Abstract
Background:
Acinetobacter spp. is characterized as an important nosocomial pathogen and increasing antimicrobial resistance. Our aim was to evaluate antimicrobial susceptibility and aminoglycosides resistance genes of Acinetobacter spp. isolated from hospitalized patients.
Methods:
Sixty isolates were identified as Acinetobacter species. The isolates were tested for antibiotic resistance by disc diffusion method for 12 antimicrobials. The presence of aphA6, aacC1 aadA1, and aadB genes were detected using PCR.
Results:
From the isolated Acinetobacter spp. the highest resistance rate showed against amikacin, tobramycin, and ceftazidim, respectively; while isolated bacteria were more sensitive to ampicillic/subactam. More than 66% of the isolates were resistant to at least three classes of antibiotics, and 27.5% of MDR strains were resistant to all seven tested classes of antimicrobials. The higher MDR rate presented in bacteria isolated from the ICU and blood samples. More than 60% of the MDR bacteria were resistance to amikacin, ceftazidim, ciprofloxacin, piperacillin/tazobactam, doxycycline, tobramycin and levofloxacin. Also, more than 60% of the isolates contained phosphotransferase aphA6, and acetyltransferase genes aacC1, but adenylyltransferase genes aadA1 (41.7%), and aadB (3.3%) were less prominent. 21.7% of the strains contain three aminoglycoside resistance genes (aphA6, aacC1 and aadA1).
Conclusion:
The rising trend of resistance to aminoglycosides poses an alarming threat to treatment of such infections. The findings showed that clinical isolates of Acinetobacter spp. in our hospital carrying various kinds of aminoglycoside resistance genes.
Keywords: Acinetobacter spp., Antibiotic resistance, PCR gene detection, Aminoglycoside resistance genes, Iran
Introduction
Acinetobacter spp. are ubiquitous, non-fermentative, gram-negative bacilli which play a significant role in colonization and infection in hospitalized patients. A. baumannii is the predominant species associated with outbreaks of nosocomial infections (1). Extensive use of antimicrobial chemotherapy in clinical cases has contributed to emergence and dissemination of nosocomial A. baumannii infections. These infections are difficult to treat due to the presence of multidrug-resistant (MDR) organisms, which includes resistance to β-lactams, aminoglycosides, fluoroquinolones and more recently, carbapenems. Administration of combination therapy is usually required for effective treatment (2). Resistance of Acinetobacter spp. to aminoglycosides primarily results from inactivation of the antibiotic by specific modifying enzymes. Multiple aminoglycoside-modifying enzymes including acetylases, adenylases, and phosphorylases and these classes have been identified in Acinetobacter spp. (3–6) The genes encoding aminoglycoside-modifying enzymes may be located on plasmids and transposons, and some of these genes have been found on class 1 integrons in MDR A. baumannii strains in Europe (7–9).
The aim of the present study was to determine the genetic basis of aminoglycoside resistance in A. baumannii strains isolated from hospitalized patients in Kashan, Iran. To this aim, the occurrence of different genes encoding aminoglycoside-modifying enzymes and aminoglycoside resistance phenotypes was investigated.
Materials and Methods
This descriptive study was carried out in Beheshti Hospital (Kashan City, Isfahan Province, Iran) in 2008. It is a tertiary-care 500-bed general teaching hospital. Sixty isolates of Acinetobacter spp. from patients were enrolled in this study. Conventional biochemical tests were used for identification at the species level in 60 gram negative, short rods showing both a negative reaction on oxidase testing and the lack of lactose fermentation. The strains were isolated from blood (58.3%), urine (13.3%), cerebrospinal fluids (8.3%), the trachea (8.3%), sputum (8.3%), and pleural fluid (3.3%) samples. A. baumannii ATCC 19606 (11B) and A. lwoffli ATCC type (13A) strains were used as quality controls in each susceptibility determination. Antimicrobial susceptibility testing was performed on all 60 isolates according to the standard method established by the CLSIs (10). Imipenem (10μg), ciprofloxacin (5μg), levofloxacin (5μg), ceftazidime (30μg), sulbactam/ampicillin (10/10 μg), tazobactam/piperacillin (100/10μg), amikacin (30μg), gentamicin (10μg), tobramicin (10μg), SXT/TMP (1.25/23.75μg), doxycycline (30μg), and minocycline (30μg) disks (Becton Dickinson Microbiology Systems) were used. Multi-drug resistance was defined in this analysis as resistance to three or more representatives of the following classes of antibiotics: quinolones (ciprofloxacin, levofloxacin), broad-spectrum cephalosporins (ceftazidime), beta-lactamase inhibitor/beta-lactams (sulbactam/ampicillin, tazobactam/piperacillin), aminoglycosides (amikacin, gentamicin and tobramycin), tetracyclines (doxycycline, minocycline), trimetprim-sulfamethoxazole and carbapenems (imipenem).
All target genes and corresponding primers used for PCR amplification are listed in Table 1. For PCR, a 1:10 dilution of an overnight culture was boiled for 10 min. Then amplification was performed with 1:10 of this dilution as the DNA template. PCR conditions included 30 cycles of amplification under the following conditions: denaturation at 95° C for 30 sec, annealing at 50° C for 30 sec and then at 40° C for 40 sec, and cycling was followed by a final extension at 72°C for 30 min. PCR products were resolved on 2.0% agarose gels, stained with ethidium bromide, and photo-graphed by UV illumination. Either the 1-kb DNA ladder or the 100-bp DNA ladder (Bio NEER, Korea) was used to assess PCR product size. We investigated genes encoding aminoglycoside resistance genes including aacC1 that confers gentamicin resistance, aadA1 that confers streptomycin and spectinomycin resistance, aadB confers tobramycin, gentamicin, and kanamycin resistance, and aphA6 that confer amikacin, gentamicin, kanamycin, and neomycin resistance.
Table 1:
The various Primers used for amplification of genes from Acinetobacter spp. Isolates
| Primer name | Primer sequence (5′ to 3′) | Target gene(s) | Bp | Reference |
|---|---|---|---|---|
| aacC1-5 | ATGGGCATCATTCGCACATGTAGG | aacC1 | 465bp | 11 |
| aacC1-3 | TTAGGTGGCGGTACTTGGGTC | |||
| aadA1-5 | ATGAG GGAAGCGGTGATCG | aadA1 | 792bp | 11 |
| aadA1-3 | TTATTTGCCGACTACCTTGGTG | |||
| aadB-5 | ATGGACACAACGCAGGTCGC | aadB | 534bp | 11 |
| aadB-3 | TTAGGCCGCATATCGCGACC | |||
| aphA6 FOR | ATGGAATTGCCCAATATTATTC | aphA6 | 797bp | 11 |
| aphA6 REV | TCAATTCAATTCATCAAGTTTTA |
Results
Acinetobacter spp. isolates were recovered from 60 patients including 35 men (58.3%) and 25 women (41.7%). The descriptive statistics of the study population are summarized in Table 2. The mean age of the population was 39.3 (±19.2) yr, with a range of 4 to 85 yr old. Table 3 summarizes the isolation sites and antibiotic resistance patterns found in this study. From the point of view of the hospital departments and type of specimen 86.7% (13/15) of isolates from ICU and 54.3% (19/35) of blood isolates were MDR. The Susceptibility test of Acinetobacter spp. isolates to different antibiotics in our hospital showed the wonderful high resistance rate to amikacin (80%) and tobramicin (68.3%). We found that Acinetobacter spp. was more sensitive to ampicillin/sulbactam than other tested antibiotics. From the 60 isolates, 40 (66.7%) were resistant to at least three classes of antibiotics and classified as multi-drug resistance (MDR). Surprisingly, among the MDR isolates 97.5% were resistant to amikacin, 80% to ceftazidime, 77.5% to ciprofloxacin, 75% to piperacillin/tazobactam, 70% to doxycycline, 65% to tobramicin and levofloxacin, 62.5% to trimthoprim/sulphamethoxazole, 37.5% to imipenem, and 30% to ampicillin-sulbactam and minocycline. Sixty-five percent of the isolates contained the phosphotransferase gene aphA6 which confers to amikacin, gentamicin, kanamycin, and neomycin resistance, 63.3% of isolates contaied acetyltransferase genes aacC1 that confers to gentamicin resistance, and 41.7% contained adenylyltransferase genes aadA1 as streptomycin and spectinomycin resistance, and 3.3% of the isolates contained aadB that confers resistance to tobramycin, gentamicin, and kanamycin. 76.9% of isolates contained the aphA6, and 19 of 25 strains (76%) contained the aadA1, 28 out of 38 (73.7%) isolates with aacC1, and both of two isolates, which contained the aadB, were MDR. Table 4 shows the percentage of aminoglycosides resistance genes detected in Acinetobacter spp. strains according to the site of isolation. The strains carrying aphA6 showed remarkably high level of resistance to amikacin 82.1% (32/39), ceftazidime 76.9% (30/39), ciprofloxacin 66.7% (26/39), and piperacillin/tazobactam 64.1% (25/39). In addition, 11 out of 40 MDR strains (27.5%) were resistant to all of the seven tested classes of antimicrobial agents. Table 5 shows the frequency of aminoglycosides resistance encoding genes detected in Acinetobacter spp. isolates in relation with antibiotics sensitivity patterns.
Table 2:
The demographic characteristics of the study population
| Parameter | No. (%) of patients | Mean±SD (range[minimum, Maximum]) |
|---|---|---|
| Age (yr) | ≤40 29(48.3) | 39.27±19.20( 81[4,85]) |
| > 40 31(51.7) | ||
| Sex (male/female) | 35/25 (58.3/41.7) | |
| Hospital sampling ward | ||
| Emergency room | 24 (40) | |
| Internal medicine | 15( 25) | |
| ICU | 15(25) | |
| Pediatrics | 6(10) |
Table 3:
Antibiotic resistance patterns of Acinetobacter spp. isolates according to the various specimen from the hospitalized patients in Kashan, Iran
| Specimens | No. of isolates | CIP | LVX | CAZ | TOB | AMK | GEN | SXT | IPM | TZP | SAM | MIN | DOX |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Blood stream | 35 | 15 | 9 | 16 | 25 | 27 | 8 | 12 | 8 | 12 | 5 | 14 | 17 |
| Cerebrospinal fluid | 5 | 3 | 4 | 3 | 4 | 5 | 3 | 4 | 1 | 3 | 3 | 3 | 3 |
| Urine | 8 | 5 | 4 | 5 | 6 | 5 | 4 | 6 | 4 | 5 | 2 | 5 | 6 |
| Trachea | 5 | 5 | 5 | 5 | 2 | 5 | 5 | 2 | 1 | 5 | 1 | 3 | 1 |
| Sputum | 5 | 3 | 3 | 5 | 3 | 4 | 3 | 4 | 1 | 4 | 1 | 3 | 2 |
| Pleural fluid | 2 | 2 | 1 | 2 | 1 | 2 | 1 | 1 | 0 | 2 | 0 | 1 | 1 |
| All | 60 | 33 | 26 | 36 | 41 | 48 | 24 | 29 | 15 | 31 | 12 | 29 | 30 |
ciprofloxacin, CIP; levofloxacin, LVX; ceftazidime, CAZ; tobramycin, TOB; Amikacin, AMK; gentamicin, GEN; trimethoprim-sulfamethoxazole, SXT; imipenem, IPM; piperacillin-tazobactam, TZP; ampicillin-sulbactam, SAM; minocycline, MIN; doxycycline, DOX
Table 4:
The percentage of aminoglycosides resistance gene detected in Acinetobacter spp. strains according to the site of isolation
| Genes | Blood stream | Cerebrospinal fluid | urine | Trachea | Sputum | Pleural fluid | Gene detection in isolates No. (%) |
|---|---|---|---|---|---|---|---|
| aphA6 | 19 | 4 | 7 | 5 | 3 | 1 | 39(65) |
| aacC1 | 21 | 3 | 6 | 3 | 4 | 1 | 38(63.3) |
| aadA1 | 11 | 2 | 5 | 3 | 3 | 1 | 25(41.7) |
| aadB | 0 | 0 | 1 | 1 | 0 | 0 | 2( 3.3) |
Table 5:
Frequency of aminoglycosides resistance encoding genes detected in Acinetobacter spp. isolates in relation with antibiotics sensitivity patterns
| Antibiotics | aphA6 (No. 39) | aacC1 (No. 38) | aadA1 (No. 25) | ||||||
|---|---|---|---|---|---|---|---|---|---|
|
| |||||||||
| S | I | R | S | I | R | S | I | R | |
| Amikacin(30μg) | 3 | 4 | 32 | 3 | 4 | 31 | 1 | 2 | 22 |
| Gentamicin(10μg) | 16 | - | 23 | 18 | - | 20 | 12 | 1 | 12 |
| Tobramicin(10μg) | 5 | 12 | 22 | 5 | 10 | 23 | 1 | 6 | 18 |
| Tazobactam/Piperacillin (100/10μg) | 10 | 4 | 25 | 12 | 5 | 21 | 5 | 5 | 15 |
| Sulbactam/Ampicillin(10/10μg) | 18 | 10 | 11 | 23 | 8 | 7 | 14 | 5 | 6 |
| Ceftazidime(30μg) | 3 | 6 | 30 | 4 | 9 | 25 | 2 | 6 | 17 |
| Ciprofloxacin(5μg) | 4 | 9 | 26 | 3 | 9 | 26 | 1 | 10 | 14 |
| Levofloxacin(5μg) | 15 | - | 24 | 17 | - | 21 | 12 | - | 13 |
| Imipenem(10μg) | 26 | 1 | 12 | 28 | 1 | 9 | 17 | - | 8 |
| Doxycycline(30μg) | 3 | 13 | 23 | 4 | 12 | 22 | 1 | 10 | 14 |
| Minocycline(30μg) | 3 | 12 | 24 | 1 | 11 | 13 | 3 | 14 | 21 |
| SXT/TMP(1.25/23.75μg) | 2 | 13 | 24 | 3 | 16 | 19 | - | 11 | 14 |
S: sensitive, I: intermediate, R: resistance
Discussion
From the total of the 60 Acinetobacter spp. isolates in the present study, 48 (80%) were identified as A. baumannii, 10% A. lwoffli and 10% as other genomic species of the Acinetobacter. In general, the investigated isolates showed some resistance or decreased susceptibility phenotype mostly to all of the tested antimicrobial agents. Aminoglycoside resistance is common in Acinetobacter and primarily results from inactivation of the antibiotic by specific modifying enzymes such as acetyltransferases, phosphotransferases, and adenylyltransferases (3). Many reports have documented the high rates of antibiotic resistance found in Acinetobacter spp. These organisms are frequently resistant to multiple antimicrobial agents and recently, there are several reports on strains resistant to virtually all clinically relevant drugs (12, 13). Differences in antibiotic susceptibility have been observed between countries, probably as a result of environmental factors and different patterns of antimicrobial usage. Gaur et al, report more than 80% of isolates to be insusceptible to second and third-generation cephalosporins, aminoglycosides, and quinolones (14).
The presence of high frequent aphA6, aacC1 and aadA1 genes are in agreement with the previously published data on clinical isolates of Acinetobacter spp. (15). The presence of at least one of the following aminoglycosides resistance gene was detected in 40 (66.7%) MDR strains: aphA6 (n = 30), aacC1 (n= 28), aadA1 (n= 19) and aadB (n= 2). In this study, 21.7% of the strains have been observed to contain three aminoglycoside resistance genes (aphA6, aacC1 and aadA1). In the present study, bloodstream infections were the most common clinical specimen of Acinetobacter spp. The frequency of isolation and variety of clones isolated bacteria found in clinical specimens in different countries widely varies (16, 17). Potential risk factors for colonization or infection of hospitalized patients with multidrug-resistant Acinetobacter strains include length of ICU stay, underlying diseases, or conditions, exposure to carbapenems or third-generation cephalosporins, hospital size and using urinary catheterization (18, 19). In conclusion, the present study showed that the emergence of Acinetobacter spp. resistance to antimicrobial agents in our hospital is associated with the spread of MDR strains. In summary, more than 60% of MDR Acinetobacter spp. isolated from patients in our hospital were resistant to aminoglycosides, broad-spectrum cephalosporins, piperacillin/tazobactam, doxycycline and trimthoprim/sulphamethoxazole. Aminoglycosides resistance in Acinetobacter spp. has emerged as a significant health problem, leaving limited options for antimicrobial therapy. The findings showed that clinical isolates of Acinetobacter spp. in our hospital carrying various kinds of aminoglycoside resistance genes.
Ethical Consideration
All Ethical issues (such as informed consent, conflict of interest, plagiarism, misconduct, co-authorship, double submission, etc) have been considered carefully.
Acknowledgments
The study is supported by Kashan University of Medical Sciences Research fund. We are grateful to Dr Kamran Dastehgoli for his help in preparation of this manuscript.
References
- 1.Magnet S, Courvalin P, Lambert T. Resistance-Nodulation-Cell Division-Type Efflux Pump Involved in Aminoglycoside Resistance in Acinetobacter baumannii Strain BM4454. Antimicrob Agents Chemother. 2001;45(12):3375–80. doi: 10.1128/AAC.45.12.3375-3380.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Mak JK, Kim MJ, Pham J, Tapsall J, White PA. Antibiotic resistance determinants in nosocomial strains of multidrug-resistant Acinetobacter baumannii. J Antimicrob Chemother. 2009;63(1):47–54. doi: 10.1093/jac/dkn454. [DOI] [PubMed] [Google Scholar]
- 3.Lambert T, Rudant E, Bouvet P, Courvalin P. Molecular basis of aminoglycoside resistance in Acinetobacter spp. J Med Microbiol. 1997;46:731–35. [Google Scholar]
- 4.Vila J, Marcos A, Marco F, Abdalla S, Vergara Y, Reig R, et al. In vitro antimicrobial production of beta-lactamases, aminoglycoside-modifying enzymes, and chloramphenicol acetyltransferase by and susceptibility of clinical isolates of Acinetobacter baumannii. Antimicrob Agents Chemother. 1993;37:138–41. doi: 10.1128/aac.37.1.138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Miller GH, Sabatelli FJ, Naples L, Hare RS, Shaw KJ. The most frequently occurring aminoglycoside resistance mechanisms- combined results of surveys in eight regions of the world. The Aminoglycoside Resistance Study Groups. J Chemother. 1995;7(Suppl. 2):17–30. [PubMed] [Google Scholar]
- 6.Seward RJ, Lambert T, Towner KJ. Molecular epidemiology of aminoglycoside resistance in Acinetobacter spp. J Med Microbiol. 1998;47:455–462. doi: 10.1099/00222615-47-5-455. [DOI] [PubMed] [Google Scholar]
- 7.Nemec A, Dolzani L, Brisse S, van den Broek P, Dijkshoorn L. Diversity of aminoglycoside-resistance genes and their association with class 1 integrons among strains of pan-European Acinetobacter baumannii clones. J Med Microbiol. 2004;53(Pt 12):1233–40. doi: 10.1099/jmm.0.45716-0. [DOI] [PubMed] [Google Scholar]
- 8.Gombac F, Riccio ML, Rossolini GM, Lagatolla C, Tonin E, Monti-Bragadin C, et al. Molecular characterization of integrons in epidemiologically unrelated clinical isolates of Acinetobacter baumannii from Italian hospitals reveals a limited diversity of gene cassette arrays. Antimicrob Agents Chemother. 2002;46:3665–68. doi: 10.1128/AAC.46.11.3665-3668.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Ribera A, Vila J, Fernández-Cuenca F, Martínez-Martínez L, Pascual A, Beceiro A, et al. Type 1 integrons in epidemiologically unrelated Acinetobacter baumannii isolates collected at Spanish hospitals. Antimicrob Agents Chemother. 2004;48:364–65. doi: 10.1128/AAC.48.1.364-365.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.National Committee for Clinical Laboratory Standards Performance standards for antimicrobial disk susceptibility tests. 2000. Approved standard, 7th ed, document M2-A7. NCCLS, Wayne, PA, USA.
- 11.Hujer KM, Hujer AM, Hulten EA, Bajaksouzian S, Adams JM, Donskey CJ, et al. Analysis of Antibiotic Resistance Genes in Multidrug-Resistant Acinetobacter sp. Isolates from Military and Civilian Patients Treated at the Walter Reed Army Medical Center. Antimicrob Agents Chemother. 2006;50(12):4114–23. doi: 10.1128/AAC.00778-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Lu Q, Huang LS, Zhang R, Xu GB, Zhao XY. Following-up of nosocomial lower respiratory infection in patients with hematological malignance after chemotherapy. Zhonghua Yu Fang Yi Xue Za Zhi. 2008;42(2):123–26. [PubMed] [Google Scholar]
- 13.Giamarellou H, Antoniadou A, Kanellakopoulou K. Acinetobacter baumannii: a universal threat to public health? Int J Antimicrob Agents. 2008;32(2):106–19. doi: 10.1016/j.ijantimicag.2008.02.013. [DOI] [PubMed] [Google Scholar]
- 14.Gaur A, Garg A, Prakash P, Anupurba S, Mohapatra TM. Observations on carbapenem resistance by minimum inhibitory concentration in nosocomial isolates of Acinetobacter species: an experience at a tertiary care hospital in North India. J Health Popul Nutr. 2008;26(2):183–88. [PMC free article] [PubMed] [Google Scholar]
- 15.Shaw KJ, Rather PN, Hare RS, Miller GH. Molecular genetics of aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying enzymes. Microbiol Rev. 1993;57:138–63. doi: 10.1128/mr.57.1.138-163.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Shiri N-V, Ronen B-A, Yehuda C. Update on Pseudomonas aeruginosa and Acinetobacter baumannii infections in the health-care setting. Curr Opin Infect Dis. 2005;18:306–13. doi: 10.1097/01.qco.0000171920.44809.f0. [DOI] [PubMed] [Google Scholar]
- 17.Van Looveren M, Goossens H. ARPAC Steering Group. Antimicrobial resistance of Acinetobacter spp. in Europe. Clin Microbiol Infect. 2004;10:684–704. doi: 10.1111/j.1469-0691.2004.00942.x. [DOI] [PubMed] [Google Scholar]
- 18.Cisneros JM, Rodríguez-Baño J, Fernández-Cuenca F, Ribera A, Vila J, Pascual A, et al. Risk-factors for the acquisition of imipenem-resistant Acinetobacter baumannii in Spain: a nationwide study. Clin Microbiol Infect. 2005;11:874–79. doi: 10.1111/j.1469-0691.2005.01256.x. [DOI] [PubMed] [Google Scholar]
- 19.Prashanth K, Badrinath S. Nosocomial infections due to Acinetobacter species: clinical findings, risk and prognostic factors. Ind J Med Microbiol. 2006;24:39–44. doi: 10.4103/0255-0857.19893. [DOI] [PubMed] [Google Scholar]