Skip to main content
Frontiers in Genetics logoLink to Frontiers in Genetics
. 2012 Nov 1;3:225. doi: 10.3389/fgene.2012.00225

Validation of Genome-Wide Intervertebral Disk Calcification Associations in Dachshund and Further Investigation of the Chromosome 12 Susceptibility Locus

Mette Sloth Mogensen 1, Karsten Scheibye-Alsing 1, Peter Karlskov-Mortensen 1, Helle Friis Proschowsky 1, Vibeke Frøkjær Jensen 2, Mads Bak 3, Niels Tommerup 3, Haja N Kadarmideen 1, Merete Fredholm 1,*
PMCID: PMC3485664  PMID: 23125846

Abstract

Herniation of the intervertebral disk is a common cause of neurological dysfunction in the dog, particularly in the Dachshund. Using the Illumina CanineHD BeadChip, we have previously identified a major locus on canine chromosome 12 nucleotide positions 36,750,205–38,524,449 that strongly associates with intervertebral disk calcification in Danish wire-haired Dachshunds. In this study, targeted resequencing identified two synonymous variants in MB21D1 and one in the 5′-untranslated region of KCNQ5 that associates with intervertebral disk calcification in an independent sample of wire-haired Dachshunds. Haploview identified seven linkage disequilibrium blocks across the disease-associated region. The effect of haplotype windows on disk calcification shows that all haplotype windows are significantly associated with disk calcification. However, our predictions imply that the causal variant(s) are most likely to be found between nucleotide 36,750,205–37,494,845 as this region explains the highest proportion of variance in the dataset. Finally, we develop a risk prediction model for wire-haired Dachshunds. We validated the association of the chromosome 12 locus with disk calcification in an independent sample of wire-haired Dachshunds and identify potential risk variants. Additionally, we estimated haplotype effects and set up a model for prediction of disk calcifications in wire-haired Dachshunds based on genotype data. This genetic prediction model may prove useful in selection of breeding animals in future breeding programs.

Keywords: canine, intervertebral disk calcification, LD pattern, haplotype effects, resequencing

Introduction

In the dog, herniation of the intervertebral disk is a common cause of neurological dysfunction. Especially the Dachshund is predisposed with a relative risk 10–12 times higher than all other breeds (Priester, 1976; Goggin et al., 2000) and an estimated lifetime occurrence of 19% (Ball et al., 1982). The intervertebral disks lie between adjacent vertebrae in the vertebral column forming cartilaginous joints that allow slight movements between vertebrae. The disks are complex structures consisting of a gelatinous core called the nucleus pulposus, an outer fibrous ring called the annulus fibrosus, and the cartilaginous endplates representing the cranial and caudal boundaries of the intervertebral disk. In the Dachshund and other hypochondroplastic breeds the predisposition to intervertebral disk herniation is the result of an early degenerative process, which can result in disk calcification (Hansen, 1952). The degeneration is preceded by early chondroid metaplasia emerging from the perinuclear zone and affecting the majority of the nucleus pulposus and perinuclear annulus fibrosus with profound matrix changes occurring within the first year of life (Hansen, 1952; Ghosh et al., 1976). Dogs with several disk calcifications are at particular high risk of herniation, while herniation rarely occurs in dogs without disk calcifications (Stigen, 1996; Lappalainen et al., 2001). A radiographic evaluation of the number of calcified disks at 2 years of age is a good indicator for the severity of the degeneration and associates strongly with the occurrence of clinical disk herniation at a later age (Jensen et al., 2008). The severity of disk degeneration among breeds describes a continuous spectrum suggesting a multifactorial etiology involving the cumulative effects of several genes and environmental factors (Ball et al., 1982). Severe disk degeneration with calcification has previously been shown highly heritable in Dachshund with heritability estimates of 0.47–0.87 (Jensen and Christensen, 2000). To decrease the occurrence of clinical disk herniation in the Danish Dachshund population the Danish Dachshund Club (DDC) has established breeding guidelines. Based on radiographic examinations at 24–42 months of age the number of calcified disks is determined and since 2008, DDC has recommended excluding dogs with ≥5 calcified disks from breeding. Since 2009, screening of breeding dogs has been mandatory and breeding values of disk calcification have been estimated, using a BLUP (Best Linear Unbiased Prediction) Animal model.

Within the past few years genome-wide association studies (GWAS) have identified numerous promising signals of association between genetic variants and human traits. The use of high density SNP arrays have also shown strength in disease mapping in dogs and has opened doors toward a greater understanding of the genetic architecture of several complex diseases (Wood et al., 2009; Wilbe et al., 2010; Madsen et al., 2011). The genetic homogeneity existing within dog breeds and the spontaneous occurrence of specific diseases in different breeds indicate a breed specific accumulation of disease causing genetic factors. This provides the dog with some advantages in studying genetic diseases as fewer markers and individuals are needed when compared with human studies (Sutter et al., 2004; Lindblad-Toh et al., 2005). The association signals identified through GWAS most likely represents only markers of putative risk and not the causal variant itself. Therefore, to generate hypothesis about mechanisms underlying a specific phenotype it is important to identify the causal variants themselves. This is often a difficult task and requires extensive efforts. The dog provides an excellent model to study complex diseases through the use of GWAS due to the extensive LD and long haplotype blocks characteristic of single dog breeds. However, because of long ranging LD in the dog genome, disease-associated haplotype blocks are often large, hampering the identification of the causal variant. Consequently, while the high extent of LD existing in the dog population is an advantage in the initial GWAS it may complicate the subsequent identification of the causative variant(s) (Sutter et al., 2004).

To investigate the underlying genetic mechanisms behind disk calcification, blood samples from Danish Dachshunds were collected through collaboration with the DDC. Previously, based on a GWAS in 33 cases and 28 controls using the Illumina CanineHD BeadChip, we identified a major locus associating with intervertebral disk calcification in wire-haired Dachshunds on a genome-wide level on canine chromosome (CFA) 12 nucleotide positions 36,750,205–38,524,449. We discovered 36 markers within the genomic region with p-values between 0.00001 and 0.026 after correcting raw p-values for multiple testing by permutation. This provided clear evidence of the region harboring genetic components affecting the development of disk calcification and thus the risk of disk herniation in wire-haired Dachshunds (Mogensen et al., 2011). The associated locus however requires additional exploration to refine the location of the causal variant(s).

This study was performed within the LUPA project (LUPA)1 to validate the original GWAS finding and characterize the CFA12: 36,750,205–38,524,449 susceptibility locus. Targeted resequencing was performed to identify potential functional SNPs that could explain the association signal and the local LD pattern across the disease-associated region was defined. Furthermore, haplotype window effects on disk calcification were estimated, to pinpoint a sub region more likely to harbor the causal variant(s).

Results

The disease-associated region contains a total of seven annotated protein coding genes in Ensembl (version 66.2); RIMS1, KCNQ5, DPPA5, C6orf221, OOEP_CANFA, DDX43, and MB21D1. Furthermore, the region harbors a number of non-coding RNAs (ncRNAs): cfa-mir-30c-2, cfa-mir-30a as well as three novel ncRNAs. As none of these genes or ncRNAs have previously been known to influence disk calcification resequencing was used to generate a list of potential mutations that could explain the association signal. Using the NimbleGen Sequence Capture technology and the Illumina platform we enriched and sequenced the target region in one affected and one unaffected dog of wire-hair. A summary of the statistics describing the resequencing data is given in Table 1. Enrichment of the selected genomic region resulted in 631 and 356 fold enrichment for the affected and unaffected sample, respectively, compared to the non-enriched library. A high coverage was achieved for both samples with >96% of the target region being covered by at least one read and >70% of the reads mapping uniquely to the target region.

Table 1.

Resequencing statistics.

Affected Unaffected
Average fold enrichment 631 356
Total reads 26,515,913 31,995,941
Uniquely mapped reads 19,007,898 23,112,589
Percent of target region covered by 1+ reads 96.5 96.8
Percent of target region covered by 10+ reads 94.8 95.1
Mean per base coverage 529 648

Average fold enrichment: the PCR efficiency raised to the power of delta-crossing threshold value (delta-Ct). Total reads: the total number of reads. Uniquely mapped reads: reads were aligned to the target region CFA12: 36,702,118–38,574,449 on CanFam2.0 via Bowtie using default parameters. Percent of target region covered by 1+ or 10+ reads: percent of target bases covered by at least one or 10 reads. Mean per base coverage: average number of reads per base.

Using the MAQ software (Li et al., 2008) to infer variants from the alignment, we identified 4119 SNPs and 377 indels in the affected dog and 2956 SNPs and 250 indels in the unaffected dog compared to the reference sequence (CanFam2.0) for the domestic dog (Canis familiaris; female boxer). The case was homozygous for three SNPs in protein coding regions or untranslated regions (UTRs): two synonymous SNPs in MB21D1 and one SNP in the 5′-UTR of KCNQ5, see Table 2. These three variants where selected for genotyping in 56 unaffected and 28 affected wire-haired dogs of standard size. All three variants were found to associate with disk calcification with the SNP in the 5′UTR of KCNQ5 showing the strongest association with a p-value of 1.4 × 10−7, see Table 3. A list of the predicted functional effect on disk calcification for SNPs identified during resequencing can be found in Table A1 in Appendix. By genotyping the three SNPs in a sample of long- and smooth-haired Dachshund, we found no association to disk calcification, data not shown. Instead dogs of these two hair-varieties seem to be fixed for the genotype of affected wire-haired dogs.

Table 2.

SNPs in protein coding regions and UTRs for which the case is homozygous.

SNP position Gene involved Type of SNP Genotype Case/Control Sequencing reads covering the SNP (case/control)
37,871,992 KCNQ5 5′UTR GG/CC (291/371)
38,513,135 MB21D1 Synonymous CC/TT (364/696)
38,514,745 MB21D1 Synonymous TT/AA (1043/1158)

SNP position is according to Ensembl Canis familiaris version 64.2.

Table 3.

Test of association between SNPs and disc calcification.

Location Gene Genotypes and observed frequencies χ2 p-value
37,871,992 KCNQ5 CC GC GG
Controls 7 (0,125) 37 (0,661) 12 (0,214) 31,575 1.4 × 10−7
Cases 1 (0,036) 3 (0,107) 24 (0,857)
38,513,135 MB21D1 TT TC CC
Controls 5 (0,090) 27 (0,482) 24 (0,428) 14,100 0,00087
Cases 1 (0,036) 3 (0,107) 24 (0,857)
38,514,745 MB21D1 AA AT TT
Controls 5 (0,090) 18 (0,321) 33 (0,589) 8,141 0,01707
Cases 1 (0,036) 2 (0,071) 25 (0,893)

The ∼1.8-Mb genomic region on CFA12 associating with disk calcification in Danish wire-haired Dachshund (Mogensen et al., 2011) encompass seven LD blocks identified using the four gamete rule (Wang et al., 2002) in Haploview, see Figure 1. The LD blocks range from 20 to 487 kb in size and all blocks include one or more markers significantly associating with disk calcification on a genome-wide level. The marker with the lowest p-value corrected for multiple testing (Pgenome = 0.00001) is located at nucleotide position 37,480,959 in LD block 3, which spans 185 kb in size.

Figure 1.

Figure 1

Association and LD block analysis of the CFA12: 36,750,205–38,524,449 susceptibility locus in wire-haired Dachshunds. Detailed view of the CFA12 genomic region associating with disk calcification in wire-haired Dachshunds. The x-axis show the position on CFA12 in mega bases (Mb) and the p-values on the y-axis correspond to the p-values from the GWAS in wire-haired dogs corrected for multiple testing (Mogensen et al., 2011), as seen in Table A4 in Appendix. The horizontal dotted line represents the threshold of genome-wide significance. The graphical representation of the LD pattern across the region is generated in Haploview 4.2. LD is specified using the r2-color scheme: r2 = 0: white; 0 < r2 < 1: shades of gray; r2 = 1: black. The black horizontal lines in the Manhatten plot correspond to the position of the LD blocks defined in Haploview.

Linear and logistic regression analyses were performed to investigate the effect of the haplotypes within each window on disk calcification. The maximal number of haplotypes is 2n, where n is the number of SNPs in a window, which mean that 16 haplotypes could be expected in a four-SNP window. However, with the dataset available and the high extent of LD the observed haplotypes for each of the nine haplotype windows ranged from two to four. The overall significance of which haplotype window explained more genetic variation than the other windows were assessed by the coefficient of determination (R2), which provides a measure of how well the haplotype effects fitted in the model predicts the disease outcome (case/control) for a particular dog. In generalized linear model (GLM), residual mean deviance (RMD) was used as an indicator for variance explained by the haplotype window and thus the lower the RMD the better is the model fit. Looking at both the linear model and GLM all haplotype windows are significantly associated with disk calcification; see Table 4. Of the nine haplotype windows, we have identified haplotype window 3 as explaining the highest proportion of variance in the disk calcification dataset followed by haplotype window 1 and 2. Haplotype window 3 CFA12: 37,123,193–37,494,845 covers a part of LD block 2 and the entire LD block 3 identified in haploview. Test of association with disk calcification for particular haplotypes within the different haplotype windows, based on both the linear model and GLM are given in Table A2 in Appendix.

Table 4.

Haplotype substitution effects for disc calcification scored as binary cases/control disc scores.

Haplotype window Nucleotide position on CFA12 Linear model (%) p-value Logistic model p-value
Hap 1 36,750,205–36,909,311 ¤R2 = 73 <0.001 *RMD = 0.64 <0.001
Hap 2 37,056,901–37,119,065 R2 = 73 <0.001 RMD = 0.64 <0.001
Hap 3 37,123,193–37,494,845 R2 = 76 <0.001 RMD = 0.46 <0.001
Hap 4 37,710,073–37,826,314 R2 = 51 <0.001 RMD = 0.92 <0.001
Hap 5 37,847,222–37,944,067 R2 = 68 <0.001 RMD = 0.75 <0.001
Hap 6 37,958,884–38,015,502 R2 = 63 <0.001 RMD = 0.85 <0.001
Hap 7 38,022,379–38,072,703 R2 = 63 <0.001 RMD = 0.82 <0.001
Hap 8 38,079,788–38,229,535 R2 = 63 <0.001 RMD = 0.85 <0.001
Hap 9 38,264,121–38,524,449 R2 = 62 <0.001 RMD = 0.76 <0.001

¤R2 = Percent variability in the data set accounted for by the fitted haplotype window model *RMD, Residual mean deviance is an indicator for goodness of fit (the lower the RMD, the better is the model fit).

Based on these analysis we are able to set up a genetic predictions model for disk calcifications ŷi in Dachshunds of the wire-haired variety given their haplotype or genotype information;

ŷi=α^0+Ŝi+∑J=1pα^J.cHiJ (1)

where, ŷi is the predicted disk calcification for individual i, α^o is the intercept, Ŝi is the estimated sex effect for the ith individual, and α^i α^i is the estimated effect for haplotype Hij for ith individual with haplotype J. Individuals with the least common haplotype were assigned the reference level α^o.

Discussion

We have previously shown that the CFA12: 36,750,205–38,524,449 genomic region associates with disk calcification in wire-haired Dachshund on a genome-wide level (Mogensen et al., 2011). However, a comprehensive study of sequence variation within the region is required to identify the causal variant(s) that might explain the association signal. In this study we have investigated genetic variation within the target region through targeted resequencing in order to identify potential risk variants and validate original GWAS findings. To further investigate the locus we have identified LD block pattern across the disease-associated region and estimated the genetic variation explained by the different haplotype windows. Finally, we have developed a risk prediction model for wire-haired Dachshunds, using the disk calcification and haplotype dataset.

Functional SNPs may have variable effect on protein sequence, transcriptional regulation, splicing, microRNA- and transcription factor binding sites depending on their position and flanking sequences. By targeted resequencing we have made a comprehensive list of potential causal variants that could explain the association signal. A ranking of these SNPs is necessary for follow-up studies to be possible. Numerous SNPs, identified in this study, are predicted to be located within transcription factor binding sites or microRNA-binding sites. Due to the high number of cases sharing the same haplotype we have focused on variants within protein coding regions or UTRs for which the case is homozygous. We have validated the association of one variant in the UTR of KCNQ5 and two synonymous variants in MB21D1 in an independent sample of wire-haired Dachshunds hereby confirming the original GWAS and thus providing further evidence for the association of this region with disk calcification. Disk herniation is also seen in long- and smooth-haired Dachshunds. However, interestingly, both cases and controls within these two hair variants appear to be fixed for the haplotype found in wire-haired cases. Thus, presumably other loci must be involved in the development of the disease in long- and smooth-haired variants. This hypothesis is supported by the fact that when 18 controls and 15 cases of long- and smooth-hair were included in our original GWAS (Mogensen et al., 2011), an additional locus, not appearing when including only wire-haired dogs, was detected on CFA3. However, more dogs are needed to confirm this hypothesis. In terms of SNPs validated in the wire-haired dogs any of the three variants may have a potential functional impact on the phenotype in wire-haired dogs. However, it is more likely that these SNPs are markers in high LD with the actual causal variant(s). Resequencing of the target region in a larger number of affected and unaffected dogs might be necessary to eliminate some of the identified variants before a thorough follow-up on other highly ranked variants can be carried out.

To characterize the CFA12 locus and potentially narrow down the candidate region we looked at the LD block pattern. Haploview identify seven LD blocks across the region associating with disk calcification. Several of the markers showing genome-wide significance are in strong LD (r2 > 0.8) with genome-wide significant markers in other LD blocks indicating the presence of strong LD within the disease-associated region. That this genomic region falls into a segment of strong LD is further documented by 28 of the 33 cases in the GWAS sharing the same haplotype across all 36 genome-wide significant markers within this region (Mogensen et al., 2011). In addition several of the markers show more or less equivalent evidence of association for the given signal indicating that the markers are highly correlated. Given the high extent of LD within this region it is difficult to resolve whether two or more independent loci contribute independent effects to disk calcification.

Analyzing haplotype window effects could potentially pinpoint a haplotype window with a higher effect on disk calcification and thus define or narrow down the region of interest. By estimating the effect of the haplotype windows we have identified window 3 CFA12: 37,123,193–37,494,845 as explaining the largest part of the genetic variation between dogs in our dataset (76%) followed by haplotype window 1 and 2 explaining 73% of the genetic variation. From these results it therefore seems most likely that the causal genetic variant(s) are to be found within the CFA12: 36,750,205–37,494,845 genomic region, which harbors the ncRNAs cfa-mir-30c-2 and cfa-mir-30a as well as a part of RIMS1. However, all haplotype windows explain a fair proportion of the variance in the dataset, which is not surprising due to the large amount of LD within this region. Therefore one needs to be careful when narrowing down the region to these three haplotype windows.

A genetic prediction model for intervertebral disk calcification based on these haplotype effects analyses may form a valuable tool for genetic counseling in the wire-haired Dachshund population.

Genome-wide association studies has to a large extent focused on the detection of effects attributable to common SNPs. Other sequence variants such as rarer variants (MAF of 1–5%) and structural variants are also expected to contribute to the genetic basis of common disease and efforts to detect these genetic variations should be included in future studies. Even when a true causal variant is identified challenges remain in reconstructing the molecular mechanisms whereby the variant have an impact on the phenotype of interest and even more work is necessary in translating these findings into advantages in clinical care. Based on a literature search no genes with a direct biological link is present within the disease-associated region one could speculate whether the region contains a regulatory element controlling the expression levels of a causal gene located either upstream or downstream of the candidate region identified here. One hypothesis is a regulatory variant affecting the expression level of COL9A1. This gene is located ∼1 Mb upstream of the disease-associated region and encodes one of the three alpha chains of collagen IX. Collagen IX serves as a minor component in the annulus fibrosus and the nucleus pulposus and is thought to be involved in maintaining network integrity in the normal disk. Mutations in COL9A2 and COL9A3 have previously been linked to human disk disease (Annunen et al., 1999; Paassilta et al., 2001) and studies in transgenic mice have further demonstrated that mutations in collagen IX can lead to disk degeneration but also degenerative joint disease (Kimura et al., 1996).

Conclusion

In the present study we validate the previously identified association of the locus CFA12: 36,750,205–38,524,449 with disk calcification in an independent sample of wire-haired Dachshund thus providing strong evidence that variation within this locus affect the development of disk calcification in wire-haired Dachshunds. Moreover, our results suggest that the locus falls within a region of strong LD hence complicating the identification of the causal variant. Our predictions on the effect of the nine different haplotype windows on disk calcification imply that the causal variant(s) are to be found within the CFA12: 36,750,205–37,494,845 genomic region, however care must be taken when drawing this conclusion as all haplotype windows explain a reasonable part of the variability in the disk calcification dataset.

Materials and Methods

Animals and diagnostic procedures

This study was confined to Dachshund registered in the DDC. All blood samples included in this study were collected by licensed veterinarians with owners’ consent. Inclusion criteria for sampling were based on radiographic examinations of intervertebral disk calcifications from the second cervical vertebra to the third sacral bone at age 24–42 months (Jensen and Ersbøll, 2000). Information regarding size (standard, miniature, and rabbit), hair variant (wire-haired, long-haired and smooth-haired) sex, age, and pedigree records were obtained from the Danish Kennel Club registry. Disease status of cases and controls were scored based on standard protocol for radiographic examinations; cases were classified as dogs with either ≥6 disk calcifications or dogs that had undergone surgical treatment for disk herniations. Controls were classified as dogs with ≤1 disk calcification. For further information on the distribution of disk calcifications among cases and controls (see Mogensen et al., 2011).

NimbleGen sequence capture array design and data analyses

For targeted resequencing one affected and one unaffected dog was selected. The affected dog had 12 disk calcifications as evaluated from the radiographic examination and was homozygous across the 36 significantly associated markers in the disease-associated region. The unaffected dog had no disk calcifications and was homozygous for the opposite alleles of the affected dog across the entire region. Both were female standard wire-haired dogs and unrelated at great grandparental level. A custom tiling NimbleGen 385K sequence capture array targeting CFA12: 36,702,118–38,574,449 on CanFam2.0 was designed and manufactured by Roche NimbleGen, Madison, WI, USA. The probe set design was approved with the fraction of bases in the target region covered by probes being 96.5%. Genomic DNA was captured following the NimbleGen Sequence Capture protocol (Roche NimbleGen, Madison, WI, USA). In brief, 25 μg genomic DNA was fragmentized by sonication to blunt-ended fragments and hybridized to the custom array. Unbound fragments were washed away. The target-enriched pool was eluted and recovered from the array and amplified by ligation-mediated PCR. Quantitative fluorescence PCR (qPCR) was performed on pre- and post-enriched libraries to calculate relative-fold enrichment of the targeted region. A locus within the target region was selected for qPCR enrichment analysis with the Stratagene Mx3000P qPCR system using the following primers designed using Primer-BLAST (Primer BLAST)2: F: 5′-TGCCTCTGTTGTCCACAGTCAGA-3′; R: 5′-TGCTTGGGGACCTCCTGTCACC-3′. One microgram of captured libraries were subsequently sequenced on the Illumina Genome Analyzer platform as paired end 2 × 36 sequencing reads following the Genome Analyzer User Guide. Bowtie (Langmead et al., 2009) was used to align short read sequence data against the CanFam2.0 reference genome and sequence variants were identified running MAQ (Li et al., 2008) on the reads aligning uniquely to the region.

All SNPs identified from resequencing were evaluated according to their potential functional effect on disk calcification. The SNPs were compared to Ensembl Canis familiaris version 64.2 annotations and predictions and SNPs in protein coding regions or within or near predicted ncRNAs were identified. Further SNPs were evaluated based on a measure of conservation in dog, human, mouse, and rat, position according to transcription start site and end site and if the SNP was likely to change the predicted binding of transcription factors or predicted ncRNAs.

Validation of GWAS findings using TaqMan® SNP genotyping assays

Three SNPs at nucleotide position 37,871,992, 38,513,135 and 38,514,745 were genotyped using Custom TaqMan® SNP Genotyping assays (Applied Biosystems, Foster City, CA, USA) in an independent sample of wire-haired dogs not included in the original GWAS. The sample included 56 controls and 28 cases that had undergone a thorough radiographic examination to determine affection status as descried previously. The primers and probes obtained from the ABI assay kit are specified in Table A3 in Appendix. Reactions were carried out according to the manufacturer’s protocol. Briefly, PCR was performed in the presence of 10 ng genomic DNA, TaqMan® Universal PCR Master Mix, and the SNP Genotyping Assay specific for each SNP. The thermal cycling conditions on Mx3000P™ (Strategene) were 95°C for 10 min, followed by 60 cycles at 92°C for 15 s and 60°C for 1 min. Results were analyzed using the MxPro software and the SNPs were tested for genotypic associations with disk calcification using chi-square test statistics.

Analysis of LD pattern in Haploview

The LD pattern of all 117 SNPs covering the CFA12: 36,750,205–38,524,449 genomic region were analyzed in Haploview 4.2 (Barrett et al., 2005) using SNP genotyping data from the original GWAS with 33 wire-haired cases and 28 wire-haired controls. The four gamete test (Wang et al., 2002) implemented in Haploview using default parameters were used to define the LD block structure and create a graphical representation of the LD pattern. The level of LD is represented by r2-values.

Estimation of haplotype effects on disk calcification

The effect of haplotypes in nine haplotype windows was estimated using data from our previous GWAS on disk calcification (Mogensen et al., 2011). The 30 cases and 23 controls included in the analyses were all of standard size and wire-haired to keep the population as genetically homogeneous as possible. For the 36 genome-wide significant markers within the CFA12: 36,750,205–38,524,449 genomic region we defined haplotype windows with four-SNPs creating nine haplotype windows, see Table A4 in Appendix. The haplotype frequencies and most likely haplotype pair (linkage phase) for each dog were estimated from genotyping data using PHASE v.2.1.1 (Stephens et al., 2001). Since haplotypes are reconstructed from genotype data, there are always two haplotypes per dog for each haplotype window. From the PHASE data each dog was assigned a score of 0, 1, or 2 corresponding to 0 copies, 1 copy, or 2 copies of a given haplotype in a haplotype window. Using this haplotype count data, we estimated the effect of each window on disk calcification in dogs. Preparation of data files and methods used for estimating haplotype substitution effects were according to those described for allele substitution models by Kadarmideen et al. (2011) and Kadarmideen (2008). Estimations of haplotype effects on disk calcification was done on a binary scale as cases = 1 (classified as dogs with ≥6 disk calcifications) and controls = 0 (classified as dogs with 0 or 1 disk calcification). Information on sex was included as fixed effects. All analyses were performed in ASReml 3.0 (Gilmour et al., 2002). Linear and logistic regression models were fitted to binary case/control scores on disk calcification. A standard linear haplotype substitution model was:

yi=α0+Si+∑J=1pαJ.cHiJ+εi (2)

where, for individual i, α0 is the intercept, Si is the sex, and εi is the residual. The term cHiJ is the number of copies (0, 1, or 2) of haplotype J (1 to p). The least common haplotype was set as a reference level (=α0) and the effect of the other haplotypes represents the relative haplotype effect compared to this reference level.

To take the binomial distribution of case/control data we fitted a GLM using the logit link function. The model took the following form:

logπi1-πi=α0+Si+∑j=1pαJ.cHiJ (3)

where πi is the probability of observing a case yi=1 1-πi is the of probability of observing a control yi=0. All analyses were conducted for each haplotype window one at a time. Significance of the model terms was assessed by F-test statistics and associated p-values for each haplotype in each haplotype window and other fixed effects. For the linear model (2), the overall model fit for a particular haplotype window was assessed by R2 values expressed as percentage. This explains the proportion of variance in disk calcification explained by the corresponding haplotype window. Since there is no equivalent expression for R2 in the GLM framework, the logistic model fit was assessed by the RMD. The RMD represent residual effects not explained by the model; hence the lower the RMD the better is the model fit. For both the linear model and GLM, the overall statistical significance was assessed by p-values. It should be noted that linear models (2) were applied to binary case/control data as if they were normally distributed. It has been shown that linear models are quite robust to violation of normality in gene or QTL mapping and association studies and that it is simple to apply and interpret in many studies (Kadarmideen et al., 2000). However, we also applied statistically appropriate GLM to case/control binary data.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Acknowledgments

This work was supported by the European Commission (LUPA-GA-201370); and a Faculty of Life Sciences, University of Copenhagen PhD stipend. The authors thank Olav Nørgaard and Majbritt Hansen for blood sampling. In addition we thank the Danish Dachshund Club and dog owners for contributing and supporting this study.

Appendix

Table A1.

Functional prediction of SNPs homozygous in the case sorted according to genomic position.

TaqMan SNPsa Positionb Case genoc Cons scored Commentse
36750513 GG 10 TSS PROXIMITY miRNA change TFBS change
36751290 GG 19 TSS PROXIMITY
36751590 TT 55 TSS PROXIMITY
36753585 GG 16 TSS PROXIMITY miRNA change TFBS change
36762341 TT 41 TSS PROXIMITY miRNA change
36766398 CC 43 TSS PROXIMITY
36801723 CC 23 TSS PROXIMITY
36803655 CC 16 TFBS change
36809769 CC 62 ncRNA PROXIMITY
36810002 TT 27 TFBS change
36814590 CC 58 TFBS change
36823331 TT 12 miRNA change TFBS change
36823332 GG 12 miRNA change TFBS change
36824279 AA 14 miRNA change TFBS change
36825704 AA 19 TFBS change
36826666 CC 17 TFBS change
36826888 CC 23 miRNA change
36827844 GG 44 miRNA change TFBS change
36840333 TT 23 TFBS change
36846574 CC 14 miRNA change
36847384 TT 13 TFBS change
36850155 CC 12 TFBS change
36853046 GG 13 miRNA change
36853059 GG 14 TFBS change
36853122 CC 16 miRNA change
36860038 TT 16 miRNA change
36871633 AA 11 miRNA change
36886442 AA 14 miRNA change
36887486 GG 12 miRNA change TFBS change
36897624 AA 12 miRNA change
36899830 AA 27 TFBS change
36899834 AA 32 TFBS change
36903284 AA 12 miRNA change TFBS change
36904787 CC 20 TFBS change
36906286 TT 18 miRNA change
36925990 AA 13 TFBS change ncRNA PROXIMITY
36926238 TT 49 TFBS change
36928655 CC 17 TFBS change
36933548 AA 26 miRNA change
36939600 AA 10 miRNA change
36941861 AA 14 miRNA change
36943148 CC 16 miRNA change
36943511 GG 25 TFBS change
36951069 GG 11 miRNA change
36955971 AA 64 TFBS change
36962236 GG 11 miRNA change
36962563 CC 51 miRNA change
36964810 CC 71 TFBS change
36965584 AA 11 TFBS change
36965676 GG 12 miRNA change
36966489 CC 29 TFBS change
36966628 CC 32 miRNA change TFBS change
36968474 AA 15 miRNA change
36971526 AA 11 miRNA change
36985376 CC 30 miRNA change
36985633 GG 14 miRNA change
37025881 CC 11 TSS PROXIMITY
37028436 CC 49 TSS PROXIMITY
37059275 CC 13 miRNA change
37063231 GG 26 TFBS change
37078527 GG 21 miRNA change TFBS change ncRNA prediction
37086384 AA 12 miRNA change
37090854 AA 26 miRNA change
37095837 CC 47 TFBS change
37099752 AA 40 miRNA change
37104620 AA 16 miRNA change
37104814 TT 25 TFBS change
37120008 CC 15 miRNA change
37120009 CC 11 miRNA change
37126044 TT 13 TFBS change
37126067 GG 34 miRNA change TFBS change
37142283 AA 71 miRNA change TFBS change
37187537 TT 30 INTRONIC
37188268 CC 67 INTRONIC
37196342 GG 12 INTRONIC
37200097 GG 48 INTRONIC
37201457 CC 15 INTRONIC
37205397 CC 34 INTRONIC
37205451 TT 19 INTRONIC
37206251 GG 15 INTRONIC
37215701 GG 65 INTRONIC
37219280 CC 33 INTRONIC
37219351 CC 14 INTRONIC
37225007 AA 97 INTRONIC
37225286 TT 13 INTRONIC
37226206 AA 10 INTRONIC
37226855 CC 16 INTRONIC
37228813 CC 11 INTRONIC
37229626 GG 19 INTRONIC
37233185 TT 13 INTRONIC
37234742 AA 31 INTRONIC
37236643 AA 15 INTRONIC
37247325 GG 15 INTRONIC
37250978 CC 80 INTRONIC
37265749 GG 40 INTRONIC
37266392 TT 13 INTRONIC
37284795 TT 13 TFBS change
37287964 GG 37 miRNA change TFBS change
37290783 CC 12 TFBS change
37292365 AA 12 miRNA change
37294131 CC 20 miRNA change
37343613 TT 12 miRNA change TFBS change
37363999 GG 30 TFBS change
37364553 AA 27 TFBS change
37452057 GG 10 INTRONIC
37452124 AA 22 INTRONIC
37458708 CC 12 INTRONIC
37458865 AA 10 INTRONIC
37458871 AA 16 INTRONIC
37459537 GG 40 INTRONIC
37472355 GG 16 INTRONIC
37472611 AA 47 INTRONIC
37476579 TT 30 INTRONIC
37477693 CC 12 INTRONIC
37478601 GG 26 INTRONIC
37480959 CC 30 INTRONIC
37482457 GG 15 INTRONIC
37491502 GG 33 INTRONIC
37492736 AA 21 INTRONIC
37493967 TT 10 INTRONIC
37494406 AA 72 INTRONIC
37494485 CC 14 INTRONIC
37498910 TT 12 INTRONIC
37499390 GG 10 INTRONIC
37502647 GG 27 INTRONIC
37506729 AA 20 INTRONIC
37516868 AA 10 INTRONIC
37521109 TT 87 INTRONIC
37521868 CC 97 INTRONIC
37522527 TT 25 INTRONIC
37529231 TT 13 INTRONIC
37529548 TT 14 INTRONIC
37536096 AA 12 INTRONIC
37538376 AA 16 INTRONIC
37544162 TT 17 INTRONIC
37555733 GG 12 INTRONIC
37555819 CC 13 INTRONIC
37558543 CC 13 INTRONIC
37559687 TT 11 INTRONIC
37561820 CC 27 INTRONIC
37564422 AA 14 INTRONIC
37566512 CC 12 INTRONIC
37568606 CC 15 INTRONIC
37570668 CC 13 INTRONIC
37574392 CC 43 INTRONIC
37574975 GG 10 INTRONIC
37579188 TT 24 INTRONIC
37582007 TT 19 INTRONIC
37582812 GG 16 INTRONIC
37585611 CC 45 INTRONIC
37594353 CC 94 INTRONIC
37598499 CC 57 INTRONIC
37605138 AA 10 INTRONIC
37605139 TT 11 INTRONIC
37605730 AA 15 INTRONIC
37606719 GG 10 INTRONIC
37627824 TT 10 INTRONIC
37658166 TT 11 INTRONIC
37710073 CC 29 TFBS change
37714749 CC 26 TFBS change
37715890 GG 94 TFBS change
37738150 AA 31 miRNA change
37744880 GG 16 miRNA change TFBS change
37750938 AA 10 miRNA change TFBS change
37754220 GG 17 miRNA change
37754259 AA 12 miRNA change
37755267 AA 15 TFBS change
37770210 TT 77 miRNA change
37824729 CC 39 TFBS change
37849581 AA 34 miRNA change
37856808 GG 11 TSS PROXIMITY miRNA change
37856942 AA 20 TSS PROXIMITY
37868611 TT 68 TSS PROXIMITY
37871156 GG 55 TSS PROXIMITY miRNA change TFBS change
* 37871992 GG 68 TSS PROXIMITY TES PROXIMITY miRNA change
37872738 AA 28 TSS PROXIMITY miRNA change TFBS change
37873638 AA 57 TSS PROXIMITY miRNA change
37875270 GG 18 TSS PROXIMITY
37877147 AA 19 TSS PROXIMITY miRNA change TFBS change
37882662 AA 12 TSS PROXIMITY TFBS change
37888494 AA 13 TSS PROXIMITY TFBS change
37891712 AA 14 TSS PROXIMITY
37940165 GG 16 TSS PROXIMITY TFBS change
37940954 TT 17 TSS PROXIMITY
37941830 AA 17 TSS PROXIMITY
37944067 TT 12 TSS PROXIMITY TFBS change
37948797 CC 14 TSS PROXIMITY TFBS change
37951161 AA 20 TSS PROXIMITY TFBS change
37951388 AA 85 TSS PROXIMITY
37952197 TT 12 TSS PROXIMITY miRNA change
37953673 TT 12 TSS PROXIMITY TES PROXIMITY
37956685 AA 30 TSS PROXIMITY TFBS change
37957180 AA 15 TSS PROXIMITY
37958884 TT 76 TSS PROXIMITY
37959750 CC 28 TSS PROXIMITY miRNA change
37960878 CC 57 TSS PROXIMITY
37965635 GG 37 TSS PROXIMITY
37968559 GG 28 TSS PROXIMITY
37969143 TT 10 TSS PROXIMITY
37969840 GG 20 TSS PROXIMITY
37970147 TT 21 TSS PROXIMITY
37972395 AA 25 TSS PROXIMITY
37973986 AA 16 TSS PROXIMITY TFBS change
37978265 GG 20 miRNA change TFBS change
37981482 GG 10 TFBS change
37983410 TT 20 miRNA change TFBS change
37987832 TT 64 TFBS change
37996273 CC 28 TFBS change
38006534 GG 47 TFBS change
38006866 AA 42 miRNA change TFBS change ncRNA PROXIMITY
38017695 GG 34 miRNA change TFBS change
38029263 TT 82 TFBS change
38031354 TT 40 miRNA change
38060116 AA 15 TFBS change
38060996 CC 33 miRNA change
38065657 AA 23 TFBS change
38066137 CC 10 TFBS change
38068479 AA 78 miRNA change
38073660 AA 15 miRNA change
38075216 TT 54 miRNA change TFBS change
38111851 AA 10 miRNA change
38116133 CC 14 TFBS change
38147726 AA 15 miRNA change
38153973 TT 26 TFBS change
38161074 AA 19 miRNA change
38162115 GG 51 miRNA change
38164334 GG 34 TFBS change
38166479 TT 63 TFBS change
38183881 AA 15 TSS PROXIMITY miRNA change
38183927 GG 17 TSS PROXIMITY miRNA change
38191074 CC 34 TSS PROXIMITY miRNA change
38192878 CC 23 TSS PROXIMITY miRNA change TFBS change
38195435 TT 46 INTRONIC
38197486 CC 27 INTRONIC
38199290 AA 10 INTRONIC
38199291 AA 10 INTRONIC
38207212 CC 17 INTRONIC
38207509 AA 88 INTRONIC
38210134 CC 19 INTRONIC
38215979 GG 12 INTRONIC
38219313 TT 26 INTRONIC
38227102 TT 21 INTRONIC
38227103 GG 23 INTRONIC
38227465 TT 16 INTRONIC
38228487 GG 21 INTRONIC
38229535 TT 75 INTRONIC
38236011 GG 39 INTRONIC
38242115 AA 71 INTRONIC
38247538 GG 25 INTRONIC
38247787 CC 14 INTRONIC
38247898 TT 40 INTRONIC
38255608 CC 13 INTRONIC
38255626 GG 10 INTRONIC
38258165 CC 13 INTRONIC
38264424 TT 30 INTRONIC
38272464 AA 31 INTRONIC
38277482 CC 95 INTRONIC
38297034 GG 11 INTRONIC
38297707 AA 71 INTRONIC
38298904 TT 27 INTRONIC
38299362 TT 14 INTRONIC
38303738 TT 16 INTRONIC
38305559 AA 27 INTRONIC
38305634 TT 12 INTRONIC
38309469 GG 12 INTRONIC
38310641 CC 15 INTRONIC
38311049 TT 55 INTRONIC
38312454 GG 36 INTRONIC
38314468 GG 13 INTRONIC
38315461 TT 24 INTRONIC
38316970 AA 33 INTRONIC
38319784 GG 98 INTRONIC
38319865 TT 56 INTRONIC
38320085 GG 32 INTRONIC
38321560 TT 11 INTRONIC
38321904 CC 29 INTRONIC
38325057 GG 32 INTRONIC
38329848 AA 11 INTRONIC
38340130 AA 22 INTRONIC
38340847 GG 32 INTRONIC
38344903 GG 27 INTRONIC
38344904 TT 26 INTRONIC
38348649 AA 31 INTRONIC
38377727 CC 22 miRNA change
38378296 GG 13 miRNA change
38378319 AA 18 miRNA change
38382993 GG 36 miRNA change
38383075 TT 81 miRNA change
38396494 TT 13 TSS PROXIMITY
38397559 TT 16 TSS PROXIMITY TFBS change
38397797 AA 10 TSS PROXIMITY miRNA change TFBS change
38400970 TT 84 TSS PROXIMITY
38402819 TT 23 TSS PROXIMITY TFBS change
38402956 GG 12 TSS PROXIMITY miRNA change TFBS change
38412468 GG 22 TSS PROXIMITY miRNA change TFBS change
38412701 TT 17 TSS PROXIMITY miRNA change
38430308 CC 96 TSS PROXIMITY miRNA change
38433536 CC 29 TSS PROXIMITY miRNA change TFBS change
38443159 TT 12 TSS PROXIMITY TFBS change
38448533 CC 14 INTRONIC
38448582 CC 13 INTRONIC
38452271 CC 99 TSS PROXIMITY
38456065 CC 35 TSS PROXIMITY miRNA change
38456369 TT 16 TSS PROXIMITY miRNA change
38457028 TT 53 TSS PROXIMITY
38457187 AA 24 TSS PROXIMITY miRNA change
38464347 TT 24 TSS PROXIMITY TES PROXIMITY miRNA change TFBS change
38466720 AA 36 TSS PROXIMITY miRNA change
38466749 GG 93 TSS PROXIMITY miRNA change
38470356 AA 12 TSS PROXIMITY miRNA change
38490914 CC 15 INTRONIC
38491832 AA 38 INTRONIC
38507808 AA 22 TSS PROXIMITY
38508991 CC 11 TSS PROXIMITY miRNA change
* 38513135 CC 41 EXONIC
38513883 TT 17 INTRONIC
38514699 TT 40 INTRONIC
* 38514745 TT 34 EXONIC
38519825 CC 80 INTRONIC

The table shows SNPs identified during resequencing within the CFA12: 36,750,205–38,524,449 genomic region for which the case is homozygous. SNPs that are homozygous in the case but without any further comments have been removed from the table. Further SNPs are only included in the table if Cons score ≥10. A paper describing details of the functional prediction of the SNPS is in preparation. aSNPs selected for TaqMan genotyping. bPosition according on CFA12 according to Ensembl Canis familiaris version 64.2. cGenotype from resequencing data. dConservation in dog, human, mouse, and rat are computed by UCSC’s phastCons and multiplied by 100. eEach SNP was annotated based on the following features: EXONIC, the SNP is in an annotated exon; INTRONIC, the SNP is in an annotated intron; TSS PROXIMITY, the SNP is close to a transcription start site; TES PROXIMITY, the SNP is close to a transcription end site; miRNA change, the SNP changes the predicted binding of miRNA; TFBS change, the SNP changes the predicted binding of a transcription factor; ncRNA, the SNP is in or near a predicted ncRNA.

*Significance of 37871992 is 1.4 ×10−7; 38513135 is 0.00087; 38514745 is 0.01707.

Table A2.

Haplotype substitution effects on linear and logistic scales for disc calcification scored as binary case/control.

Haplotypes Haplotype window Linear model Logistic model1
Hap 1 R2 = 73% RMD3 = 0.64
α0 = H4 −0.49 −8.53
H1 0.71 5.93
H2 0.20 −5.28ns
H3 −0.22ns −8.40ns
Hap 2 R2 = 73% RMD = 0.64
α0 = H3 −0.36 −8.91
H1 0.63 6.14
H2 −0.27ns −8.24ns
Hap 3 R2 = 76% RMD = 0.46
α0 = H4 −0.41 −22.97
H1 0.66 15.52
H2 0.39 12.06ns
H3 0.03ns 1.056ns
Hap 4 R2 = 51% RMD = 0.92
α0 = H3 −0.41 −19.36
H1 0.63 11.08
H2 0.36 9.26
Hap 5 R2 = 68% RMD = 0.75
α0 = H3 −0.31 −7.03
H1 0.61 5.28
H2 −0.33 −6.13ns
H3 −0.31ns −9.25ns
Hap 6 R2 = 63% RMD = 0.85
α0 = H2 −0.31 −6.82
H1 0.60 4.73
Hap 7 R2 = 63% RMD = 0.82
α0 = H3 −0.32 −7.41
H1 0.61 5.35
H2 0.38 2.77ns
Hap 8 R2 = 63% RMD = 0.85
α0 = H2 −0.31 −6.82
H1 0.59 4.73
Hap 9 R2 = 62% RMD = 0.76
α0 = H4 −0.40 −19.45
H1 0.64 11.01
H2 0.11ns 0.94ns
H3 0.14 7.68ns

Tests of association of haplotypes (coded as H1, H2, etc.) from CFA12: 36,750,205–38,524,449; those haplotype effects that were not significant at P < 0.01 are marked with superscript ns in each haplotype window. 1Estimates on logit scale can be back transformed to probability of observing a case or control by π = 1/(1 + e−η) where η is an estimate of haplotype effects. 2R2, percent variability in the data set that is accounted for by the fitted haplotype block model; 3RMD, residual mean deviance is an indicator for goodness of fit (lower is better).

Table A3.

Specification of the primers and probes in the SNP genotyping assays.

SNP location Forward primer; reverse primer Probes labeled with VIC®/FAM™ fluorescent dye
37,871,992 F: TTCGAATTTGAAGCTAAGACTGCTAGAA;
R: AACCGCCCGGGCTT
VIC: CCCTCTCCGCCCCC; FAM: CCTCTCGGCCCCC
38,513,135 F: AGAGCAGAATTTATCCAGTTCCTTTCG; R:
AACAGGAAAGATTGCTTAAAACTAATGAAGT
VIC: TTTCCAAACTTTGTTTTCA; FAM: CCAAACTTCGTTTTCA
38,514,745 F: ACCTGCAACATTTTACTCCATCACTT; R:
GACCTTTTAAAAAGTCATGGGCAGT
VIC: TCACAGCAAGTTTTAG; FAM: TCACAGCATGTTTTAG

SNP location in base pairs; F, forward primer; R, reverse primer; VIC, VIC ® fluorescent dye, FAM, FAM™ fluorescent dye.

Table A4.

Top allelic association hits in the GWAS on disc calcification in 33 wire-haired cases and 28 wire-haired controls, sorted by genomic position.

Haplotype window Canine SNP Chr Pos Pgenome AR/ANR
Hap 1 BICF2P1218920 12 36750205 0.02646 A/T
Hap 1 BICF2P909271 12 36756197 0.02646 G/A
Hap 1 TIGRP2P163331 12 36770550 0.02646 G/T
Hap 1 BICF2S23234423 12 36909311 3.0E-5 T/C
Hap 2 TIGRP2P163344 12 37056901 3.0E-5 T/C
Hap 2 BICF2P1304914 12 37079212 3.0E-5 G/A
Hap 2 BICF2P211642 12 37099752 3.0E-5 A/C
Hap 2 BICF2P979506 12 37119065 3.0E-5 G/A
Hap 3 BICF2P16177 12 37123193 3.0E-5 T/G
Hap 3 BICF2P825805 12 37134630 3.0E-5 A/C
Hap 3 BICF2S23242450 12 37480959 1.0E-5 C/A
Hap 3 BICF2S23240823 12 37494845 8.7E-4 A/G
Hap 4 BICF2S23023749 12 37710073 0.00916 C/T
Hap 4 BICF2S23043206 12 37733597 0.00916 T/C
Hap 4 G745F34S150 12 37806613 0.00916 G/A
Hap 4 BICF2P717725 12 37826314 0.00392 T/G
Hap 5 BICF2P1197203 12 37847222 0.00916 G/A
Hap 5 TIGRP2P163387 12 37859396 0.00916 C/T
Hap 5 BICF2S23632751 12 37899159 9.0E-5 T/C
Hap 5 TIGRP2P163398 12 37944067 9.0E-5 T/C
Hap 6 BICF2P1304952 12 37958884 9.0E-5 T/G
Hap 6 TIGRP2P163406 12 37980930 9.0E-5 T/G
Hap 6 BICF2P478656 12 38003121 9.0E-5 C/T
Hap 6 BICF2P371497 12 38015502 9.0E-5 T/C
Hap 7 BICF2P31931 12 38022379 9.0E-5 C/A
Hap 7 BICF2S22962067 12 38042875 9.0E-5 T/C
Hap 7 BICF2P462046 12 38064467 0.00922 G/A
Hap 7 BICF2P1309489 12 38072703 9.0E-5 T/C
Hap 8 BICF2P114736 12 38079788 9.0E-5 A/C
Hap 8 BICF2P1354926 12 38182743 9.0E-5 G/A
Hap 8 BICF2P320495 12 38202857 9.0E-5 G/A
Hap 8 BICF2P1089702 12 38229535 9.0E-5 T/A
Hap 9 TIGRP2P163437 12 38264121 9.0E-5 A/G
Hap 9 BICF2S23241475 12 38348649 0.01039 A/C
Hap 9 TIGRP2P163478 12 38507494 0.00333 T/C
Hap 9 BICF2P1077702 12 38524449 0.00333 G/T

Chr, chromosome; Pos, physical position; Pgenome, p-value corrected for multiple testing by permutation; AR, risk allele; ANR, non-risk allele.

Footnotes

Abbreviations

BLUP, best linear unbiased prediction; CFA, canine chromosome; DDC, Danish Dachshund Club; GLM, generalized linear model; GWAS, genome-wide association studies; LD, linkage disequilibrium; ncRNAs, non-coding RNAs; qPCR, quantitative fluorescence PCR; RMD, residual mean deviance; R2, coefficient of determination; UTRs, untranslated regions.

References

  1. Annunen S., Paassilta P., Lohiniva J., Perälä M., Pihlajamaa T., Karppinen J., et al. (1999). An allele in COL9A2 associated with intervertebral disc disease. Science 285, 409–412 10.1126/science.285.5426.409 [DOI] [PubMed] [Google Scholar]
  2. Ball M. U., McGuire J. A., Swain S. A., Hoerlein B. F. (1982). Patterns of occurrence of disk disease among registered Dachshunds. J. Am. Vet. Med. Assoc. 180, 519–522 [PubMed] [Google Scholar]
  3. Barrett J. C., Fry B., Maller J., Daly M. J. (2005). Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21, 263–265 10.1093/bioinformatics/bti464 [DOI] [PubMed] [Google Scholar]
  4. Ghosh P., Taylor T. K., Braund K. G., Larsen L. H. (1976). A comparative chemical and histochemical study of the chondrodystrophoid and non-chondrodystrophoid canine intervertebral disc. Vet. Pathol. 13, 414–427 [DOI] [PubMed] [Google Scholar]
  5. Gilmour A., Gogel B., Cullis B., Welham S., Thompson R. (2002). ASReml User Guide Release 1.0. Hemel Hempstead: VSN International Ltd [Google Scholar]
  6. Goggin J. E., Li A. S., Franti C. E. (2000). Canine intervertebral disc disease: characterization by age, sex, breed and anatomic site of involvement. Am. J. Vet. Res. 31, 1687–1692 [PubMed] [Google Scholar]
  7. Hansen H. J. (1952). A pathologic-anatomical study on disc degeneration in dog. Acta Orthop. Scand. Suppl. 11, 1–120 [DOI] [PubMed] [Google Scholar]
  8. Jensen V. F., Beck S., Christensen K. A., Arnbjerg J. (2008). Quantification of the association between intervertebral disk calcification and disk herniation in Dachshunds. J. Am. Vet. Med. Assoc. 223, 1090–1095 10.2460/javma.233.7.1090 [DOI] [PubMed] [Google Scholar]
  9. Jensen V. F., Christensen K. A. (2000). Inheritance of disc calcification in the dachshund. J. Vet. Med. A Physiol. Pathol. Clin. Med. 47, 331–340 10.1046/j.1439-0442.2000.00296.x [DOI] [PubMed] [Google Scholar]
  10. Jensen V. F., Ersbøll A. K. (2000). Mechanical factors affecting the occurrence of intervertebral disc calcification in the dachshund. A population study. J. Vet. Med. A Physiol. Pathol. Clin. Med. 47, 283–296 10.1046/j.1439-0442.2000.00296.x [DOI] [PubMed] [Google Scholar]
  11. Kadarmideen H. (2008). Biochemical, ECF18R and RYR1 gene polymorphisms and their associations with osteochondral diseases and production traits in pigs. Biochem. Genet. 46, 41–53 10.1007/s10528-007-9127-5 [DOI] [PubMed] [Google Scholar]
  12. Kadarmideen H., Ali A., Thomson P., Muller B., Zinsstag J. (2011). Polymorphisms of the SLC11A1 gene and resistance to bovine tuberculosis in African Zebu cattle. Anim. Genet. 42, 656–658 10.1111/j.1365-2052.2011.02203.x [DOI] [PubMed] [Google Scholar]
  13. Kadarmideen H., Janss L., Dekkers J. (2000). Power of quantitative trait locus mapping for polygenic binary traits using generalized and regression interval mapping in multi-family half-sib designs. Genet. Res. 76, 305–317 10.1017/S001667230000481X [DOI] [PubMed] [Google Scholar]
  14. Kimura T., Nakata K., Tsumaki N., Miyamoto S., Matsui Y., Ebara S., et al. (1996). Progressive degeneration of articular cartilage and intervertebral discs. An experimental study in transgenic mice bearing a type IX collagen mutation. Int. Orthop. 20, 177–181 10.1007/s002640050058 [DOI] [PubMed] [Google Scholar]
  15. Langmead B., Trapnell C., Pop M., Salzberg S. L. (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25. 10.1186/gb-2009-10-11-r134 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Lappalainen A., Norrgård M., Alm K., Snellman M., Laitinen O. (2001). Calcification of the intervertebral discs and curvature of the radius and ulna: a radiographic survey of Finnish miniature dachshunds. Acta Vet. Scand. 4, 229–236 10.1186/1751-0147-42-229 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Li H., Ruan J., Durbin R. (2008). Mapping short DNA sequencing reads and calling variants using mapping quality scores. Genome Res. 18, 1851–1858 10.1101/gr.076661.108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lindblad-Toh K., Wade C. M., Mikkelsen T. S., Karlsson E. K., Jaffe D. B., Kamal M., et al. (2005). Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature 438, 803–819 10.1038/nature04338 [DOI] [PubMed] [Google Scholar]
  19. Madsen M., Olsen L., Häggström J., Höglund K., Ljungvall I., Falk T., et al. (2011). Identification of 2 loci associated with development of myxomatous mitral valve disease in Cavalier King Charles Spaniels. J. Hered. 102, S62–S67 10.1093/jhered/esr041 [DOI] [PubMed] [Google Scholar]
  20. Mogensen M., Karlskov-Mortensen P., Proschowsky H., Lingaas F., Lappalainen A., Lohi H., et al. (2011). Genome-wide association study in Dachshund: identification of a major locus affecting intervertebral disc calcification. J. Hered. 102, S8–S86 10.1093/jhered/esr021 [DOI] [PubMed] [Google Scholar]
  21. Paassilta P., Lohiniva J., Göring H., Perälä M., Räïnä S., Karppinen J., et al. (2001). Identification of a novel common genetic risk factor for lumbar disk disease. JAMA 285, 1843–1849 10.1001/jama.285.14.1843 [DOI] [PubMed] [Google Scholar]
  22. Priester W. A. (1976). Canine intervertebral disc disease – occurrence by age, breed, and sex among 8,117 cases. Theriogenology 6, 293–303 10.1016/0093-691X(76)90021-2 [DOI] [Google Scholar]
  23. Stephens M., Smith N., Donnelly P. (2001). A new statistical method for haplotypes reconstruction from population data. Am. J. Hum. Genet. 68, 78–989 10.1086/319501 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Stigen Ø. (1996). Calcification of intervertebral discs in the dachshund: a radiographic study of 115 dogs at 1 and 5 years of age. Acta Vet. Scand. 37, 229–237 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Sutter N. B., Eberle M. A., Parker H. G., Pullar B. J., Kirkness E. F., Kruglyak L., et al. (2004). Extensive and breed-specific linkage disequilibrium in Canis familiaris. Genome Res. 14, 2388–2396 10.1101/gr.3147604 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Wang N., Akey J., Zhang K., Chakraborty R., Jin L. (2002). Distribution of recombination crossovers and the origin of haplotype blocks: the interplay of population history, recombination, and mutation. Am. J. Hum. Genet. 71, 1227–1234 10.1086/341125 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Wilbe M., Jokinen P., Truvé K., Seppala E. H., Karlsson E. K., Biagi T., et al. (2010) Genome-wide association mapping identifies multiple loci for a canine SLE-related disease complex. Nat. Genet. 3, 250–254 10.1038/ng.525 [DOI] [PubMed] [Google Scholar]
  28. Wood S. H., Ke X., Nuttall T., McEwan N., Ollier W. E., Carter S. D. (2009). Genome-wide association analysis of canine atopic dermatitis and identification of disease related SNPs. Immunogenetics 61, 765–772 10.1007/s00251-009-0402-y [DOI] [PubMed] [Google Scholar]

Articles from Frontiers in Genetics are provided here courtesy of Frontiers Media SA

RESOURCES