14 kb enhancers, and the GM-CSF −3 kb enhancer all form inducible DNase I hypersensitive sites (DHSs) (1, 12, 14, 16). These enhancers are each activated via cooperation between kinase and calcium signaling pathways, which in T cells are linked to the TCR, and they encompass binding sites for the Ca2+-inducible transcription factor NFAT which supports chromatin remodeling (1, 19). Induction of these DHSs is suppressed by cyclosporin A (CsA) which blocks the Ca2+-dependent induction of NFAT by inhibiting calcineurin (12, 14, 16).

IL-3 and GM-CSF can also be aberrantly expressed in myeloid leukemia where they function as autocrine growth factors (20). For example, IL-3 functions as a mediator of autocrine growth in chronic myeloid leukaemia (CML) (21), but the mechanisms responsible for its aberrant expression remain unknown. Additional studies are, therefore, needed to identify the significant in vivo sources of IL-3, and the DNA elements underlying the normal induction of activation of IL-3 expression in mature hematopoietic cells and in the developing hematopoietic system, as well as the aberrant induction of IL-3 expression by BCR-ABL signaling in early myeloid progenitor cells in CML patients (21-23).

In this study we aimed to identify mechanisms controlling the correct inducible and developmental regulation of the human IL-3 gene. We initially found that the proximal −14 and −4.5 kb enhancer regions were not sufficient to direct efficient IL-3 promoter activation in transgenic mice. However, a more expansive analysis revealed that a transgene incorporating a powerful −37 kb inducible enhancer was able to direct the correct pattern of inducible and developmentally regulated IL-3 gene expression in vivo.

MATERIALS AND METHODS

All experiments involving animals or humans were authorized by research ethics committees.

Transgenic mice

The previously described B38, C42 and D48 IL-3/GM-CSF transgenic mouse lines contain 1 to 6 copies of a 130 kb AgeI DNA fragment of BAC clone CTD2004C12 (24). Line E52 contains 1 copy of the same BAC fragment, but has a 15.5 kb deletion at the 3′ end, terminating 21 kb downstream of the GM-CSF gene, and lacking the +30 kb region homologous to mouse CNSa +34 kb enhancer element (18). Copy number was estimated made by Southern blot hybridization of mouse and human DNA, with human IL-3 and GM-CSF and mouse CD19 gene probes.

Cell preparation and stimulation

Unless indicated otherwise, all cell stimulation was for 4 h with 20 ng/ml PMA and 2 μM calcium ionophore A23187 (PMA/I). Human cell lines: Jurkat T cells, HMC-1 mast cells, KG1a myeloblastic cells, and Raji B cells were all cultured as previously described (25). HMC-1 mast cells were obtained from Dr. J. Butterfield (26).

Mouse cells used in this study include (i) freshly isolated thymocytes obtained by passing a thymus through a cell strainer, (ii) spleen derived CD19+ve B cells purified on magnetic beads, (iii) actively dividing T blast cells prepared from splenic T cells (24), (iv) mast cells grown from bone marrow by long term culture in IL-3 and SCF (25), (v) myeloid progenitor cells (MPs) and macrophages derived from fetal liver, and (vi) mouse embryonic fibroblasts (MEFs) cultured from embryos. The myeloid progenitor cells (MPs) were grown from day 13.5 transgenic mouse fetal liver by culture at starting density of 1 × 106 cells/ml for 5 to 8 days in IMDM supplemented with 10% FCS 150 μM monothioglycerol, 500 U/ml penicillin and streptomycin, 10 ng/ml recombinant mouse IL-3 and 10 ng/ml recombinant mouse SCF. Non-adherent cells were moved into a new flask each time they were expanded so as to separate them from any emerging adherent macrophages from the culture. We confirmed that these cells grew as bunches of round non-adherent cells, stained for ERMP12 antibodies, and were not granular, as is expected for MPs. In parallel, the adherent macrophages were maintained in isolation from the MPs in the presence of 10% L cell-conditioned media containing M-CSF until they reached confluence. The mouse embryonic fibroblasts (MEFs) were prepared from decapitated, eviscerated day 13.5 transgenic mouse embryos dispersed by digestion for several hours with 0.25% collagenase followed by culture for 14 days in DMEM plus 5% FCS, splitting the cells each time they reached confluence. The T lymphoblasts were prepared by culture with CD3/CD28 antibody beads for 2 days, followed by culture in IL-2 for a further 2 days without beads. Liver nuclei were prepared by homogenising liver in nuclei digestion buffer containing 0.3 M sucrose (25), passing it through a 70 μM strainer, and centrifugation in an angle rotor at 18,500 g through a cushion of digestion buffer containing 1.8 M sucrose for 30 min at 4°C.

mRNA analyses

mRNA was extracted from cells using Trizol (Invitrogen) according to the manufacturer’s instructions. cDNA was generated from purified mRNA using M-MLV Reverse Transcriptase (Invitrogen) according to the manufacturer’s recommendation. Unless indicated otherwise, all the gene expression analyses were performed by quantitative real-time PCR using SYBR Green I reagents (Applied Biosystems, Foster City, CA) on a ABI Prism 7500. The data from each set of primers were analyzed against a standard curve made with a serial dilution of cDNA from PMA/I stimulated T-blast cells or mast cells. Levels of expression of mRNA encoding both human and mouse GM-CSF and IL-3 were determined relative to mouse GAPDH expression. Semi-quantitative analysis of mRNA was performed using 25 cycles of PCR.

Primers used for mRNA analyses were as follows: Human GM-CSF; Forward CACTGCTGCTGAGATGAATGAAA, Reverse GTCTGTAGGCAGGTCGGCTC. Human IL-3; Forward GGACTTCAACAACCTCAATGGG, Reverse TTGAATGCCTCCAGGTTTGG. Mouse GM-CSF; Forward ATGCCTGTCACGTTGAATGAAG, Reverse CAGATCGTTAAGGTGGACCATG. Mouse GAPDH; Forward TGGTGAAGCAGGCATCTGAG, Reverse TGTTGAAGTCGCAGGAGACAAC. Because the sequences of the mouse and human IL-3 and GM-CSF coding regions have diverged considerably, these primers sets do not cross-react between the human and mouse mRNAs (and the human proteins do not recognise the mouse receptors).

DNase I-hypersensitive site analysis

DNase I digestions and analyses were performed on either isolated nuclei or permeabilised cells as previously described (24, 25). Samples with optimal extents of DNase I digestion were selected for Southern blot hybridization analysis of DHSs using the strategies summarized below.

Probes based on previously published strategies for mapping DHSs were as follows:

(i) DHSs upstream of the IL-3 gene −10.1 kb BamHI site were probed with a 0.7 kb EcoRI/BamHI fragment of DNA (−10.1 to −10.8 kb), (ii) DHSs across the IL-3 promoter region were mapped from the −6.6 kb SpeI site with a 0.5 kb SpeI/BamHI fragment of DNA, (iii) DHSs across a 9.4 kb region spanning the GM-CSF enhancer and promoter were mapped from an EcoRI site 6.8 kb upstream from the GM-CSF gene using a 1.5kb BamHI fragment of DNA as a probe (2), (iv) DHSs spanning the insulator downstream of the IL-3 gene were mapped from a BamHI site using a 1kb BglII/BamHI fragment of DNA (12, 15).

Primers used to amplify DNA segments as probes for mapping novel DHSs are described in Supplemental Table 1.

Transient transfection assays

Transfection assays and luciferase assays were performed using the luciferase reporter gene plasmid pXPG(27) containing either the −559 to +50 bp segment of the human IL-3 promoter (pIL3H) or a 229 bp fragment of the TK promoter, plus the indicated upstream DNA fragments, as described previously (25), or a DNA segment spanning the human IL-3 +4.5 kb DHS. All transfection assays were performed by electroporation using 4.5 × 106 cells and 5 μg of test plasmid. With the exception of Fig. 5D, in each assay cells were cotransfected with 1 μg of an appropriate Renilla luciferase plasmid to control for transfection efficiency. Transfected cells were first cultured for 21 hours to equilibrate and then stimulated for 8 h with 20 ng/ml PMA and 1or 2 μM A23187.

Figure 5. Analysis of enhancers upstream of the IL-3 gene.

Figure 5

Open in a new tab

A, Luciferase reporter gene assays in stimulated Jurkat T cells transiently transfected with the luciferase plasmid pIL3H containing human IL-3 promoter alone or in conjunction with DNA segments containing the indicated DHSs. For −37/−40 and −34/−37/−40, the order of elements relative to the IL-3 promoter is as in the genome. In each case, values represent the average of two independent constructs.

B, DHS mapping of the IL-3 −37 kb region as in Fig. 3C in human cell lines before and after stimulation for 4 h with PMA/I.

C, Transient transfection assays of a luciferase plasmid containing the thymidine kinase (TK) promoter alone, or with either the SV40 or the IL-3 −37 kb enhancer in stimulated cell lines.

D, Transient transfection assays of a luciferase plasmid containing the TK promoter alone, or with the IL-3 −37 kb enhancer, in non-stimulated and stimulated Jurkat cells.

In panels A and C, co-transfected Firefly luciferase activity is used to correct for transfection efficiency of firefly luciferase. Panel D depicts just the Firefly luciferase data so as to make it possible to show the level of induction of the TK promoter. Error bars indicate S.D.

Construction of plasmids used in transfection assays

DNA fragments spanning the human IL-3 −40, −37, −34 kb and +4.5 kb DHSs were amplified from the BAC CTD2004C12 by PCR using primers with restriction enzyme sites added to allow cloning as follows:

IL-3 −37 kb DHS with XhoI linkers (defined here as the X37 element because of the XhoI sites):

Forward CCCGCTCGAGCTAAATGCATTTCCCACC,

Revesrse CCCGCTCGAGCTGAGGAGTGGAGATTACAGG.

IL-3 −34 kb DHS with KpnI linkers:

Forward GGGGGGTACCGGCCATCATAGAAGCAGAAGG,

Reverse GGGGGGTACCTGAATCACAGAGTGCCCACC.

IL-3 −40 kb DHS with BamHI linkers:

Forward CGCGGGATCCAGGGCTCAAAACCAACTATGC,

Reverse CGCGGGATCCGGTGTTTACACCTGCTCAAGG.

IL-3 +4.5 kb DHS with BglII and KpnI linkers:

Forward TTCCCTAGATCTCGCACGTGACAGCTAGTC,

Reverse CTTGGTTCTGGTACCAGTCTGGCTTTAAGCTGCAG.

After amplification and restriction enzyme digestion, DNA fragments were cloned into either pIL3H (12), containing the −559 to +50 bp segment of the human IL-3 promoter in pXPG, pTK229 (12), containing a 229 bp fragment of the TK promoter in pXPG, or in the case of the IL-3 +4.5 kb DHS, just the luciferase vector pXPG (27). The combination of BamHI, XhoI, and KpnI made it possible to clone each of the −40, −37 and −34 kb DHSs into pIL3H at the same time and maintain the natural order of these elements in the genome relative to the IL-3 promoter. The combination of BglII and KpnI made it possible to clone the +4.5 kb DHS in the sense orientation relative to the human IL-3 and GM-CSF genes in the human genome, and relative to the luciferase gene in pXPG.

The additional derivatives of the 684 bp X37 segment (the −37 kb element plus XhoI adapters) as used in Fig. 7B were as follows: (i) The 123-684 fragment was generated by BamHI digestion, and the 1-305 and 305-684 fragments were generated by PvuII digestion. (ii) PCR-generated sub-fragments of the X37 segment were engineered using primers containing BglII and KpnI cloning sites as follows:

Figure 7. Transcription factor binding within the −37 kb IL-3 enhancer.

Figure 7

Open in a new tab

A-D, Analyses of Jurkat T cells cultured with and without stimulation for 4 h with 20 ng/ml PMA and 0.57 mM calcium ionophore A23187. A, EGR-1 ChIP assay of the −37 kb IL-3 enhancer performed as described (28), with enrichment levels normalised against a negative control within the VEZF1 gene body. B, EMSA performed using a probe encompassing the IL-3 −37 kb EGR-1 site and antibodies against Sp1, Sp3 and EGR-1. C, Semi-quantitative real time PCR analysis of mRNA expression.

The 274 bp 84-357 segment was created with TTTATAGATCTCTGGGGAAGGGACATC and AATTAGGTACCGGCTAGGTTAGGAAGGAC.

The 184 bp 84-267 segment was created with TTTATAGATCTCTGGGGAAGGGACATC and AATTAGGTACCATGAGATGACACTGACTC.

Primers used for site-directed mutagenesis of X37 were as follows:

GATA forward GGGTGTGGGATCCAGgcAACACAGGATGAGAGG,

reverse CCTCTCATCCTGTGTTgcCTGGATCCCACACCC;

ETS-1#1 forward GGGATCCAGATAACACActATGAGAGGTGGGAGG,

reverse CCTCCCACCTCTCATagTGTGTTATCTGGATCCC;

ETS-1#2 forward GAAAGAAAGTTCAGGCAAAGctACATCTTGCAGGTCTTTCTC,

reverse GAGAAAGACCTGCAAGATGTagCTTTGCCTGAACTTTCTTTC;

EGR-1 forward CAAACAACCTggtgaACAAAATCATATTG,

reverse CAATATGATTTTGTtcaccAGGTTGTTTG.

EMSAs and ChIP

EMSAs of the IL-3 −37 kb enhancer EGR-1 site were performed as previously described (28) and used the following primers:

Forward strand: AGGTCTTTCTCAAACAACCTCCCCCACAAAATCATATTGA

Reverse strand: TCAATATGATTTTGTGGGGGAGGTTGTTTGAGAAAGACCT

EMSAs employed nuclear extracts from Jurkat T cells, cultured with and without stimulation for 4 h with 20 ng/ml PMA and 0.57 μM calcium ionophore A23187. The super-shift EMSAs included antibodies against Sp1 (Millipore #17-601), Sp3 (Santa Cruz Biotechnology #sc644X) or EGR-1 (Santa Cruz Biotechnology #sc110X).

EGR-1 ChIP assays of the human IL-3 promoter in Jurkat cells were performed as described (28), with enrichment levels normalised against a negative control within the human VEZF1 gene body, using the following primers: IL-3 promoter forward GGTTGTGGGCACCTTGCT;

IL-3 promoter reverse TCTGTCTTGTTCTGGTCCTTCGT;

VEZF forward GACAGCAGCCGAACTTCGTT; VEZF reverse TGGTGCCCGAGGAAGATG. .

RESULTS

A 130 kb segment spanning the human IL-3/GM-CSF locus supports correct developmentally regulated and inducible IL-3 and GM-CSF gene expression

Our initial aim was to determine whether the previously defined regulatory regions of the human IL-3 locus are sufficient to support its correct inducible and tissue-specific expression in vivo. We created 8 independent mouse lines from a transgene containing the IL-3 −14 and −4.5 kb enhancers and promoter linked to a human CD4 reporter gene (Fig. 1A). However, this combination of DNA elements was clearly insufficient for in vivo expression because 3 lines displayed low level variegated expression, while the remaining 5 lines showed no expression upon stimulation in T blast cells (Supplemental Fig. 1).

Figure 1. Developmental regulation of human IL-3/GM-CSF transgenes.

Figure 1

Open in a new tab

A, Map of the 130 kb BAC transgene with the intact genomic locus showing previously defined enhancers (E), the insulator (Ins) and a region homologous to the mouse CNSa enhancer. Lines B38, C42 and D48 contain the complete 130 kb transgene, and line E50 has a 15.5 kb 3′ deletion as indicated by the bracket underneath. Underneath is the map of the minimal IL-3/Enhancer transgenic construct containing just the proximal human IL-3 gene elements plus the −14 kb enhancer linked to a human CD4 reporter gene.

B, Copy number determination of the 130 kb transgenes based on segments of the human IL-3 and GM-CSF genes, using the mouse CD19 locus as an internal reference, and human genomic DNA as a 2 copy control.

C, Human IL-3 and GM-CSF mRNA expression in stimulated transgenic mouse T blast cells, expressed relative to expression of the mouse IL-3 and GM-CSF genes, corrected for copy number.

D, Hematopoietic differentiation pathway showing the predicted sources of IL-3 and GM-CSF.

E, Inducible expression of human GM-CSF and IL-3 mRNA in line C42. Columns depict mRNA expression in stimulated cells relative to mouse GAPDH and corrected for copy number. Fold induction relative to non-stimulated cells is shown underneath.

To aid identification of additional essential IL-3 gene regulatory elements we performed detailed analyses of a much larger transgene spanning the intact human IL-3/GM-CSF locus. We created several lines of transgenic mice from a 130 kb AgeI genomic DNA fragment (lines B38, C42, D48 and E50, Fig. 1A) which includes the entire upstream 49 kb intergenic region separating the IL-3 gene from the upstream ACSL6 gene. Lines B38, C42 and D48 also include sequences extending to 36 kb downstream of the start of the GM-CSF gene, while line E50 has a 15 kb 3′ deletion and terminates 21 kb downstream. Transgene activity was assessed in actively proliferating T blast cells generated by stimulating spleen T lymphocytes with CD3 and CD28 antibodies and then culturing them for several days with IL-2 in the absence of stimulus. These cells were then re-stimulated with PMA and Calcium ionophore (PMA/I) to activate TCR signaling pathways and induce cytokine gene expression. For all four lines, the IL-3 and GM-CSF genes were efficiently induced in a copy-number dependent fashion (Fig. 1C). The average level of expression was in each case slightly higher than the levels determined for the endogenous mouse IL-3 and GM-CSF genes (24). Line E50, which lacks the CNSa 3′ GM-CSF region, supported approximately the same level of IL-3 expression as the other 3 lines, and a slightly lower level of GM-CSF expression, but this difference was not considered significant.

To define the pattern and mechanisms of developmentally regulated inducible human IL-3 and GM-CSF gene expression during different stages of hematopoietic differentiation we used transgenic mouse line C42 as a model and prepared the following cell types: (i) thymocytes as a model of immature T cells, (ii) actively dividing spleen-derived T blast cells, (iii) non-adherent myeloid progenitor (MP) cells cultured from fetal liver, (iv) mast cells cultured from the bone marrow, (v) adherent macrophages derived from MP cells, and (vi) fibroblasts cultured from mouse embryos (MEFs). The differentiation pathways linking these cells are depicted in Figure 1D. Within this scheme, HSCs and MPs potentially give rise to both macrophages, expected to express just GM-CSF, and mast cells which efficiently express both IL-3 and GM-CSF.

Cells were stimulated with PMA/I, and human IL-3 and GM-CSF gene mRNA expression was measured relative to mouse GAPDH mRNA (Fig.1E). The level of induction relative to unstimulated cells is shown underneath this graph depicting levels measured in stimulated cells. As anticipated, the IL-3 and GM-CSF genes were efficiently induced in activated T blast cells and mast cells. The level of expression was substantially higher in mast cells than in T cells, possibly because (i) mast cells express GATA-2 in addition to T cell factors such as Runx1, NFAT and AP-1, and (ii) the IL-3/GM-CSF locus includes many regulatory elements containing GATA motifs (1, 25). This is consistent with our findings that the GM-CSF enhancer is more active, and GM-CSF expression is higher, in cells expressing GATA factors (25).

MP cells also produced high levels of GM-CSF mRNA, equivalent to T blast cells, and moderate levels of IL-3 mRNA. In agreement with previous studies (3), IL-3 was not expressed in macrophages or MEFs. However, macrophages and MEFs similarly produced barely detectable levels of GM-CSF mRNA, in the order of a thousand fold lower than T blast cells. This was consistent with our previous studies of primary CD11b+ myeloid cells derived directly from the spleens of GM-CSF transgenic mice, where the mouse and human GM-CSF genes were both expressed at similar low levels (25). Hence, our findings are inconsistent with the prevailing dogma that macrophages and fibroblasts are assumed to be significant sources of GM-CSF.

Properties of DHSs located between the IL-3 and GM-CSF genes

To both identify novel potential regulatory elements, and define the pattern of developmental and inducible regulation of the IL-3/GM-CSF locus, we performed an exhaustive analysis of DHSs in line C42 in the cell types employed above, both before and after stimulation (Figs. 2, 3 and 4), and after stimulation in the presence of CsA (Supplemental Fig. 2). As additional non-expressing controls, we included splenic B cells and liver nuclei. For each cell type, the optimal DNase I-digested samples were selected from a series of DNase I titrations, and the same set of samples was then used for each subsequent analysis. This selection was based on the efficiency of DNase I digestion and PMA/I-induction as confirmed by examining the intensities of the DHS bands detected across the ubiquitous CTCF sites within the insulator downstream of the IL-3 gene (Fig. 3A) and the inducible DHS within the GM-CSF enhancer (Fig. 3B). DHSs were mapped using the strategies depicted in Fig. 2A. These assays demonstrated strong induction of the −3 kb GM-CSF enhancer DHS in T blast cells and mast cells, somewhat weaker induction of this DHS in MP cells, macrophages and MEFs, and no induction in thymocytes or B cells which do not express GM-CSF.

Figure 2. Distribution of tissue-specific and inducible DHSs in the IL-3/GM-CSF locus.

Figure 2

Open in a new tab

A and B, Strategies employed for mapping DHSs. The indirect-end-labeling probes used to map DHSs are marked as horizontal black arrows. Brackets define the regions between specific restriction enzyme sites covered by each probe.

A, Map of the previously defined inducible DHSs (vertical black arrows) and constitutive DHSs (vertical grey arrows) located within proximal regions of the human IL-3 and GM-CSF genes, as defined in T cells. The black boxes indicate the previously defined conserved −4.5 kb IL-3 and −3 kb GM-CSF enhancers.

B, UCSC genome browser view of conserved regions upstream of the human IL-3 gene (http://genome.cse.ucsc.edu), with the strategies for mapping DHSs shown underneath. The vertical arrows indicate the three conserved regions that were the principle targets for analyses of DHSs and enhancer function.

C, Summary of DHS mapping data. Inducible DHSs are black, stable DHSs are grey, and weak DHSs are shown as thin arrows. Levels of inducible IL-3 and GM-CSF expression relative to GAPDH, taken from Figure 1E, are indicated at the left of each row.

Figure 3. DHS analysis of the human IL-3/GM-CSF locus in transgenic line C42.

Figure 3

Open in a new tab

A-F, Southern blot hybridization analysis of DHSs as summarized in Fig. 2C, using the probes defined in Figs. 2A and B. DHSs were mapped before and after stimulation for 4 h with PMA/I in line C42 mast cells, B cells, thymocytes (Thy), T blast cells (T Bl), myeloid progenitor cells (MP), macrophages (MΦ), fibroblasts (MEF), and liver. DHSs are marked by arrows plus their distances in kb relative to the IL-3 gene transcription start site.

Figure 4. DHSs associated with a LI-LINE repeat element upstream of the IL-3 gene.

Figure 4

Open in a new tab

A, UCSC browser view and map spanning the conserved and repeat regions upstream of the IL-3 gene (http://genome.cse.ucsc.edu). Probes used for mapping DHSs in panels B and C are indicated by horizontal arrows, with locations of DHSs indicated as vertical arrows. The −16.4 kb DHS lies within the 5′ UTR of the L1PA13 LINE, and includes motifs for factors such as NFAT, AP-1, ETS, PU.1 and RUNX1, similar to the enhancers in this locus. The −23.3 kb DHS lies just outside the LIPA13 LINE, within a coding region segment of a separate incomplete L1 LINE repeat. The −23.3 kb DHS was also detected using the −34 kb BamHI probe used in Fig. 3E, which employed the same BamHI Southern blot filter as the one depicted here in panel C.

B, Higher resolution mapping of the −23.3 kb IL-3 DHS in stimulated C42 blast cells probed from an upstream KpnI site, and using internal EcoRI and EcoRV sites as size markers. The sizes of these markers are indicated on the right hand side, and the positions of each band relative to the IL-3 transcription start site are shown on the left.

C, Mapping DHSs in transgenic tissues across the repeat-region spanning the −14 kb enhancer from a BamHI site at −10.3 kb. Shown underneath is an additional DHS identified at −10.3 kb mapped in the same DNase I-digested samples but assayed in a parallel analysis from a SpeI site at −8.8 kb.

Within the insulator region we also identified an inducible CsA-resistant DHS at IL-3 +4.5 kb in GM-CSF-expressing cells in addition to the ubiquitous DHSs (Supplemental Fig. 2A). Unlike the other PMA/I-inducible DHSs in the IL-3/GM-CSF locus, this DHS was not suppressed by CsA which functions by blocking the Ca2+/calcineurin-dependent induction of NFAT. Furthermore, this DHS functioned as a non-coding RNA promoter that is transcribed towards the +4.9 kb DHS and the GM-CSF gene (Supplemental Fig. 2B). Interestingly, the +4.9 kb DHS, which encompasses a low affinity CTCF site, was weakest in the cell types that have the weakest induction of the +4.5 kb DHS and show the lowest GM-CSF expression. This element may, therefore, function as a chromatin opening element for the intergenic region separating the GM-CSF gene from the high affinity CTCF sites within the insulator.

IL-3 gene activation is associated with a cluster of far upstream DHSs

The above results suggested that the 130 kb BAC transgene is a reliable model to study the regulation of the IL-3/GM-CSF locus. To search for additional essential IL-3 gene regulatory elements within this transgene we used the mapping strategies depicted in Figs. 2B and 4A to identify DHSs within the entire 39 kb region between the −14 kb enhancer and the upstream ACSL6 gene. These assays identified a tightly regulated complex cluster of novel far upstream DHSs present only in cells capable of IL-3 gene expression (summarized in Fig. 2C) and co-localizing with conserved non-coding sequences (Fig. 2B). This region included a highly inducible DHS at −37.5 kb, that was strongest in mast cells and T blast cells, weak in MP cells, and absent in all other cell types (Fig. 3C). The −37.5 kb inducible DHS was flanked by stable T blast-specific DHSs located at −40.3 and − 33.7 kb, and additional inducible DHSs present in activated mast cells and T blast cells at −40.6 and −34.0 kb which were weak in stimulated MP cells, and absent in other cell types (Figs. 3D and E). Parallel assays of the IL-3 proximal region identified tissue-specific DHSs at −4.1 and −4.5 kb in mast cells, T blast cells and MP cells, a DHS at −1.5 kb specifically in T blast cells, and inducible DHSs at the −4.5 kb enhancer and promoter in T blasts and mast cells (Fig. 3F). The IL-3 −34.0, −37, and −40.6 kb inducible DHSs were each substantially suppressed by CsA, suggesting an NFAT-dependent mechanism of activation (Supplemental Fig. 2C).

We also made the unexpected observation that a full length LI-LINE repeat element, embedded within a 25 kb cluster of repeat elements, was associated with inducible DHSs located at −23.3 kb in mast cells and T blast cells, and −16.4 kb in mast cells, MPs and macrophages (Fig. 4). The −16.4 kb DHS was located within the 5′ UTR which represents the promoter of the ancestral retrotransposon. An additional inducible DHS was detected at −10.3 kb as a prominent DHS in mast cells, and a weaker DHS in MPs and macrophages (Fig. 4C). The −14 kb region, which functions as an enhancer in Jurkat and CEM T cells (12), was not detected as a DHS in any of the cell types examined here.

The IL-3 −37 kb DHS functions as a powerful inducible enhancer

Overall, it was clear that the level of inducible IL-3 expression in different cell types correlated very closely with the presence of a highly complex cluster of tissue-specific DHSs occupying much of the upstream intergenic region. Because the pattern of induction of the −37 kb IL-3 DHS closely paralleled the induction of the gene itself, we tested the function of this element as an inducible enhancer of the IL-3 promoter in luciferase reporter gene assays in Jurkat T cells stimulated with PMA/I. Parallel assays were performed with the adjacent −34 and −40 kb DHSs, and the previously defined −14 and −4.5 kb inducible enhancers. We found that the −37 kb element functioned as an exceptionally powerful enhancer, which increased IL-3 promoter activity by 40 fold (Fig. 5A). This was in the order of 20 times more powerful than the −14 and −4.5 kb IL-3 enhancers, and 10 times greater than the −3 kb GM-CSF enhancer (11). In contrast, the −34 and −40 kb DHSs contributed no enhancer activity, even when in combination with the −37 kb enhancer (−40 plus −37, and −40 plus −37 plus −34). The −37 kb enhancer was equally active in the reverse orientation, whereas the −40 kb DHS remained inactive when reversed (data not shown).

Because the IL-3 promoter is itself both inducible and tissue-specific, the above assays are unable to assess either of these parameters for the −37 kb enhancer. To find a model system where we could test these properties we first screened a panel of human cell lines for the inducible −37 kb DHS. These included Jurkat T cells, HMC1 mast cells, and KG1a myeloid progenitor cells, where in each case the −37 kb DHS was inducible, and Raji B cells and 5637 epithelial cells where this DHS could not be induced (Fig. 5B). To assess both tissue specificity and inducibility of the −37 kb enhancer, it was assayed in plasmids containing the constitutively active Thymidine Kinase (TK) promoter in parallel with the well defined SV40 enhancer which was used as the reference point. The −37 kb enhancer showed the greatest activity in Jurkat T cells where it was twice as active as the SV40 enhancer, and increased TK promoter activity by 25 fold (Fig. 5C). The −37 kb enhancer was also active, but to a lesser degree, in HMC1 and KG1a cells, where it increased promoter activity by 3 to 6 fold, whereas it was inactive in Raji B cells. The function of the −37 kb enhancer was also strictly inducible because it did not support any significant increase in TK promoter activity in the absence of stimulation (Fig. 5D).

The −37 kb enhancer encompasses conserved motifs for inducible and developmentally regulated factors

The 684 bp sequence used in Fig. 5A to define the −37 kb enhancer is displayed in Fig. 6A, where the conserved transcription factor-binding motifs are highlighted in grey and the most highly conserved DNA sequences are double underlined. These include a 55 bp core region containing GATA, ETS-1 and NFAT consensus elements, plus downstream EGR-1, NFAT and AP-1 elements. These elements are widely conserved across a broad range of mammalian species (http://genome.cse.ucsc.edu). Supplemental figure 3 depicts the alignment between nine representative mammalian genomes. For this group of mammals it can be seen that the core region of the enhancer is well conserved across primates, dogs, cats and horses, but less well conserved among rodents. The most highly conserved motifs are the four adjacent elements in the central region that have consensus binding sequences for ETS-1 (site #2), EGR-1, NFAT and AP-1, and are highlighted on line 3 of the sequence in Fig. 6A.

Figure 6. Regulatory elements within the −37 kb IL-3 enhancer.

Figure 6

Open in a new tab

A, Sequence of the 684 bp region encompassing the IL-3 −37 kb enhancer which is termed here as the X37 element. Consensus transcription factor binding motifs are highlighted in grey. Each of these highlighted motifs was found to be conserved in the genomes of from 5 to 10 different species (average = 7) in an alignment of the genomes of 18 placental mammals (http://genome.cse.ucsc.edu). The most highly conserved DNA sequences are marked by a double underline. Regions included in the 184 bp (84-269) and 274 bp (84-357) PCR-generated sub-fragments are demarcated by a slash. BamHI and PvuII sites used to generate sub-fragments are shown above the cleavage sites in italics.

B, Luciferase reporter gene transfection assays in stimulated Jurkat T cells of pIL3H plasmids containing segments of the −37 kb enhancer linked to the human IL-3 promoter.

C, Map of the −37 kb enhancer with transcription factor motifs and showing DNA segments used in transfection assays.

D, Transient transfection assays in stimulated Jurkat T cells of pIL3H plasmids containing the −37 kb enhancer with the indicated mutations.

To further dissect tissue-specific mechanisms of enhancer function we followed the parallel approaches of (i) assaying sub-fragments of the enhancer, starting from the 684 bp fragment (termed the X37 element because it has XhoI adapters at the ends –f the −37 kb DHS) defined above (Figs. 6B and C), and (ii) making point mutations in motifs for the developmentally regulated factors GATA, ETS-1 and EGR-1 (Fig. 6D). Fig. 6B shows that the minimal region maintaining full enhancer function is defined by a 274 bp core region (bases 84-357) encompassing the DHS and incorporating most of the transcription factor motifs depicted in Fig. 6A. DNA fragments lacking the downstream AP-1 site (bases 123-305 or 84-269) had substantially reduced enhancer activity (Figs. 6B and C). Although this downstream AP-1 motif was clearly required for maximal function of the full length enhancer, the downstream segment encompassing bases 306-684 bp, encompassing this AP-1 site plus an NFAT site, was completely inactive in the absence of the upstream elements.

The most significant motif identified by point mutations within the 274 bp core region was the EGR-1 site, where enhancer activity was reduced to ~17% (Fig. 6D). The two ETS-1 motifs also each contributed to enhancer function, whereby mutation of site 1 reduced enhancer activity to 62% and mutation of site 2 reduced enhancer activity to 26% (Fig. 6D). No effect on enhancer activity was observed after either (i) specific mutation of the conserved GATA motif or (ii) deletion of the non-conserved weak consensus PU.1 motif, most likely because Jurkat cells do not express GATA factors (25), and T cells do not normally express PU.1 (29).

Because EGR-1 motifs frequently overlap with Sp1 motifs (30), we further investigated the nature of factors binding to the crucial EGR-1 motif within the −37 kb enhancer. The −37 kb EGR-1 element resembles an EGR-1 binding site in the IL-2 gene (31) whereby both elements encompass the sequence TCCCCCAC and overlap with Sp1-like motifs. It has been shown previously that Sp1 and EGR-1 compete for binding to overlapping sites, and it is proposed that EGR-1 displaces Sp1 to mediate activation of some PMA-inducible genes (32). To determine which of these factors bind to the enhancer we performed EMSA and ChIP analyses in PMA/I-stimulated Jurkat cells (Figs. 7A and B). In these studies we also confirmed induction of both IL-3 and GM-CSF mRNA expression (Fig. 7C). EMSAs revealed that the −37 kb EGR-1 motif bound in vitro to both of the constitutively expressed factors Sp1 and Sp3, and to the inducible factor EGR-1 (Fig. 7B). Note, however, that althogh Sp1 and EGR-1 can both bind in EMSAs, where the probe is in excess, these factors cannot bind simultaneosly to the same site in vivo. We used ChIP assays in Jurkat cells to confirm inducible binding of EGR-1 to the −37 kb enhancer, but not the Sp1/EGR-1-like element in the IL-3 promoter (Fig. 7A). However, neither Sp1 nor Sp3 were found by ChIP to bind to the −37 kb enhancer in Jurkat cells (not shown). We suggest that the lack of in vivo Sp1 binding prior to activation may be due to lack of chromatin accessibility within the enhancer in non-stimated cells, whereas EGR-1 may out-compete Sp1 binding after activation once the DHS has formed.

DISCUSSION

Independent regulation of the IL-3/GM-CSF locus

This study establishes that a 130 kb region of the IL-3/GM-CSF locus includes all the DNA elements that are required for its correct developmental and inducible regulation. It also establishes that the IL-3/GM-CSF locus is controlled independently of the downstream Th2 cytokine gene cluster encompassing the IL-4, IL-5, and IL-13 genes which are co-regulated as a separate unit by the Th2 LCR (9). This conclusion is further supported by chromatin cross-linking (3C) assays which detected direct interactions within the nucleus between the Th2 LCR and the IL-4, IL-5, IL-13 genes, but not between the Th2 locus and the IL-3/GM-CSF locus (10). Furthermore, our data provide further evidence suggesting that the closely linked IL-3 and GM-CSF genes are regulated independently of each other. This concept was first proposed on the basis that (a) the GM-CSF gene is expressed efficiently in vivo as an isolated 10 kb transgene (15), (b) the IL-3 insulator effectively blocks activation of the IL-3 promoter by the GM-CSF enhancer (11), and (c) IL-3 and GM-CSF have overlapping, but also unique functions in hematopoietic development. There is also the suggestion that co-expressed genes may actually require independant enhancers that is based on evidence that the beta-globin LCR can only activate one gene in this locus at any one moment in time (33).

In this study we also obtained a fortuitous deletion in line E50 of a conserved sequence 30 kb downstream of the GM-CSF gene, which is homologous to the mouse GM-CSF +34 kb CNSa enhancer (18). However, the activity of this truncated GM-CSF transgene was not substantially different to the intact transgenes, suggesting that CNSa is not playing a major role in the inducible activation of the GM-CSF gene in T blast cells.

Identification of elements controlling IL-3 gene expression

Our analyses revealed the existence of a highly complex 40 kb region extending upstream from the IL-3 gene which encompasses at least three enhancers and a total of 9 additional DHSs that each had inducible and/or tissue-specific properties that mirrored the expression pattern of the IL-3 gene. While it remains likely that many of these upstream elements are required for the correct fine tuning of IL-3 gene expression, the cluster of DHSs that co-localized with conserved sequences in the −33 kb to 40 kb region was particularly prominent as a region closely linked to IL-3 gene expression. This region is reminiscent of LCRs, which typically include both enhancer and non-enhancer elements, such as the β-globin LCR which exists as a complex series of 5 DHSs spread over at least 22 kb upstream of the β-globin gene cluster (34). However, the IL-3 upstream regulatory region also includes inducible tissue-specific DHSs associated with LI-LINE retrotransposons. These DHSs may also make a significant contribution to the normal regulation of the IL-3 gene as there is already some precedent for L1 LINE 5′UTRs directing transcripts within the human genome, and even contributing to tissue-specificity (35). This finding is also reminiscent of the observation that a repeat element has been adopted as a normal component of an enhancer in the Tal1 locus (36), and our previous studies identified aberrant activation of repeat elements as a factor contributing to aberrant gene expression in Hodgkin’s lymphoma (37).

Regulation of the −37 kb IL-3 enhancer

The −37 kb enhancer the stands out as the dominant element controlling the IL-3 gene, considering that (i) the −37 kb enhancer is 10 to 20 times more powerful than either the −14 or −4.5 kb enhancers, (ii) the combination of the −14 and −4.5 kb enhancers was insufficient to support IL-3 gene promoter activity in vivo, (iii) the −14 kb DHS has never been detected in non-leukemic cells, and (iv) the IL-3 −40, −34 and −4.1 kb DHSs lack enhancer activity (12). Like the other previously defined enhancers in the IL-3/GM-CSF locus, the −37 kb enhancer contains ideal consensus binding sites for the Ca2+ inducible factor NFAT and the MAPK-inducible factor AP-1. The −37 kb NFAT and AP-1 sites are, therefore, likely to represent significant targets where the Ca2+ and MAPK TCR signaling pathways converge to activate the IL-3 locus. However, unlike the GM-CSF enhancer and IL-2 promoter, these NFAT and AP-1 motifs do not exist as classical composite NFAT/AP-1 binding sites where these factors bind cooperatively (1, 38).

The exquisite tissue specificity of the −37 kb enhancer may be dictated by a highly conserved 55 bp core segment encompassing GATA, ETS-1 and NFAT motifs. In addition, a highly conserved EGR-1 site exists just downstream of this region. The two ETS-1 motifs and the EGR-1 binding site all contributed significantly to enhancer function in Jurkat T cells. The PU.1 and GATA motifs were not required for function in Jurkat T cells, which lack these factors. However, it is highly significant that essentially all the major regulatory elements in the IL-3/GM-CSF locus encompass GATA motifs (1, 25). These GATA motifs are more likely to be important for promoting inducible expression in progenitor cells and mast cells than in T cells, as is established for GATA motifs in the GM-CSF enhancer and promoter (25). These motifs may also be critical for IL-3 and GM-CSF expression in the emerging hemopoietic system in the embryo (4). Furthermore, because GATA-2 expression is typically maintained in leukaemic cells arising from MP cells, these GATA motifs are also likely to contribute to IL-3 and GM-CSF expression in myeloid leukaemia. Future studies of this locus will now be better equipped to identify the elements that account for the activation of IL-3 expression in CML in response to constitutive tyrosine kinase signaling from the BCR-ABL fusion protein (21). It is also possible that some DHSs in the locus will be disease-specific as the IL-3 −14 kb enhancer DHS has only ever been detected in two cell lines derived from T cell leukemia (12).

The IL-3/GM-CSF locus undergoes a program of developmental regulation

The specific combination of developmentally regulated transcription factor motifs found in the −37 kb enhancer, together with the many RUNX motifs found elsewhere in the locus (1), represents an ideal combination adapted to support gene expression in progenitor cells, mast cells and T cells (25, 39), but not in other cell types. GATA, RUNX and ETS family factors belong to a tight cluster of factors directing combinatorial control in hematopoietic progenitor cells (39).

However, because the −37 kb DHS is strictly inducible, it is likely that the binding of the constitutively expressed factors to the enhancer is dependent on the inducible factors NFAT, AP-1 and EGR-1. This mechanism resembles the GM-CSF enhancer where binding of the tissue-specific factor RUNX-1 is dependent on accessibility to chromatin created by NFAT-dependent chromatin remodeling (25).

Cells with the capacity to express IL-3 and/or GM-CSF arise from two different types of progenitor cell: (i) lymphoid progenitors which can produce either T cells that express both genes, or B cells that express neither gene, and (ii) myeloid progenitors that start out with some capacity to express both genes, and can produce mast cells which up-regulate IL-3 and GM-CSF expression, and monocytes/macrophages that down-regulate both genes. Within the lymphoid lineage the −4.1 and −1.5 kb DHSs were constitutively present in T blast cells and memory T cells but absent in both thymocytes, naive T cells and B cells (24). We also observed some specific differences between the lymphoid and myeloid pathways, with the IL-3 −40.3 and −1.5 kb DHSs being T cell-specific, and the IL-3 −16.4 and −10 kb DHSs being myeloid cell-specific. To a very large extent, the expression levels seen in the different lineages reflect whether or not these cells had acquired these various DHSs.

We observed that some specific DHSs in the IL-3 locus, such as the IL-3 −4.5 and −4.1 kb DHSs, begin to be acquired early during the differentiation process in MPs, and become stronger in IL-3-expressing mast cells, but are extinguished in an alternate differentiation pathway leading to macrophages. We previously proposed that the IL-3 −4.5, −4.1 kb and −1.5 DHSs, which are stably maintained in T blast cells, also play a role in maintaining the locus in a partially active state in memory T cells, priming the locus for activation by inducible enhancers (24). These stably maintained DHSs, and the IL-3 promoter (40), each encompass motifs for RUNX1, a factor known to be required for IL-3 gene expression and expansion of HSCs in the early embryo (4). Hence, it is significant that the constitutive IL-3 −40, −34, and −10 kb DHSs also each encompass RUNX1 motifs. Once the open chromatin regions have formed at each of these DHSs, the RUNX elements may be able to maintain stable RUNX1 binding and thereby maintain the locus in a primed state in both memory T cells and in myeloid cells that have gained the capacity to express RUNX1. Most of these DHSs also encompass motifs for other inducible factors that may be responsible for the initial creation of these DHSs.

The finding that GM-CSF expression was also strongly down-regulated during monocyte/macrophage differentiation was somewhat unexpected. This does not appear to be a cell culture artifact as we obtained similar findings in our studies of freshly isolated spleen CD11b+ monocytic cells stimulated with either PMA/I or LPS (25). Hence, the concept that macrophage-lineage cells produce significant amounts of GM-CSF may be more representative of macrophage progenitor cells which express GATA-2, and primitive cell lines (25), rather than mature monocytes and macrophages which no longer express GATA-2.

Supplementary Material

1

ACKNOWLEDGEMENTS

This work was supported by the AICR, the BBSRC, LLR, the MRC, the EC, and the NH&MRC.

We thank D. Roberts and D. Brooke for making transgenic mice, and H. Tagoh for the CD19 gene probe. We thank Peter Laslo for comments on the manuscript.

Abbreviations used in this paper

IL

Interleukin

GM-CSF

Granulocyte-Macrophage Colony-Stimulating-Factor

HSCs

hematopoietic stem cells

DHS

DNase I Hypersensitive Site

CsA

Cyclosporin A

LCR

locus control region

BAC

bacterial artificial chromosome

PMA

phorbol 12-myristate 13-acetate

MEF

mouse embryonic fibroblast, EMSA, electrophoretic mobility shift assay

ChIP

chromatin immuno-precipitation.

REFERENCES

  • 1.Cockerill PN. Mechanisms of transcriptional regulation of the human IL-3/GM-CSF locus by inducible tissue-specific promoters and enhancers. Crit Rev Immunol. 2004;24:385–408. doi: 10.1615/critrevimmunol.v24.i6.10. [DOI] [PubMed] [Google Scholar]
  • 2.Alexander WS. Cytokines in hematopoiesis. Int Rev Immunol. 1998;16:651–682. doi: 10.3109/08830189809043013. [DOI] [PubMed] [Google Scholar]
  • 3.Nicola NA. Hemopoietic cell growth factors and their receptors. Annu Rev Biochem. 1989;58:45–77. doi: 10.1146/annurev.bi.58.070189.000401. [DOI] [PubMed] [Google Scholar]
  • 4.Robin C, Ottersbach K, Durand C, Peeters M, Vanes L, Tybulewicz V, Dzierzak E. An unexpected role for IL-3 in the embryonic development of hematopoietic stem cells. Developmental cell. 2006;11:171–180. doi: 10.1016/j.devcel.2006.07.002. [DOI] [PubMed] [Google Scholar]
  • 5.He WY, Lan Y, Yao HY, Li Z, Wang XY, Li XS, Zhang JY, Zhang Y, Liu B, Mao N. Interleukin-3 promotes hemangioblast development in mouse aorta-gonad-mesonephros region. Haematologica. 2010;95:875–883. doi: 10.3324/haematol.2009.014241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Gasson JC. Molecular physiology of granulocyte-macrophage colony-stimulating factor. Blood. 1991;77:1131–1145. [PubMed] [Google Scholar]
  • 7.Basu S, Dunn AR, Marino MW, Savoia H, Hodgson G, Lieschke GJ, Cebon J. Increased tolerance to endotoxin by granulocyte-macrophage colony-stimulating factor-deficient mice. Journal of immunology. 1997;159:1412–1417. [PubMed] [Google Scholar]
  • 8.Frazer KA, Ueda Y, Zhu Y, Gifford VR, Garofalo MR, Mohandas N, Martin CH, Palazzolo MJ, Cheng JF, Rubin EM. Computational and biological analysis of 680 kb of DNA sequence from the human 5q31 cytokine gene cluster region. Genome Res. 1997;7:495–512. doi: 10.1101/gr.7.5.495. [DOI] [PubMed] [Google Scholar]
  • 9.Lee GR, Spilianakis CG, Flavell RA. Hypersensitive site 7 of the TH2 locus control region is essential for expressing TH2 cytokine genes and for long-range intrachromosomal interactions. Nat Immunol. 2005;6:42–48. doi: 10.1038/ni1148. [DOI] [PubMed] [Google Scholar]
  • 10.Spilianakis CG, Lalioti MD, Town T, Lee GR, Flavell RA. Interchromosomal associations between alternatively expressed loci. Nature. 2005;435:637–645. doi: 10.1038/nature03574. [DOI] [PubMed] [Google Scholar]
  • 11.Bowers SR, Mirabella F, Calero-Nieto FJ, Valeaux S, Hadjur S, Baxter EW, Merkenschlager M, Cockerill PN. A conserved insulator that recruits CTCF and cohesin exists between the closely related but divergently regulated interleukin-3 and granulocyte-macrophage colony-stimulating factor genes. Mol Cell Biol. 2009;29:1682–1693. doi: 10.1128/MCB.01411-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hawwari A, Burrows J, Vadas MA, Cockerill PN. The human IL-3 locus is regulated cooperatively by two NFAT-dependent enhancers that have distinct tissue-specific activities. J Immunol. 2002;169:1876–1886. doi: 10.4049/jimmunol.169.4.1876. [DOI] [PubMed] [Google Scholar]
  • 13.Bert AG, Burrows J, Hawwari A, Vadas MA, Cockerill PN. Reconstitution of T cell-specific transcription directed by composite NFAT/Oct elements. J Immunol. 2000;165:5646–5655. doi: 10.4049/jimmunol.165.10.5646. [DOI] [PubMed] [Google Scholar]
  • 14.Duncliffe KN, Bert AG, Vadas MA, Cockerill PN. A T cell-specific enhancer in the IL-3 locus is activated cooperatively by Oct and NFAT elements within a DNase I-hypersensitive site. Immunity. 1997;6:175–185. doi: 10.1016/s1074-7613(00)80424-0. [DOI] [PubMed] [Google Scholar]
  • 15.Cockerill PN, Bert AG, Roberts D, Vadas MA. The human GM-CSF gene is autonomously regulated in vivo by an inducible tissue-specific enhancer. Proc Natl Acad Sci U S A. 1999;96:15097–15102. doi: 10.1073/pnas.96.26.15097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Cockerill PN, Shannon MF, Bert AG, Ryan GR, Vadas MA. The granulocyte-macrophage colony-stimulating factor/interleukin 3 locus is regulated by an inducible cyclosporin A-sensitive enhancer. Proc Natl Acad Sci U S A. 1993;90:2466–2470. doi: 10.1073/pnas.90.6.2466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Osborne CS, Vadas MA, Cockerill PN. Transcriptional regulation of mouse granulocyte-macrophage colony-stimulating factor/IL-3 locus. J Immunol. 1995;155:226–235. [PubMed] [Google Scholar]
  • 18.Wurster AL, Precht P, Pazin MJ. NF-kappaB and BRG1 bind a distal regulatory element in the IL-3/GM-CSF locus. Mol Immunol. 2011;48:2178–2188. doi: 10.1016/j.molimm.2011.07.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Johnson BV, Bert AG, Ryan GR, Condina A, Cockerill PN. GM-CSF enhancer activation requires cooperation between NFAT and AP-1 elements and is associated with extensive nucleosome reorganization. Mol Cell Biol. 2004;24:7914–7930. doi: 10.1128/MCB.24.18.7914-7930.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Russell NH. Autocrine growth factors and leukaemic haemopoiesis. Blood Rev. 1992;6:149–156. doi: 10.1016/0268-960x(92)90026-m. [DOI] [PubMed] [Google Scholar]
  • 21.Jiang X, Lopez A, Holyoake T, Eaves A, Eaves C. Autocrine production and action of IL-3 and granulocyte colony-stimulating factor in chronic myeloid leukemia. Proceedings of the National Academy of Sciences of the United States of America. 1999;96:12804–12809. doi: 10.1073/pnas.96.22.12804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Jiang X, Ng E, Yip C, Eisterer W, Chalandon Y, Stuible M, Eaves A, Eaves CJ. Primitive interleukin 3 null hematopoietic cells transduced with BCR-ABL show accelerated loss after culture of factor-independence in vitro and leukemogenic activity in vivo. Blood. 2002;100:3731–3740. doi: 10.1182/blood-2002-05-1324. [DOI] [PubMed] [Google Scholar]
  • 23.Holyoake TL, Jiang X, Jorgensen HG, Graham S, Alcorn MJ, Laird C, Eaves AC, Eaves CJ. Primitive quiescent leukemic cells from patients with chronic myeloid leukemia spontaneously initiate factor-independent growth in vitro in association with up-regulation of expression of interleukin-3. Blood. 2001;97:720–728. doi: 10.1182/blood.v97.3.720. [DOI] [PubMed] [Google Scholar]
  • 24.Mirabella F, Baxter EW, Boissinot M, James SR, Cockerill PN. The human IL-3/granulocyte-macrophage colony-stimulating factor locus is epigenetically silent in immature thymocytes and is progressively activated during T cell development. J Immunol. 2010;184:3043–3054. doi: 10.4049/jimmunol.0901364. [DOI] [PubMed] [Google Scholar]
  • 25.Bert AG, Johnson BV, Baxter EW, Cockerill PN. A modular enhancer is differentially regulated by GATA and NFAT elements that direct different tissue-specific patterns of nucleosome positioning and inducible chromatin remodeling. Mol Cell Biol. 2007;27:2870–2885. doi: 10.1128/MCB.02323-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Butterfield JH, Weiler DA. In vitro sensitivity of immature human mast cells to chemotherapeutic agents. Int Arch Allergy Appl Immunol. 1989;89:297–300. doi: 10.1159/000234963. [DOI] [PubMed] [Google Scholar]
  • 27.Bert AG, Burrows J, Osborne CS, Cockerill PN. Generation of an improved luciferase reporter gene plasmid that employs a novel mechanism for high-copy replication. Plasmid. 2000;44:173–182. doi: 10.1006/plas.2000.1474. [DOI] [PubMed] [Google Scholar]
  • 28.Dickson J, Gowher H, Strogantsev R, Gaszner M, Hair A, Felsenfeld G, West AG. VEZF1 elements mediate protection from DNA methylation. PLoS genetics. 2010;6:e1000804. doi: 10.1371/journal.pgen.1000804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Anderson MK, Hernandez-Hoyos G, Diamond RA, Rothenberg EV. Precise developmental regulation of Ets family transcription factors during specification and commitment to the T cell lineage. Development. 1999;126:3131–3148. doi: 10.1242/dev.126.14.3131. [DOI] [PubMed] [Google Scholar]
  • 30.Liu C, Calogero A, Ragona G, Adamson E, Mercola D. EGR-1, the reluctant suppression factor: EGR-1 is known to function in the regulation of growth, differentiation, and also has significant tumor suppressor activity and a mechanism involving the induction of TGF-beta1 is postulated to account for this suppressor activity. Crit Rev Oncog. 1996;7:101–125. [PubMed] [Google Scholar]
  • 31.Skerka C, Decker EL, Zipfel PF. A regulatory element in the human interleukin 2 gene promoter is a binding site for the zinc finger proteins Sp1 and EGR-1. J Biol Chem. 1995;270:22500–22506. doi: 10.1074/jbc.270.38.22500. [DOI] [PubMed] [Google Scholar]
  • 32.Khachigian LM, Collins T. Inducible expression of Egr-1-dependent genes. A paradigm of transcriptional activation in vascular endothelium. Circ Res. 1997;81:457–461. doi: 10.1161/01.res.81.4.457. [DOI] [PubMed] [Google Scholar]
  • 33.Wijgerde M, Grosveld F, Fraser P. Transcription complex stability and chromatin dynamics in vivo. Nature. 1995;377:209–213. doi: 10.1038/377209a0. [DOI] [PubMed] [Google Scholar]
  • 34.Dillon N, Grosveld F. Transcriptional regulation of multigene loci: multilevel control. Trends in genetics: TIG. 1993;9:134–137. doi: 10.1016/0168-9525(93)90208-y. [DOI] [PubMed] [Google Scholar]
  • 35.Matlik K, Redik K, Speek M. L1 antisense promoter drives tissue-specific transcription of human genes. J Biomed Biotechnol. 2006;2006:71753. doi: 10.1155/JBB/2006/71753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Smith AM, Sanchez MJ, Follows GA, Kinston S, Donaldson IJ, Green AR, Gottgens B. A novel mode of enhancer evolution: the Tal1 stem cell enhancer recruited a MIR element to specifically boost its activity. Genome Res. 2008;18:1422–1432. doi: 10.1101/gr.077008.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Lamprecht B, Walter K, Kreher S, Kumar R, Hummel M, Lenze D, Kochert K, Bouhlel MA, Richter J, Soler E, Stadhouders R, Johrens K, Wurster KD, Callen DF, Harte MF, Giefing M, Barlow R, Stein H, Anagnostopoulos I, Janz M, Cockerill PN, Siebert R, Dorken B, Bonifer C, Mathas S. Derepression of an endogenous long terminal repeat activates the CSF1R proto-oncogene in human lymphoma. Nature medicine. 2010;16:571–579. doi: 10.1038/nm.2129. 571p following 579. [DOI] [PubMed] [Google Scholar]
  • 38.Cockerill PN, Bert AG, Jenkins F, Ryan GR, Shannon MF, Vadas MA. Human GM-CSF enhancer function is associated with cooperative interactions between AP-1 and NFATp/c. Mol Cell Biol. 1995;15:2071–2079. doi: 10.1128/mcb.15.4.2071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wilson NK, Foster SD, Wang X, Knezevic K, Schutte J, Kaimakis P, Chilarska PM, Kinston S, Ouwehand WH, Dzierzak E, Pimanda JE, de Bruijn MF, Gottgens B. Combinatorial transcriptional control in blood stem/progenitor cells: genome-wide analysis of ten major transcriptional regulators. Cell Stem Cell. 2010;7:532–544. doi: 10.1016/j.stem.2010.07.016. [DOI] [PubMed] [Google Scholar]
  • 40.Taylor DS, Laubach JP, Nathan DG, Mathey-Prevot B. Cooperation between core binding factor and adjacent promoter elements contributes to the tissue-specific expression of interleukin-3. J Biol Chem. 1996;271:14020–14027. doi: 10.1074/jbc.271.24.14020. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS49879-supplement-1.pdf (329.2KB, pdf)

RESOURCES