Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Nov 1.
Published in final edited form as: Immunogenetics. 2010 Jun 29;62(8):491–498. doi: 10.1007/s00251-010-0458-8

Thirty allele-level haplotypes centered around KIR2DL5 define the diversity in an African American population

LiHua Hou 1, Minghua Chen 1, Bo Jiang 1, DongYing Wu 2, Jennifer Ng 1, Carolyn Katovich Hurley 1
PMCID: PMC3485642  NIHMSID: NIHMS411134  PMID: 20585770

Abstract

KIR2DL5 alleles were physically linked to alleles at adjacent KIR loci to define this region of KIR haplotypes in 55 gene positive random African Americans. The majority carried KIR2DL5B. Three KIR2DL5A and six KIR2DL5B alleles that have been previously described and 11 novel KIR2DL5 alleles were identified by DNA sequencing. Novel alleles included variation that may impact promoter activity; two alleles carried nonsynonymous coding region variation. Based on linkage with KIR2DS1, KIR2DS3, KIR2DS5, KIR2DL2, KIR2DL3, and KIR3DS1 alleles, 7 haplotypes of KIR2DL5A and 23 haplotypes of KIR2DL5B were observed. The phylogenetic relationships among the KIR2DL5 alleles predicted their association with either KIR2DS3 (6 alleles) or KIR2DS5 (7 alleles). All of the KIR2DL5A alleles were linked either to KIR3DS1*01301 or KIR3DS1*049N. The majority of the KIR2DL5B alleles were linked to seven KIR2DL2 alleles; two were linked to a novel allele of KIR2DL3. These findings underscore the diversity of KIR haplotypes present in this population.

Keywords: natural killer cell, cell surface receptor, killer cell immunoglobulin-like receptor, haplotypes, polymorphism, population study

Introduction

The human natural killer cell immunoglobulin-like receptor (KIR) KIR2DL5 gene arises from an ancient lineage with orthologs identified in nonhuman primates (Hershberger et al. 2005;Khakoo et al. 2000;Rajalingam et al. 2004). KIR2DL5 is classified as an inhibitory receptor but its ligand is not yet known (Estefania et al. 2007;Yusa et al. 2004). Its D0-D2 domain structure (specified by exons 3 and 5 in the absence of exon 4) distinguish it and KIR2DL4 from the other two domain KIR that are characterized by a D1-D2 structure (specified by exons 4 and 5 with the inactivation of exon 3) (Vilches et al. 2000b).

The gene encoding KIR2DL5 is duplicated in some KIR haplotypes (Gomez-Lozano et al. 2002). KIR2DL5B lies in the centromeric region of the KIR gene complex, flanked by KIR2DL2 (or KIR2DL3) at its 5’ end and by KIR2DS3 (or KIR2DS5) at its 3’ end (Du et al. 2008;Ordonez et al. 2008). KIR2DL5A lies in the telomeric region flanked by KIR3DS1 (5’) and KIR2DS3 (or KIR2DS5) and KIR2DS1 (3’). The KIR2DL5 gene is usually found in a subset of KIR haplotypes designated as B which are marked by an increased activating KIR gene content (Hsu et al. 2002;Marsh et al. 2003a).

Both KIR2DL5A and KIR2DL5B are polymorphic, encoding eight and thirteen alleles respectively (IPD-KIR database release 2.1.0) (Robinson et al. 2010). Many of the KIR2DL5B alleles are not expressed due to variation in transcription factor binding sites, including runt-related transcription factor-3 (RUNX3) (also known as AML2) (Vilches et al. 2000a;Vilches et al. 2000b), Yin Yang 1 (YY1) and specificity protein 1 (Sp1)(Davies et al. 2007;Li et al. 2008). Variation in the balance between forward and reverse transcripts impacted by allelic polymorphism alters expression levels. Reduced promoter activity may lead to epigenetic silencing mediated by methylation (Gomez-Lozano et al. 2007).

The purpose of this study was to evaluate 2DL5 allelic diversity in an African American population and to identify alleles at flanking loci to define this region of KIR haplotypes.

Materials and Methods

Human studies were approved by the Georgetown University Institutional Review Board and conform to standards laid down in the 1964 Declaration of Helsinki. Genomic DNA was isolated from Epstein Barr Virus-transformed B-cell lines from 100 unique and unrelated African Americans from the National Institute of General Medical Sciences (NIGMS) Human Genetics Resource Center DNA and Cell Line Repository (http://ccr.coriell.org/nigms/) using a QIAamp® DNA Blood Mini Kit (Qiagen, Valencia, CA). Characterization of the KIR2DS1, KIR2DS3, KIR2DS5, and KIR3DS1 alleles carried in this population has already been reported (Hou et al. 2009;Jiang et al. 2010). The strategy for KIR2DL5 allele characterization has been described previously; two overlapping amplicons cover the 5’ upstream region from -274 through the 3’UTR (Mulrooney et al. 2008). KIR2DL2/2DL3 alleles were identified by the DNA sequencing of overlapping amplicons using PCR primers listed in supplemental Table 1. An exception was KIR2DL3 amplicons B and C where one of the two PCR primers yielding each amplicon annealed in intron 5 but did not produce overlapping fragments. In some cases, other closely related KIR loci coamplified with some of the amplicons and required additional strategies. KIR2DL2-999T and KIR2DL3-1316T HaploPrep™ separation kits (Qiagen, Valencia, CA) were used to isolate specific KIR2DL2/2DL3 alleles from those cell lines shown to carry KIR2DL1, KIR2DS2 or both KIR2DL2 and KIR2DL3. Probe 2DL2-999T targets nucleotide position 708 in exon 6 shared by all known KIR2DL2 alleles except KIR2DL2*004 and absent from KIR2DL3. The probe 2DL3-1316T targets nucleotide 1024 in exon 9 which is found in all alleles of KIR2DL3 but not in KIR2DL2. Cleavage of KIR2DP1 with the restriction enzyme BclI eliminated its coamplification with amplicon A of KIR2DL3 and reduced the background observed in sequencing amplicon B. Genomic DNA (2ug) was digested using 3 ul Bc1I (15 Units/ul; New England BioLabs, Ipswich, MA) in 1X NE buffer 3 in a total volume of 200 ul at 50°C for 1hr. DNA was isolated using phenol: chloroform and ethanol precipitation and PCR amplification performed as described.

KIR2DL5 and KIR2DL2/KIR2DL3 amplicons were purified using AmPure magnetic beads (Agencourt Bioscience, Beverly MA). Sequencing was performed using Applied Biosystems’ BigDye Terminator Ready Reaction mix (Applied Biosystems, Foster City, CA). Sequencing primers were positioned to obtain the sequence of both strands of each amplicon (supplemental Table 2 for KIR2DL2/2DL3) (Mulrooney et al. 2008). Some of the primers for KIR2DL2/2DL3 were specific for polymorphisms that distinguished alleles and/or reduced the background from contaminating loci. The reactions were purified using CleanSEQ (Agencourt Bioscience). Sequencing products were detected using an Applied Biosystems 3730XL DNA analyzer. Sample files were analyzed using Sequencher (Genecodes Corp., Ann Arbor, MI) and Assign SBT 3.2.7 (Conexio Genomics, Applecross, Western Australia) software. Sequences were compared to known KIR sequences obtained from the IPD-KIR database version 2.1.0 to determine allelic assignments. Proximal promoter sequences were compared to known KIR sequences from sources previously described (Mulrooney et al. 2008). In this report, the numbering of nucleotides and codons are based on IPD-KIR unless noted.

In heterozygotes, novel alleles were isolated using allele specific amplification, HaploPrep kits (Qiagen, Valencia, CA) or by cloning and characterized by DNA sequencing. Allele designations for novel alleles were assigned by the WHO Nomenclature Committee for Factors of the HLA System (Marsh et al. 2003b).

Adjacent genes, KIR2DS3, KIR2DS5, and KIR2DS1, were identified in all KIR2DL5 positive cells by extracting DNA fragments with probes 2DS3-867A, 2DS5-493C or 2DS1-563A (HaploPrep) followed by detection of KIR2DL5 on the fragment by sequencing. Long-range PCR was used to link KIR3DS1 or KIR2DL2/2DL3 to KIR2DL5 alleles in cases of a novel allele or a novel allele combination defining a haplotype using a sense primer annealing in the 5’ gene (3DS1-SSPF- GGCAGAATATTCCAGGAGG, 2DL2-E6F-708T- TCACCCACTGAACCAAGCTCT, and 2DL3-SSPF- CCTTCATCGCTGGTGCTG) and an antisense primer annealing in KIR2DL5 (GGGGTCACAGGGCCCATGAGGAT). Haplotype specific extraction was also used to link KIR2DL2/2DL3 or KIR3DL1/KIR3DS1 to KIR2DL5 using probes 2DL2-999T, 2DL3-1316T, 3DL1-1156C, 3DS1-556T, and 2DL5-784A (HaploPrep).

The nucleotide sequences of KIR2DL5 were aligned by MUSCLE (Edgar 2004) and a maximum likelihood tree was built using PHYML (version 3.0, BIONJ distance-based tree as the starting tree, GTR as the substitution model)(Guindon and Gascuel 2003).

Results

KIR2DL5B predominates in a population with high KIR2DL5 allelic diversity

Fifty five of 100 random African Americans carried KIR2DL5; 31% carried KIR2DL5A and 82% carried KIR2DL5B. This is consistent with the distribution previously observed in a population of 32 African Americans (Du et al. 2008). In contrast, in European Americans, the majority of KIR2DL5 positive individuals carry KIR2DL5A (83%) compared to KIR2DL5B (49%) (Mulrooney et al. 2008). Sequencing of 254 base pairs of the 5’ upstream region and the entire coding region of KIR2DL5 identified three known KIR2DL5A alleles, six known KIR2DL5B alleles, and 11 novel alleles (Table 1). A comparison with a similar study in European Americans (n=74) (Mulrooney et al. 2008) shows three alleles present in >10% of gene positive individuals in African Americans and four in European Americans; two of these frequent alleles (KIR2DL5A*0010101 found in 22% of African Americans and 63% of European Americans; KIR2DL5B*0020101 found in 33% and 29%, respectively) are common in both populations. Frequent KIR2DL5B*00601 (20%) in African Americans was not observed in European Americans; frequent KIR2DL5B*0020102 (14%) in European Americans was not observed in African Americans. Seventeen alleles are found at frequencies <10%--each of these alleles was found in from one to three African American individuals. In contrast, in European Americans, three alleles at frequencies <10% were found in single individuals. Thus, African Americans appear to carry a broader spectrum of KIR2DL5 alleles compared to an European American population.

Table 1.

Number of individuals carrying KIR2DL5 alleles in a population of 100 random African Americansa.

KIR2DL5A* Number individuals KIR2DL5B* Number individuals
0010101 12 0020101 (or 0020103)c 18
00102 1 0020104b 1
0050101 2 0020106b 2
01201b 1 00202b 1
01202b 1 003 1
004 3
00601 11
00603b 3
0070102b 1
0080101 3
0080102b 1
010 1
01301b 1
01302b 1
01303b 1
Open in a new tab
a

Seven individuals carried KIR2DL5A and KIR2DL5B and five carried two KIR2DL5B alleles. One individual apparently carrying three KIR2DL5 alleles was not included in this table.

b

Novel, described in this study

c

KIR2DL5B*0020101 and KIR2DL5B*0020103 differ in an intron and were not distinguished in this study.

The identity of the 11 novel alleles as KIR2DL5A versus KIR2DL5B was determined by sequence homology to known alleles and by physically linking the new allele to its 5’ neighboring gene, either to KIR3DS1 for KIR2DL5A or to KIR2DL2 (or KIR2DL3) for KIR2DL5B (Hsu et al. 2002). Novel alleles differing in their coding sequences included KIR2DL5A*01201 with a substitution in the signal peptide and KIR2DL5B*01301 with a substitution in the second extracellular domain (Table 2). Six alleles had synonymous substitutions including variants of the two novel alleles described above.

Table 2.

Novel alleles

Novel allele Most similar allele Promoter variationa Codon (amino acid) substitutiona Gene 5’ Cell GenBank accession number
2DL5A*01201 2DL5A*0010101 -1 ACA (T) => CCA (P) KIR3DS1 GM17114 FJ824674
2DL5A*01202 2DL5A*01201 210 TCC (S) => TCG (S), 345 GCT (A) => GCC (A) KIR3DS1 GM17102 FJ804063
2DL5B*0020104 2DL5B*0020101 -23 T => C KIR2DL2 GM17173 FJ804070
2DL5B*0020106 2DL5B*0020101 -239G => T, -215T => C, -208C => T, -206A => G, -176G => A, -159A => G, -154T => C, -120C => T, -97A => G, -84G => A, -27C => T, -23T => C, -10C => T KIR2DL3 GM17129
GM17178		 FJ804065
2DL5B*00202 2DL5B*0020101 -215T => C, -208C => T, -206A => G, -154T => C, -97A => G, -84G => A, -23T => C 345 GCT (A) => GCC (A) KIR2DL2 GM17187 GU121962
2DL5B*00603 2DL5B*00601 210 TCC (S) => TCG (S), 345 GCT (A) => GCC (A) KIR2DL2 GM17141
GM17160
GM17166		 FJ804069
2DL5B*0070102 2DL5B*0070101 -206A => G, -176G => A, -120C => T KIR2DL3 GM17190 FJ804067
2DL5B*0080102 2DL5B*0080101 -23T => C KIR2DL2 GM17177 FJ804071
2DL5B*01301 2DL5B*0080101 114 CGC (R) => TGC (C), 166 CAC (H) => CAT (H) KIR2DL2 GM17113 FJ804064
2DL5B*01302 2DL5B*01301 4 GGT (G) => GGA (G), 79 CCA (P) => CCG (P), 86 TCA (S) => TCG (S) KIR2DL2 GM17128 FJ804066
2DL5B*01303 2DL5B*01301 -215T => C, 154T => C, -97A => G-84G => A,-23T => C -17 GTC (V) => GTG (V) KIR2DL2 GM17183 FJ824675
Open in a new tab
a

Most similar allele => novel allele

Six of the novel alleles exhibited variation in their 5’ upstream regions from their most similar allele. Four of these alleles, all KIR2DL5B alleles, join KIR2DL5B*003 in carrying the expressed version of the RUNX3 site: KIR2DL5B*0020106, *00202, *0070102, and *01303. Furthermore, two of these alleles, KIR2DL5B*0020106 and KIR2DL5B*0070102, exhibit identical nucleotide changes which alter the binding sites for transcription factors key in the regulation of KIR expression (Davies et al. 2007;Li et al. 2008). Substitution at nucleotide -176 restores the sequence of the Ying Yang 1 (YY1) site; disruption of this site in most KIR2DL5 alleles is thought to increase the strength of the antisense promoter reducing gene expression of KIR2DL5. Variation at -27 alters an Sp1 site, creating a better consensus sequence for specificity protein 1 (Sp1) binding. This latter variation, also found in KIR2DL5B*003 and KIR2DL5B*0070101, has been shown to decrease forward promoter activity reducing expression compared to KIR2DL5A*001 (Li et al. 2008). It is not known how these two nucleotide substitutions will impact the balance between sense and antisense transcripts but expression may vary from the other KIR2DL5B alleles.

Eleven novel KIR2DL2/2DL3 alleles alter the amino acid sequence of the gene located 5’ of KIR2DL5B

Alleles present at the KIR2DL2/2DL3 locus were identified by DNA sequencing in preparation for defining their association with KIR2DL5B alleles. In addition to six previously reported alleles, four KIR2DL2 and seven KIR2DL3 novel alleles were detected in 100 African Americans (Table 3). Two of the four novel KIR2DL2 alleles carried single nonsynonymous substitutions altering D1 or transmembrane regions compared to their most similar alleles. Five of seven novel KIR2DL3 alleles carried one or two nonsynonymous substitutions altering D1, D2 or cytoplasmic tail regions.

Table 3.

Novel KIR2DL2/KIR2DL3 alleles

Sample ID Locus Most Similar Allele WHO namea Codons (Amino Acid) Altered GenBank Accession No.
GM17109 2DL2 003 2DL2*00601 16 CGC (R) => CCC (P) EU933932
GM17115 2DL2 003 2DL2*00602 16 CGC (R) => CCC (P), 31 GAT (D) => GAC (D) EU933933
GM17134 2DL2 001 2DL2*007 232 GTC (V) => GCC (A) EU933935
GM17140 2DL2 001 2DL2*00102 80 TAC (Y) => TAT (Y) EU933931
GM17113 2DL3 001 2DL3*00102 246 CGC (R) => CGG (R) GU138980
GM17159 2DL3 006 2DL3*012 255 GTT (V) => GCT (A), 299 TCT (S) => TTT (F) GU138983
GM17160 2DL3 001 2DL3*00103 59G TC (V) => GTT (V) GU138984
GM17172 2DL3 001 2DL3*013 131 CGG (R) => CAG (Q) GU138986
GM17127 2DL3 001 2DL3*011 114 CCG (P) => CTG (L) GU138982
GM17190 2DL3 005 2DL3*014 11 CGG (R) => CTG (L), 142 GAG (E) => GAA (E), 297 CAC (H) => CGC (R) GU138979
GM17199 2DL3 001 2DL3*016 123 AGC (S) => AAT (N), 282 TAT (Y) => TAC (Y) GU573764
Open in a new tab
a

The names are alleles are assigned by the World Health Organization Nomenclature Committee for Factors of the HLA System (Marsh et al. 2003b).

Linkage defines 30 allelic haplotypes centered around KIR2DL5

Table 4 shows the linkage of KIR2DL5 alleles with alleles at nearby loci defining these centromeric and telomeric regions of the KIR haplotypes. The association with KIR2DS3 or KIR2DS5 was observed to parallel the nucleotide sequence homology as identified by a phylogenetic tree of KIR2DL5 coding sequences (Figure 1). Alleles clustered with KIR2DL5B*0020101 are associated with KIR2DS3; alleles clustered with KIR2DL5A*0010101 are associated with KIR2DS5. Both KIR2DL5A and KIR2DL5B alleles and both expressed and non-expressed alleles are found in each cluster.

Table 4.

Centromeric and telomeric haplotypesa associated with KIR2DL5

Haplo No. Individuals 2DL2 2DL3 2DL5B 2DS3 2DS5 Haplo No. Individuals 3DS1 2DL5A 2DS3 2DS5 2DS1
C1 14 2*00101 *0020101/03 3*00103 T1 9 *01301 *0010101 5*00201 *00201
C2 1 2*00101 *0020101/03 3*00105 T2 1 *01301 *0010101 5*00201 *006
C3 1 2*00101 *0020101/03 3*004 T3 1 *049N *0010101 5*00201 *00201
C4 1 2*00102 *0020101/03 3*00103 T4 1 *01301 *00102 5*00201 *00201
C5 1 2*00101 *0020104 3*00103 T5 2 *01301 *0050101 3*002 *00201
C6 1 2*00101 *0020106 3*00103 T6 1 *01301 *01201 5*009 *00201
C7 1 3*014 *0020106 3*00103 T7 1 *01301 *01202 5*006 -
C8b 1 2*00301 *00202 3*00106
C9 1 2*004 *003 5*003
C10 3 2*00101 *004 5*006
C11 7 2*00602 *00601 5*007
C12 2 2*00301 *00601 5*009
C13 1 2*00301 *00601 5*00201
C14 1 2*00601 *00601 5*009
C15 3 2*00602 *00603 5*006
C16 1 3*014 *0070102 5*003
C17 1 2*00101 *0080101 5*00201
C18 1 2*00101 *0080101 5*007
C19 1a 2*007 *0080101 5*007
C20 1 2*00301 *0080102 5*009
C21 1 2*00601 *010 3*00104
C22 1 2*00101 *01301 5*005
C23 1 2*00101 *01302 5*00801
Open in a new tab
a

Each haplotype was identified by the physical linkage of adjacent loci in all individuals carrying the haplotype. The exceptions were KIR2DS1 which was not physically linked to adjacent loci in all individuals carrying a particular haplotype and haplotypes C20 (linkage of KIR2DL2) and haplotype C8 which were predicted based on common associations. It is not known whether the gene segments carried in the centromeric gene complex are located on the same chromosome as the telomeric gene complex in individuals who carry both. The number of individuals carrying the haplotype are listed in the table; the table does not include two KIR2DL5 positive individuals in whom haplotypes could not be determined by physical linkage or be predicted. This included the individual carrying novel allele KIR2DL5*01303.

Figure 1.

Figure 1

Open in a new tab

Phylogenetic tree of KIR2DL5 alleles. Alleles cluster into two major groups which correspond with the KIR2DS3 or KIR2DS5 associations observed in our study. The nucleotides that differ among the alleles are shown with their position in the coding sequence. Asterisks following the allele names identify alleles identified in this study.

Linkage of telomeric KIR2DL5A to specific alleles of KIR2DS3 or KIR2DS5 noted by other investigators were observed [KIR2DL5A*0010101 with KIR2DS5*00201 (11 individuals); KIR2DL5A*0050101 with KIR2DS3*002 (2 individuals)] (Middleton et al. 2007;Ordonez et al. 2008). Three additional haplotypes of KIR2DL5A with KIR2DS5 were identified: one silent variation of KIR2DL5A*0010101 (KIR2DL5A*00102) remains associated with KIR2DS5*00201 and two new haplotypes include novel alleles, KIR2DL5A*01201 and KIR2DL5A*01202. Five of the six KIR2DL5A haplotypes include KIR3DS1*01301; one is linked to KIR3DS1*049N. Although also found in the absence of KIR2DL5A, KIR2DS1 was found linked to KIR2DL5A in 15 of 16 individuals. The majority of haplotypes contain the predominant KIR2DS1*00201 (Middleton et al. 2007); one included KIR2DS1*006.

In the centromeric KIR2DL5B complex, the previously noted association of KIR2DL5B*0020101/03 with KIR2DS3*00103 (15 out of 55 KIR2DL5 positive individuals) was the most common haplotype in African Americans (Ordonez et al. 2008)). If other flanking loci were considered, 23 haplotypes of KIR2DL5B were observed: nine with KIR2DS3 and 14 with KIR2DS5. Alleles closely related to KIR2DL5B*0020101/03 (e.g. KIR2DL5B*0020104 or KIR2DL5B*010) (Figure 1) remain associated with KIR2DS3*00103 or its silent variants. Other alleles of KIR2DL5B are associated with a number of KIR2DS5 alleles.

The centromeric KIR2DL5B alleles are primarily associated with KIR2DL2 alleles. Seven KIR2DL2 alleles were identified in linkage with KIR2DL5B; the same alleles were found in association with haplotypes carrying either KIR2DS3 or KIR2DS5. Two haplotypes carried KIR2DL3*014 in association with two different KIR2DL5B alleles, one in association with KIR2DS3 and one with KIR2DS5.

Discussion

Few studies have explored KIR haplotype diversity at allele-level resolution. This study of 55 KIR2DL5 positive random African Americans has detected extensive diversity at both the allelic and the haplotypic levels for KIR. Twenty KIR2DL5 alleles are embedded within 30 multi-gene complexes defining either centromeric and telomeric regions of the KIR gene cluster. These gene complexes are further differentiated by the linked alleles at neighboring loci. Specific KIR2DL5 alleles were associated either with KIR2DS3, an apparently non-expressed locus (VandenBussche et al. 2008), or with KIR2DS5, a diverse locus in African Americans (Hou et al. 2009). Other sources of haplotype variability included allelic variation at KIR2DS3 (6 alleles) and KIR2DS5 (7 alleles) as well as at KIR2DS1 (2 alleles), KIR3DS1 (2 alleles), and KIR2DL2/KIR2DL3 (8 alleles). This diversity is reminiscent of the allelic diversity of the HLA haplotypes although the extent of allelic variation at a KIR locus is more subtle. KIR allelic products differ only modestly from one another while HLA allelic variation can be more extensive resulting in many amino acid differences.

The impact of genetic variation on the expressed KIR repertoire and the functional activity of NK cells is yet to be fully understood. The presence of specific KIR genes has been associated with susceptibility or resistance to infectious and autoimmune diseases and to malignancy (Bashirova et al. 2006) (Khakoo and Carrington 2006). In human immunodeficiency virus (HIV) infected individuals, the presence of KIR3DS1 is associated with a delayed progression to AIDS (Martin et al. 2002a) and KIR3DS1 expressing cells inhibit viral replication (Alter et al. 2007). In autoimmune subjects with psoriasis, those carrying activating KIR2DS2 and KIR2DS1 are more likely to develop psoriatic arthritis than subjects without these genes (Martin et al. 2002b). In hematopoietic progenitor cell transplantation for acute myelogenous leukemia, a decreased frequency of relapse has been noted in transplants with donors carrying haplotypes with increased numbers of activating KIR genes (i.e., KIR B haplotypes) (Cooley et al. 2009). The mechanisms by which individual KIR impact disease susceptibility, progression and outcome is not yet clear. While resistance in diseases associated with the presence of inhibitory KIR receptors with known HLA ligands may result from a decreased activation threshold for NK cells (Khakoo et al. 2004), the lack of information on the ligands of other KIR including KIR2DL5 hinders an understanding of mechanisms for those KIR.

Less is known about the impact of KIR allelic polymorphism on the immune response. Allelic variation alters the level of protein expression and the affinity of ligand binding as demonstrated for KIR3DL1 (Sharma et al. 2009;Yawata et al. 2008) and KIR2DL2/KIR2DL3 (Moesta et al. 2008). In HIV infection, allotypic variation of KIR3DL1 influences disease progression and levels of the pathogen in plasma (Martin et al. 2007). In hepatitis C infections, the presence of the KIR2DL3 subset of the KIR2DL2/KIR2DL3 alleles is associated with the resolution of infection in those carrying the appropriate HLA-C ligand (Khakoo et al. 2004). Thus, the unique KIR haplotypes observed in the African American population, coupled with diversity in their HLA ligands, likely result in unique immune response profiles for an individual.

Supplementary Material

1

Acknowledgments

This research is supported by funding from the Office of Naval Research N00014-08-1-1078. The views expressed in this article are those of the authors and do not reflect the official policy or position of the Department of the Navy, the Department of Defense, or the U.S. government.

Footnotes

The authors have no conflicts of interest related to this study.

References

  1. Alter G, Martin MP, Teigen N, Carr WH, Suscovich TJ, Schneidewind A, Streeck H, Waring M, Meier A, Brander C, Lifson JD, Allen TM, Carrington M, Altfeld M. Differential natural killer cell-mediated inhibition of HIV-1 replication based on distinct KIR/HLA subtypes. J Exp Med. 2007;204:3027–36. doi: 10.1084/jem.20070695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bashirova AA, Martin MP, McVicar DW, Carrington M. The Killer Immunoglobulin-Like Receptor Gene Cluster: Tuning the Genome for Defense. Annu Rev Genomics Hum Genet. 2006;7:277–300. doi: 10.1146/annurev.genom.7.080505.115726. [DOI] [PubMed] [Google Scholar]
  3. Cooley S, Trachtenberg E, Bergemann TL, Saeteurn K, Klein J, Le CT, Marsh SG, Guethlein LA, Parham P, Miller JS, Weisdorf DJ. Donors with group B KIR haplotypes improve relapse-free survival after unrelated hematopoietic cell transplantation for acute myelogenous leukemia. Blood. 2009;113:726–32. doi: 10.1182/blood-2008-07-171926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Davies GE, Locke SM, Wright PW, Li H, Hanson RJ, Miller JS, Anderson SK. Identification of bidirectional promoters in the human KIR genes. Genes Immun. 2007;8:245–53. doi: 10.1038/sj.gene.6364381. [DOI] [PubMed] [Google Scholar]
  5. Du Z, Sharma SK, Spellman S, Reed EF, Rajalingam R. KIR2DL5 alleles mark certain combination of activating KIR genes. Genes Immun. 2008;9:470–80. doi: 10.1038/gene.2008.39. [DOI] [PubMed] [Google Scholar]
  6. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32:1792–7. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Estefania E, Flores R, Gomez-Lozano N, Aguilar H, Lopez-Botet M, Vilches C. Human KIR2DL5 is an inhibitory receptor expressed on the surface of NK and T lymphocyte subsets. J Immunol. 2007;178:4402–10. doi: 10.4049/jimmunol.178.7.4402. [DOI] [PubMed] [Google Scholar]
  8. Gomez-Lozano N, Gardiner CM, Parham P, Vilches C. Some human KIR haplotypes contain two KIR2DL5 genes: KIR2DL5A and KIR2DL5B. Immunogenetics. 2002;54:314–9. doi: 10.1007/s00251-002-0476-2. [DOI] [PubMed] [Google Scholar]
  9. Gomez-Lozano N, Trompeter HI, de Pablo R, Estefania E, Uhrberg M, Vilches C. Epigenetic silencing of potentially functional KIR2DL5 alleles: Implications for the acquisition of KIR repertoires by NK cells. Eur J Immunol. 2007;37:1954–65. doi: 10.1002/eji.200737277. [DOI] [PubMed] [Google Scholar]
  10. Guindon S, Gascuel O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol. 2003;52:696–704. doi: 10.1080/10635150390235520. [DOI] [PubMed] [Google Scholar]
  11. Hershberger KL, Kurian J, Korber BT, Letvin NL. Killer cell immunoglobulin-like receptors (KIR) of the African-origin sabaeus monkey: evidence for recombination events in the evolution of KIR. Eur J Immunol. 2005;35:922–35. doi: 10.1002/eji.200425408. [DOI] [PubMed] [Google Scholar]
  12. Hou L, Chen M, Jiang B, Kariyawasam K, Ng J, Hurley CK. In contrast to other stimulatory natural killer cell immunoglobulin-like receptor loci, several KIR2DS5 alleles predominate in African Americans. Hum Immunol. 2009;70:733–7. doi: 10.1016/j.humimm.2009.04.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hsu KC, Chida S, Dupont B, Geraghty DE. The killer cell immunoglobulin-like receptor (KIR) genomic region: gene-order, haplotypes and allelic polymorphism. Immunological Reviews. 2002;190:40–52. doi: 10.1034/j.1600-065x.2002.19004.x. [DOI] [PubMed] [Google Scholar]
  14. Jiang B, Hou L, Chen M, Ng J, Hurley CK. The profile of KIR3DL1 and KIR3DS1 alleles in an African American population resembles that found in African populations. Tissue Antigens. 2010 doi: 10.1111/j.1399-0039.2010.01468.x. In press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Khakoo SI, Carrington M. KIR and disease: a model system or system of models? Immunol Rev. 2006;214:186–201. doi: 10.1111/j.1600-065X.2006.00459.x. [DOI] [PubMed] [Google Scholar]
  16. Khakoo SI, Rajalingam R, Shum BP, Weidenbach K, Flodin L, Muir DG, Canavez F, Cooper SL, Valiante NM, Lanier LL, Parham P. Rapid evolution of NK cell receptor systems demonstrated by comparison of chimpanzees and humans. Immunity. 2000;12:687–98. doi: 10.1016/s1074-7613(00)80219-8. [DOI] [PubMed] [Google Scholar]
  17. Khakoo SI, Thio CL, Martin MP, Brooks CR, Gao X, Astemborski J, Cheng J, Goedert JJ, Vlahov D, Hilgartner M, Cox S, Little AM, Alexander GJ, Cramp ME, O’Brien SJ, Rosenberg WM, Thomas DL, Carrington M. HLA and NK cell inhibitory receptor genes in resolving hepatitis C virus infection. Science. 2004;305:872–4. doi: 10.1126/science.1097670. [DOI] [PubMed] [Google Scholar]
  18. Li H, Pascal V, Martin MP, Carrington M, Anderson SK. Genetic control of variegated KIR gene expression: polymorphisms of the bi-directional KIR3DL1 promoter are associated with distinct frequencies of gene expression. PLoS Genet. 2008;4:e1000254. doi: 10.1371/journal.pgen.1000254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Marsh SG, Parham P, Dupont B, Geraghty DE, Trowsdale J, Middleton D, Vilches C, Carrington M, Witt CS, Guethlein LA, Shilling HG, Garcia CA, Hsu KC, Wain H. Killer-cell immunoglobulin-like receptor (KIR) nomenclature report, 2002. Immunogenetics. 2003a;55:220–6. doi: 10.1007/s00251-003-0571-z. [DOI] [PubMed] [Google Scholar]
  20. Marsh SGE, Parham P, Dupont B, Geraghty DE, Trowsdale J, Middleton D, Vilches C, Carrington M, Witt C, Guethlein LA, Shilling H, Garcia CA, Hsu KC, Wain H. Killer-cell immunoglobulin-like receptor (KIR) nomenclature report, 2002. Tissue Antigens. 2003b;62:79–86. doi: 10.1034/j.1399-0039.2003.00072.x. [DOI] [PubMed] [Google Scholar]
  21. Martin MP, Gao X, Lee JH, Nelson GW, Detels R, Goedert JJ, Buchbinder S, Hoots K, Vlahov D, Trowsdale J, Wilson M, O’Brien SJ, Carrington M. Epistatic interaction between KIR3DS1 and HLA-B delays the progression to AIDS. Nat Genet. 2002a;31:429–34. doi: 10.1038/ng934. [DOI] [PubMed] [Google Scholar]
  22. Martin MP, Nelson G, Lee JH, Pellett F, Gao X, Wade J, Wilson MJ, Trowsdale J, Gladman D, Carrington M. Cutting Edge: Susceptibility to psoriatic arthritis: Influence of Activating Killer Ig-like receptor genes in the absence of specific HLA-C alleles. J Immunol. 2002b;169:2818–22. doi: 10.4049/jimmunol.169.6.2818. [DOI] [PubMed] [Google Scholar]
  23. Martin MP, Qi Y, Gao X, Yamada E, Martin JN, Pereyra F, Colombo S, Brown EE, Shupert WL, Phair J, Goedert JJ, Buchbinder S, Kirk GD, Telenti A, Connors M, O’Brien SJ, Walker BD, Parham P, Deeks SG, McVicar DW, Carrington M. Innate partnership of HLA-B and KIR3DL1 subtypes against HIV-1. Nat Genet. 2007;39:733–40. doi: 10.1038/ng2035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Middleton D, Meenagh A, Gourraud PA. KIR haplotype content at the allele level in 77 Northern Irish families. Immunogenetics. 2007;59:145–58. doi: 10.1007/s00251-006-0181-7. [DOI] [PubMed] [Google Scholar]
  25. Moesta AK, Norman PJ, Yawata M, Yawata N, Gleimer M, Parham P. Synergistic polymorphism at two positions distal to the ligand-binding site makes KIR2DL2 a stronger receptor for HLA-C than KIR2DL3. J Immunol. 2008;180:3969–79. doi: 10.4049/jimmunol.180.6.3969. [DOI] [PubMed] [Google Scholar]
  26. Mulrooney TJ, Hou L, Steiner NK, Chen M, Belle I, Ng J, Hurley CK. Promoter variants of KIR2DL5 add to diversity and may impact gene expression. Immunogenetics. 2008;60:287–94. doi: 10.1007/s00251-008-0273-7. [DOI] [PubMed] [Google Scholar]
  27. Ordonez D, Meenagh A, Gomez-Lozano N, Castano J, Middleton D, Vilches C. Duplication, mutation and recombination of the human orphan gene KIR2DS3 contribute to the diversity of KIR haplotypes. Genes Immun. 2008;9:431–7. doi: 10.1038/gene.2008.34. [DOI] [PubMed] [Google Scholar]
  28. Rajalingam R, Parham P, Abi-Rached L. Domain shuffling has been the main mechanism forming new hominoid killer cell Ig-like receptors. J Immunol. 2004;172:356–69. doi: 10.4049/jimmunol.172.1.356. [DOI] [PubMed] [Google Scholar]
  29. Robinson J, Mistry K, McWilliam H, Lopez R, Marsh SG. IPD--the Immuno Polymorphism Database. Nucleic Acids Res. 2010;38:D863–D869. doi: 10.1093/nar/gkp879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Sharma D, Bastard K, Guethlein LA, Norman PJ, Yawata N, Yawata M, Pando M, Thananchai H, Dong T, Rowland-Jones S, Brodsky FM, Parham P. Dimorphic motifs in D0 and D1+D2 domains of killer cell Ig-like receptor 3DL1 combine to form receptors with high, moderate, and no avidity for the complex of a peptide derived from HIV and HLA-A*2402. J Immunol. 2009;183:4569–82. doi: 10.4049/jimmunol.0901734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. VandenBussche CJ, Mulrooney TJ, Frazier WR, Dakshanamurthy S, Hurley CK. Dramatically reduced surface expression of NK cell receptor KIR2DS3 is attributed to multiple residues throughout the molecule. Genes and Immunity. 2008 doi: 10.1038/gene.2008.91. In press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Vilches C, Gardiner CM, Parham P. Gene structure and promoter variation of expressed and nonexpressed variants of the KIR2DL5 gene. J Immunol. 2000a;165:6416–21. doi: 10.4049/jimmunol.165.11.6416. [DOI] [PubMed] [Google Scholar]
  33. Vilches C, Rajalingam R, Uhrberg M, Gardiner CM, Young NT, Parham P. KIR2DL5, a novel killer-cell receptor with a D0-D2 configuration of Ig- like domains. J Immunol. 2000b;164:5797–804. doi: 10.4049/jimmunol.164.11.5797. [DOI] [PubMed] [Google Scholar]
  34. Yawata M, Yawata N, Draghi M, Partheniou F, Little AM, Parham P. MHC class I-specific inhibitory receptors and their ligands structure diverse human NK-cell repertoires toward a balance of missing self-response. Blood. 2008;112:2369–80. doi: 10.1182/blood-2008-03-143727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Yusa S, Catina TL, Campbell KS. KIR2DL5 can inhibit human NK cell activation via recruitment of Src homology region 2-containing protein tyrosine phosphatase-2 (SHP-2) J Immunol. 2004;172:7385–92. doi: 10.4049/jimmunol.172.12.7385. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS411134-supplement-1.doc (44KB, doc)

RESOURCES