Abstract
The Gram-positive bacterium Bacillus subtilis contains two Tat translocases, which can facilitate transport of folded proteins across the plasma membrane. Previous research has shown that Tat-dependent protein secretion in B. subtilis is a highly selective process and that heterologous proteins, such as the green fluorescent protein (GFP), are poor Tat substrates in this organism. Nevertheless, when expressed in Escherichia coli, both B. subtilis Tat translocases facilitated exclusively Tat-dependent export of folded GFP when the twin-arginine (RR) signal peptides of the E. coli AmiA, DmsA, or MdoD proteins were attached. Therefore, the present studies were aimed at determining whether the same RR signal peptide-GFP precursors would also be exported Tat dependently in B. subtilis. In addition, we investigated the secretion of GFP fused to the full-length YwbN protein, a strict Tat substrate in B. subtilis. Several investigated GFP fusion proteins were indeed secreted in B. subtilis, but this secretion was shown to be completely Tat independent. At high-salinity growth conditions, the Tat-independent secretion of GFP as directed by the RR signal peptides from the E. coli AmiA, DmsA, or MdoD proteins was significantly enhanced, and this effect was strongest in strains lacking the TatAy-TatCy translocase. This implies that high environmental salinity has a negative influence on the avoidance of Tat-independent secretion of AmiA-GFP, DmsA-GFP, and MdoD-GFP. We conclude that as-yet-unidentified control mechanisms reject the investigated GFP fusion proteins for translocation by the B. subtilis Tat machinery and, at the same time, set limits to their Tat-independent secretion, presumably via the Sec pathway.
INTRODUCTION
Protein secretion is an important feature for the survival and competitive success of bacterial cells in their natural habitats. The ability to secrete proteins is particularly well developed in the Gram-positive bacterium Bacillus subtilis, which is of interest both from applied and fundamental scientific points of view (3, 47, 48, 51). Combined genetic, proteomic, and bioinformatic analyses have revealed that the vast majority of proteins secreted by B. subtilis leave the cytoplasm in an unfolded state via the general secretion (Sec) pathway (47). Upon translocation, these proteins fold into their active and protease-resistant conformation (19). A limited number of proteins are secreted via the so-called twin-arginine (RR) (Tat) pathway, which, in contrast to the Sec pathway, can facilitate the transport of fully folded proteins (16, 35, 37, 38, 42, 45, 53).
The proteins destined for export via the Sec or Tat pathways are synthesized with N-terminal signal peptides. These have a characteristic tripartite structure consisting of a positively charged N-terminal region, a hydrophobic H region, and a C-terminal region (37, 48). The C region contains a signal peptidase cleavage site for signal peptide removal during or shortly after membrane translocation of the attached protein (10, 52). Although the signal peptides of Sec and Tat substrates are similar in structure, particular signal peptide features promote the specific targeting of proteins to the Tat pathway. These include a twin-arginine recognition motif in the N region with the consensus sequence (K/R)RX##, where # marks hydrophobic residues and X can be any residue (6, 12, 14, 33, 46). This RR motif is specifically recognized by the Tat translocase (1, 8, 13). Additionally, RR signal peptides are unattractive for the Sec machinery, because their H region has a relatively low hydrophobicity and because the C region often (but not always) contains a positively charged residue that strongly promotes Sec avoidance (7, 14, 49). Importantly, the Sec incompatibility of Tat substrates is achieved not only through RR signal peptide features but also through their rapid or controlled folding in the cytoplasm prior to translocation (15, 39). In fact, some Tat-dependently exported proteins are subject to dedicated chaperone-mediated proofreading in the cytoplasm in order to prevent the initiation of their transport before folding or cofactor assembly has been completed (30, 38, 40, 43).
B. subtilis contains two independently working Tat translocases named TatAyCy and TatAdCd, which are of the TatAC type that is commonly found in Gram-positive bacteria (21, 22, 23). Unlike the TatABC-type translocases that are present in Gram-negative bacteria, these “minimal” TatAC translocases lack a TatB subunit (4, 5, 24). In B. subtilis, the TatAyCy and TatAdCd translocases have distinct specificities for the Dyp-type peroxidase YwbN and the phosphodiesterase PhoD, respectively, at least when the cells are grown in a standard LB medium (21, 22, 23). Also, a hybrid precursor of the subtilisin AprE fused to the YwbN signal peptide was secreted in a TatAyCy-specific manner, suggesting a preferential interaction between the YwbN signal peptide and the TatAyCy translocase (25). Nevertheless, the specificities of TatAyCy and TatAdCd overlap at least to some extent, as was recently shown by the heterologous expression of TatAdCd or TatAyCy in Escherichia coli strains lacking their own TatABC translocase (4, 5). The latter studies revealed that both B. subtilis Tat translocases are able to translocate the green fluorescent protein (GFP) fused to the RR signal peptides of the E. coli AmiA, DmsA, or MdoD proteins (Fig. 1). A specificity difference was, however, observed, as the trimethylamine N-oxide (TMAO) reductase (TorA) and a TorA-GFP fusion were transported by TatAdCd but not by TatAyCy (4, 5).
Fig 1.

Signal peptide sequences. The amino acid sequences of the RR signal peptides of AmiA, DmsA, and MdoD of E. coli and YwbN and PhoD of B. subtilis are shown. Twin-arginine motifs are underlined, hydrophobic H regions are printed in italics, and the C regions are marked in bold, with residues flanking the signal peptidase cleavage sites underlined.
An interesting conclusion from the heterologous Tat expression studies in E. coli was that both B. subtilis TatAC translocases were able to translocate active GFP when expressed in E. coli. In contrast, earlier experiments had indicated that this was not possible in B. subtilis (25, 32). Therefore, the aim of the present study was to assess whether the same RR signal peptide-GFP hybrid precursors that were Tat-dependently translocated in E. coli would also lead to Tat-dependent GFP secretion in B. subtilis. In addition, we investigated whether a fusion of GFP to the full-size YwbN protein might facilitate GFP export. Briefly, the results show that none of the GFP fusion constructs were Tat-dependently secreted. Instead, Tat-independent GFP secretion was observed, which was most pronounced when the cells were grown in LB medium of high salinity. Taken together, our findings show that the GFP fusion proteins are rejected for translocation by the B. subtilis Tat machinery. Furthermore, the avoidance of Tat-independent secretion of all three hybrid GFP precursors, presumably via the Sec pathway, seems to be suppressed when cells are grown in medium with 6% salt.
MATERIALS AND METHODS
Plasmids, bacterial strains, media, and growth conditions.
The plasmids and bacterial strains used in this study are listed in Table 1. Strains were grown with agitation at 37°C in either lysogeny broth (LB) or Paris minimal (PM) medium. LB medium consisted of 1% tryptone and 0.5% yeast extract with or without NaCl (1% or 6%), pH 7.4. Notably, LB with 1% NaCl is the standard LB medium that has been used in all our previous studies. PM consisted of 10.7 mg ml−1 K2HPO4, 6 mg ml−1 KHPO, 1 mg ml−1 trisodium citrate, 0.02 mg ml−1 MgSO4, 1% glucose, 0.1% Casamino Acids (Difco), 20 mg ml−1 l-tryptophan, 2.2 mg ml−1 ferric ammonium citrate, and 20 mM potassium glutamate. To activate a phosphate starvation response and, accordingly, induce the expression of the TatAdCd translocase, the strains were grown overnight in high-phosphate defined medium (HPDM), which is rich in phosphate. The next morning, cells were transferred to low-phosphate defined medium (LPDM). Both media were prepared according to Müller et al. (34). Lactococcus lactis was grown at 30°C in M17 broth supplemented with 0.5% glucose. When required, media for E. coli were supplemented with erythromycin (Em; 100 μg ml−1), kanamycin (Km; 20 μg ml−1), chloramphenicol (Cm; 5 μg ml−1), or spectinomycin (Sp; 100 μg ml−1); media for B. subtilis were supplemented with Em (1 μg ml−1), Km (20 μg ml−1), Cm (5 μg ml−1), phleomycin (Phleo; 4 μg ml−1), or Sp (100 μg ml−1); media for L. lactis were supplemented with Em (2 μg ml−1).
Table 1.
Strains and plasmids used in this study
| Plasmid or strain | Relevant properties | Reference |
|---|---|---|
| Plasmids | ||
| pHB201 | B. subtilis-E. coli expression vector; ori-pBR322 ori-pTA1060 cat86::lacZa; Cmr Emr | 10 |
| pHB-AmiA-GFP | pHB201 vector carrying the amiA-gfp hybrid gene; Cmr Emr | This study |
| pHB-DmsA-GFP | pHB201 vector carrying the dmsA-gfp hybrid gene; Cmr Emr | This study |
| pHB-MdoD-GFP | pHB201 vector carrying the mdoD-gfp hybrid gene; Cmr Emr | This study |
| pSG1554 | bla amyE3′ spc Pxyl-′gfpmut1 amyE5′ | 29 |
| pNZ8910 | SURE expression vector; PspaS; Emr | 9 |
| pSG1554-SpYwbN | pSG1154 vector carrying the signal sequence of ywbN fused to gfpmut1; Apr Spr | This study |
| pSG1554-YwbN | pSG1154 vector carrying ywbN fused to gfpmut1; Apr Spr | This study |
| pSURE-SpYwbN-GFP | pNZ8910 vector carrying the ywbN signal sequence-gfp gene fusion; Emr | This study |
| pSURE-YwbN-GFP | pNZ8910 vector carrying the ywbN-gfp gene fusion; Emr | This study |
| pGFP | Originally known as pNZ8907; PspaS translationally fused to gfp; only the full-size GFP is produced; Emr | 9 |
| Strains | ||
| E. coli DH5α | supE44 hsdR17 recA1 gyrA96 thi-1 relA1 | 44 |
| L. lactis MG1363 | Plasmid-free derivative of NCDO 712 | 18 |
| B. subtilis | ||
| 168 | trpC2 | 2 |
| ATCC 6633 | Subtilin producer | 9 |
| tatAyCy strain | trpC2 tatAy-tatCy::Sp; Spr | 21 |
| tatAdCd strain | trpC2 tatAd-tatCd::Km; Kmr | 22 |
| tatAdCd strain | trpC2 tatAd-tatCd::Cm; Cmr | 21 |
| total-tat2 strain | trpC2 tatAd-tatCd::Km; Kmr; tatAy-tatCy::Sp; Spr; tatAc::Em; Emr | 22 |
| ywbN strain | trpC2 ywbN::Phleo; Phleor | This study |
| ywbN spaRK strain | trpC2 ywbN::Phleo; Phleor; amyE::spaRK; Kmr | This study |
| tatAyCy ywbN spaRK strain | trpC2 ywbN::Phleo; Phleor; amyE::spaRK; Kmr; tatAy-tatCy::Sp; Spr | This study |
| tatAdCd ywbN spaRK strain | trpC2 ywbN::Phleo; Phleor; amyE::spaRK; Kmr; tatAd-tatCd::Cm; Cmr | This study |
| ywbN pGFP strain | trpC2 ywbN::Phleo; Phleor; amyE::spaRK; Kmr; pNZ8907 | This study |
| ywbN pSURE-SpYwbN-GFP strain | trpC2 ywbN::Phleo; Phleor; amyE::spaRK; Kmr; pSURE-SpYwbN-GFP; Emr | This study |
| ywbN pSURE-YwbN-GFP strain | trpC2 ywbN::Phleo; Phleor; amyE::spaRK; Kmr; pSURE-YwbN-GFP; Emr | This study |
| AyCy ywbN pSURE-YwbN-GFP strain | trpC2 ywbN::Phleo; Phleor; amyE::spaRK; Kmr; pSURE-SpYwbN-GFP; Emr; tatAy-tatCy::Sp; Spr | This study |
| AdCd ywbN pSURE-YwbN-GFP strain | trpC2 ywbN::Phleo; Phleor; amyE::spaRK; Kmr; pSURE-SpYwbN-GFP Emr; tatAd-tatCd::Cm; Cmr | This study |
| 168 XywbN strain | trpC2 amyE::xylA-ywbN-myc; Cmr | 22 |
| tatAyCy XywbN strain | trpC2 tatAy-tatCy::Sp; Spr; amyE::xylA-ywbN-myc; Cmr | 22 |
| tatAdCd XywbN strain | trpC2 tatAd-tatCd::Km; Kmr; amyE::xylA-ywbN-myc; Cmr | 22 |
| total-tat2 XywbN strain | trpC2 tatAd-tatCd::Km; Kmr; tatAy-tatCy::Sp; Spr; tatAc::Em; Emr; amyE::xylA-ywbN-myc; Cmr | 22 |
| 168 pHB201 strain | trpC2; pHB201; Emr Cmr | This study |
| 168 pHB-AmiA-GFP strain | trpC2; pHB-AmiA-GFP; Emr Cmr | This study |
| tatAyCy pHB-AmiA-GFP strain | trpC2 tatAy-tatCy::Sp; pHB-AmiA-GFP; Spr Emr Cmr | This study |
| tatAdCd pHB-AmiA-GFP strain | trpC2 tatAd-tatCd::Km; pHB-AmiA-GFP; Kmr Emr Cmr | This study |
| total-tat2 pHB-AmiA-GFP strain | trpC2 tatAd-tatCd::Km tatAy-tatCy::Sp tatAc::Em; pHB-AmiA-GFP; Kmr Spr Emr Cmr | This study |
| 168 pHB-DmsA-GFP strain | trpC2; pHB-DmsA-GFP; Emr Cmr | This study |
| tatAyCy pHB-DmsA-GFP strain | trpC2 tatAy-tatCy::Sp; pHB-DmsA-GFP; Spr Emr Cmr | This study |
| tatAdCd pHB-DmsA-GFP strain | trpC2 tatAd-tatCd::Km; pHB-DmsA-GFP; Kmr Emr Cmr | This study |
| total-tat2 pHB-DmsA-GFP strain | trpC2 tatAd-tatCd::Km tatAy-tatCy::Sp tatAc::Em; pHB-DmsA-GFP; Kmr Spr Emr Cmr | This study |
| 168 pHB-MdoD-GFP strain | trpC2; pHB-MdoD-GFP; Emr Cmr | This study |
| tatAyCy pHB-MdoD-GFP strain | trpC2 tatAy-tatCy::Sp; pHB-MdoD-GFP; Spr Emr Cmr | This study |
| tatAdCd pHB-MdoD-GFP strain | trpC2 tatAd-tatCd::Km; pHB-MdoD-GFP; Kmr Emr Cmr | This study |
| total-tat2 pHB-MdoD-GFP strain | trpC2 tatAd-tatCd::Km tatAy-tatCy::Sp tatAc::Em; pHB-MdoD-GFP; Kmr Spr Emr Cmr | This study |
DNA techniques.
Procedures for DNA purification, restriction, ligation, agarose gel electrophoresis, and transformation of competent E. coli cells were carried out as previously described (44). B. subtilis was transformed as described by Kunst and Rapoport (28). PCR was carried out with the Pwo DNA polymerase. PCR products were purified using the PCR purification kit from Roche. Restriction enzymes were obtained from New England BioLabs. Plasmid DNA from E. coli was isolated using the alkaline lysis method (44) or the InvisorbPlasmid isolation kit (Invitek). All constructs were checked by sequencing (serviceXS, Leiden, the Netherlands).
To construct the plasmids pHB-AmiA-GFP, pHB-DmsA-GFP, and pHB-MdoD-GFP, the amiA-gfp, dmsA-gfp, and mdoD-gfp hybrid genes were PCR amplified from the respective pBAD24-based plasmids carrying these genes (5) (Table 1). The 5′ primers used for PCR contained the mntA ribosome-binding site and start codon, as well as an SpeI restriction site, and the 3′ primer contained a BamHI restriction site (Table 2). The resulting PCR products were cleaved with SpeI and BamHI and ligated to SpeI-BamHI-cleaved pHB201. Ligation mixtures were used to transform E. coli, resulting in the identification of plasmids pHB-AmiA-GFP, pHB-DmsA-GFP, and pHB-MdoD-GFP. Next, these plasmids were used to transform the 168, tatAyCy, tatAdCd, and total-tat2 B. subtilis strains. To construct the plasmids pSURE-SpYwbN-GFP and pSURE-YwbN-GFP, the ywbN signal sequence and the full-length ywbN gene were PCR amplified from chromosomal DNA of B. subtilis 168. The 5′ primer used for PCR contained a KpnI restriction site, and the 3′ primer contained a HindIII restriction site (Table 2). The resulting PCR products were cleaved with KpnI and HindIII and ligated to KpnI-HindIII-cleaved pSG1154 (29), which contains the gfpmut1 gene. The fusion products Sp(Ywbn)-GFP and YwbN-GFP were then amplified from these vectors using a 5′ primer containing a BspHI restriction site and a 3′ primer containing a HindIII restriction site, and they were cloned into the NcoI-HindIII-cleaved pNZ8910 plasmid. Ligation mixtures were used to transform L. lactis, resulting in the isolation of plasmids pSURE-SpYwbN-GFP and pSURE-YwbN-GFP. The plasmids were then used to transform the B. subtilis ywbN, tatAyCy ywbN, or tatAdCd ywbN strains.
Table 2.
Primers used in this study
| Primer | Sequencea | Remarks |
|---|---|---|
| RBS-MntA-AmiA-F | GGGGGACTAGTAAGAGGAGGAGAAAT; ATGAGCACTTTTAAACCACTA | SpeI, RBS mntA |
| RBS-MntA-DmsA-F | GGGGGACTAGTAAGAGGAGGAGAAAT; ATGAAAACGAAAATCCCTGAT | SpeI, RBS mntA |
| SpeI-MntA-MdoD-F | GGGGGACTAGTAAGAGGAGGAGAAAT; ATGGATCGTAGACGATTTATT | SpeI, RBS mntA |
| GFP-Rev-BamHI | CCCCCGGATCCTTATTTGTATAGTTCATCCATGC | BamHI, end gfp |
| YwbN_LW-F | GGCGGTACCATGAGCGATGAACAGAAAAAGCCAGAACAA | KpnI |
| SPywbN_LW-R | GGGGAATTCAACAAGCGGAGCGAGACCGCC | EcoRI |
| YwbN_LW-R | GGGGGAATTCTGATTCCAGCAAACGCTG | EcoRI |
| F-YwbN-SURE | GGGGGTCATGAGCGATGAACAGAAAAAGCCAGAACAAATTC | RcaI |
| GFP-Rev-HindIII | GCCCAAGCTTATTATTTGTAGAGCTCATCCATGCCATGTG | HindIII, end gfpmut1 |
Underlining represents restriction sites used for cloning. Italics indicate the start of the amiA, dmsA, or mdoD gene.
SDS-PAGE and Western blotting.
Cellular or secreted proteins were separated by PAGE using precast Bis-Tris NuPAGE gels (Invitrogen). The presence of GFP, YwbN, or LipA in cellular or growth medium fractions was detected by Western blotting. For this purpose, proteins separated by PAGE were semidry blotted (75 min at 1 mA/cm2) onto a nitrocellulose membrane (Protran; Schleicher & Schuell). Subsequently, GFP was detected with monoclonal antibodies (Clontech); YwbN-Myc was detected with monoclonal antibodies against the Myc tag attached to this protein (Gentaur); and YwbN, LipA, TrxA, PhoD, and PhoB were detected with specific polyclonal antibodies raised in rabbits. Visualization of bound antibodies was performed with fluorescent IgG secondary antibodies (IRDye 800 CW goat anti-rabbit or goat anti-mouse antibody from LiCor Biosciences) in combination with the Odyssey Infrared Imaging System (LiCor Biosciences). Fluorescence was recorded at 800 nm.
Fluorescence microscopy.
Cells carrying plasmids pHB-AmiA-GFP, pHB-DmsA-GFP, and pHB-MdoD-GFP were grown in LB supplemented with 1 or 6% NaCl. After 7 h of growth, the optical density at 600 nm (OD600) was measured. The strains containing pGFP, pSURE-SpYwbN-GFP, or pSURE-YwbN-GFP were grown till an OD600 of 1.0 and induced with 1.0% (vol/vol) supernatant of B. subtilis ATCC 6633. In this respect, it is noteworthy that the subtilin produced by B. subtilis ATCC 6633 is secreted into its growth medium. Addition of this spent medium in a 100-fold dilution to B. subtilis cells containing pGFP, pSURE-SpYwbN-GFP, or pSURE-YwbN-GFPl induces the spaS promoter on these plasmids, thereby driving the high-level transcription of the downstream GFP genes. Upon growth for 2 additional hours, cells were spotted on M9 agarose slides containing the appropriate salt concentrations. These slides were prepared by transfer of M9 agarose medium into a 65-μl Frame-Seal slide chamber (SLF-0601; Bio-Rad). Fluorescence microscopy was performed with a Leica DM5500 B microscope. Fluorescence images were recorded using a Leica EL6000 lamp with the intensity set to 55%. The exposure time was 256 ms. Quantification of GFP fluorescence was done by using the ImageJ software package (http://rsbweb.nih.gov/ij/). Cellular fluorescence values were measured in gray scale values. Background fluorescence was calculated by averaging the gray scale values of the area outside the cells. Finally, the background fluorescence was subtracted from the cellular fluorescence.
RESULTS
The AmiA and MdoD RR signal peptides mediate Tat-independent GFP secretion in B. subtilis.
When heterologously expressed in E. coli, the TatAdCd and TatAyCy translocases can transport the AmiA-GFP, DmsA-GFP, and MdoD-GFP precursors across the inner membrane, leading to an accumulation of active GFP in the periplasm (4, 5). To assess whether the very same RR signal peptide-GFP precursors would also be exported Tat dependently in B. subtilis, we expressed them in B. subtilis 168 and corresponding tat mutant strains. For this purpose, the respective hybrid genes were provided with the ribosome-binding site and the start codon of the B. subtilis mntA gene, which are well suited for heterologous protein expression in B. subtilis (26). The resulting constructs were then constitutively expressed at relatively low levels from the E. coli-B. subtilis shuttle vector pHB201. Cells containing these constructs were subsequently grown in standard LB medium (1% NaCl). It should be noted that under these conditions, the cells produce mainly the TatAyCy translocase, and the TatAdCd translocase is expressed at barely detectable levels (23, 36). As shown in Fig. 2A (left), all three precursors were synthesized in B. subtilis cells when grown overnight in this medium. However, only in the case of AmiA-GFP and MdoD-GFP were processing to the mature form and release of this mature form into the growth medium observed (Fig. 2A, left and right). The strains producing AmiA-GFP secreted relatively larger amounts of mature GFP into the medium than strains producing MdoD-GFP. Notably, the secretion of mature-size GFP by strains producing AmiA-GFP was not influenced by the absence of tatAyCy, tatAdCd, or even all tat genes, and the same was true for strains producing MdoD-GFP, although in this case the GFP was secreted at lower levels (Fig. 2A). No secretion of GFP was detectable for wild-type or tat mutant strains producing the DmsA-GFP precursor (Fig. 2A). Consistent with this observation, barely any mature-size GFP was detectable in cells producing DmsA-GFP. This suggests that the DmsA-GFP precursor is neither an acceptable substrate for the two TatAC translocases nor the Sec translocase when produced in B. subtilis cells grown in standard LB medium (1% NaCl). In contrast, under these conditions, the control protein YwbN-Myc was secreted in a strictly TatAyCy-dependent manner, as evidenced by the fact that it was secreted only by the parental strain 168 and the tatAdCd mutant but not by the tatAyCy or total-tat2 mutants (Fig. 2B). These findings show that under the tested conditions, the precursors of AmiA-GFP, DmsA-GFP, and MdoD-GFP are rejected by the Tat system of B. subtilis.
Fig 2.
Secretion of AmiA-GFP, DmsA-GFP, or MdoD-GFP by cells grown in standard LB medium with 1% NaCl. (A) Cell and growth medium fractions of B. subtilis strains producing AmiA-GFP, DmsA-GFP, or MdoD-GFP were separated by centrifugation and used for SDS-PAGE and Western blotting with specific antibodies. For this purpose, the cells of tatAyCy, tatAdCd, or total-tat mutant strains or the parental strain 168 were grown for 7 h in LB medium, supplemented with 1% NaCl. Protein loading was corrected for OD600. pG, cells harboring pHB-AmiA-GFP, pHB-DmsA-GFP, or pHB-MdoD-GFP; ev, cells harboring the empty vector pHB201. (B) Cell and growth medium fractions of B. subtilis strains producing YwbN-Myc were prepared for SDS-PAGE and Western blotting with specific antibodies as indicated for panel A. For this purpose, the cells of tatAyCy, tatAdCd, or total-tat mutant strains or the parental strain 168 contained the XywbN cassette in amyE. Xy, cells containing the XywbN cassette.
Rejection of the chimeric YwbN-GFP protein by Tat.
Our previous studies have shown that the RR signal peptide of the Tat substrate YwbN can redirect the normally Sec-dependent protein AprE into the B. subtilis Tat pathway, leading to TatAyCy-dependent secretion of this protein (25). We decided therefore to challenge the Tat system with a chimeric protein consisting of GFP fused to the C terminus of full-length YwbN (YwbN-GFP). As controls, we used strains producing GFP with or without the RR signal peptide (denoted SpGFP and GFP, respectively). Subsequently, the YwbN-GFP, SpGFP, or GFP proteins were produced using the subtilin-induced SURE system (9). The possible secretion of YwbN-GFP or GFP was assessed by Western blotting using specific antibodies for GFP and YwbN. As shown in Fig. 3, neither GFP nor SpGFP was secreted into the growth medium. In contrast, small amounts of the YwbN-GFP fusion protein were secreted, but this was independent of the TatAyCy or TatAdCd translocases. These findings show that GFP produced in B. subtilis is rejected by the Tat system, irrespective of its fusion to a full-size Tat substrate or an RR signal peptide only.
Fig 3.
Secretion of a chimeric YwbN-GFP fusion protein. Cell and growth medium fractions of B. subtilis strains producing GFP, GFP fused to the signal peptide of YwbN (SpGFP), or the fusion protein YwbN-GFP were separated by centrifugation and used for SDS-PAGE and Western blotting with specific monoclonal antibodies directed against GFP and polyclonal antibodies against YwbN. Notably, the full-size YwbN-GFP fusion protein was efficiently detected only with antibodies against YwbN. Specifically, the cells of parental strain 168, as well as the ywbN (mutant lacking ywbN gene), ywbN pGFP (producing “unfused” GFP), ywbN pSpGFP (producing SpGFP), ywbN pYwbNGFP (producing YwbN-GFP), ywbN AyCy pYwbNGFP (lacking TatAyCy and producing YwbN-GFP), and ywbN AdCd pYwbNGFP (lacking TatAdCd and producing YwbN-GFP) mutant strains, were grown for 7 h in LB medium, supplemented with 1% NaCl. Protein loading was corrected for OD600. The positions of GFP, SpGFP, YwbNGFP, the secreted control protein LipA, and the cytoplasmic lysis marker TrxA are indicated with arrows. Positions of Mw markers are indicated on the left.
To test whether the GFP protein produced with the different signal peptide fusions was active, we analyzed the producing cells by fluorescence microscopy. As can be observed in Fig. 4, the production of the authentic GFP protein with the control plasmid pGFP resulted in a very bright fluorescent signal throughout the B. subtilis cells. Fusion of the YwbN signal peptide to GFP largely abolished the fluorescent signal, and the remaining signal was most clearly detectable at the cell poles. Notably, production of the YwbN-GFP fusion protein resulted in a spotted pattern of GFP fluorescence that was not altered in the absence of the tatAyCy or tatAdCd genes. Together with the Western blotting data, these findings suggest that fusion of YwbN or the YwbN signal peptide to GFP may interfere with its folding into an active and stable conformation and/or to an altered subcellular localization, possibly in an aggregated state. Alternatively, the GFP might correctly fold and then aggregate.
Fig 4.
Fluorescence microscopic analysis of GFP, SpGFP, and YwbNGFP production. Cells of B. subtilis 168 producing GFP, GFP fused to the signal peptide of YwbN (SpGFP), or the YwbN-GFP fusion protein were grown in LB medium with 1% NaCl till an OD600 of 1.0. The strains were then induced with subtilin by the addition of spent medium from B. subtilis ATCC 6633 (1%, vol/vol) and grown for 2 additional hours. After this time period, cells were spotted onto M9 agarose slides with 1% NaCl and analyzed by phase contrast and fluorescence microscopy.
Phosphate starvation conditions result in Tat-independent GFP secretion.
Studies on the B. subtilis Tat translocases (following expression in both B. subtilis and E. coli) have shown that the TatAdCd translocase is the most permissive of the two translocases present in B. subtilis (4, 17). However, production of the TatAdCd complex of B. subtilis is fully induced only under phosphate starvation conditions (23, 36). We thus investigated whether this translocase can facilitate the secretion of AmiA-GFP, DmsA-GFP, or MdoD-GFP under conditions of phosphate starvation. As shown in Fig. 5, all three precursors were produced by cells grown in LPDM medium, with the cells also containing mature GFP in various amounts. Furthermore, secretion of mature-size GFP was observed in the AmiA-GFP- and DmsA-GFP-producing strains (Fig. 5A, right). The secretion of GFP was, however, mostly Tat independent, since bands corresponding to mature-size GFP were detected in the medium of mutant strains lacking tatAyCy, tatAdCd, or all tat genes. In contrast, no GFP secretion was observed for cells producing MdoD-GFP. In control experiments, the secretion of PhoD was found to be dependent upon the production of the TatAdCd complex, as shown by the lack of PhoD secreted by the tatAdCd and total-tat mutant strains, in addition to the PhoD secretion observed in the strain lacking the tatAyCy genes. Furthermore, secretion of the Sec-dependent protein PhoB was not affected by any of the tested tat mutations. These findings show that induction of the TatAdCd translocase does not preclude the rejection of GFP by the B. subtilis Tat system.
Fig 5.
Secretion of AmiA-GFP, DmsA-GFP, or MdoD-GFP by cells grown in phosphate starvation conditions. Cell and growth medium fractions of B. subtilis strains producing AmiA-GFP, DmsA-GFP, or MdoD-GFP (A), PhoD (B), or PhoB (C) were separated by centrifugation and used for SDS-PAGE and Western blotting with specific antibodies. For this purpose, the cells of tatAyCy, tatAdCd, or total-tat mutant strains or the parental strain 168 were grown for 7 h in LPDM medium. Protein loading was corrected for OD600. Lanes are labeled as described in the legend to Fig. 2, and the positions of precursor and mature forms of PhoD and PhoB are marked with arrows. Positions of Mw markers are indicated on the left. Note that PhoD and PhoB are produced through expression of the authentic genes from their own promoters.
High-salinity growth conditions result in elevated levels of Tat-independent GFP secretion.
We have previously shown that the specificity of Tat-dependent protein transport in B. subtilis is influenced by the salinity of the growth medium (50). This was most clearly evidenced by the finding that some YwbN was secreted completely Tat independently when LB medium was supplemented with 6% NaCl (instead of the standard 1% NaCl). To investigate whether the secretion of AmiA-GFP, DmsA-GFP, MdoD-GFP, SpYwbN-GFP, or YwbN-GFP might be influenced by a growth medium with high salinity, cells producing these hybrid precursors were grown in LB medium with 6% NaCl. As shown by Western blotting of cellular and growth medium samples, the increased salt concentration in the medium resulted in a drastically improved secretion of DmsA-GFP, with mature-size GFP now clearly detectable in both the cellular and growth medium fractions (Fig. 6A). The highest levels of secreted GFP were observed for the tatAyCy and total-tat mutant strains, suggesting that the TatAyCy translocase interferes with the Tat-independent translocation of DmsA-GFP during growth in LB medium with 6% salt. Consistent with these findings, the high-salinity growth conditions clearly had a stimulating effect on the secretion of mature GFP by cells producing AmiA-GFP or MdoD-GFP. Again, the highest levels of mature GFP were secreted by the tatAyCy and total-tat mutant strains. The high salt concentration had no effect on secretion of SpYwbN-GFP or YwbN-GFP (not shown). Under the same conditions, Tat-independent secretion of YwbN was observed (Fig. 6B) as previously reported (50). These observations show that the Tat-independent secretion of GFP and YwbN is strongly stimulated when cells are grown in LB medium with 6% NaCl. As the Tat-independent secretion most likely takes place via the Sec pathway (25, 50), these findings imply that the high-salinity growth conditions result (at least partially) in a suppressed Sec avoidance of the respective precursor proteins. Since both Tat-dependent protein translocation and Sec avoidance are determined not only by features of the signal peptide but also by the folding state of the respective precursor protein, we used fluorescence microscopy to determine whether folded and active GFP is detectable in cells producing AmiA-GFP, DmsA-GFP, or MdoD-GFP. Indeed, Fig. 7 shows that at least some of the GFP within cells producing AmiA-GFP, DmsA-GFP, or MdoD-GFP is active when cells were grown in LB with 6% NaCl. Nevertheless, little if any GFP seems to be secreted by the Tat translocases of the respective cells. It should be noted here that the cellular GFP expression levels and fluorescence were not substantially different when cells were grown in LB with 1% or with 6% NaCl, suggesting that salt does not directly affect the folding state of cytoplasmic GFP (data not shown). This view is supported by the finding that cells producing the authentic GFP (without signal peptide) did not show significant differences in fluorescence upon growth in LB with 1% or 6% NaCl (Fig. 8).
Fig 6.
Secretion of AmiA-GFP, DmsA-GFP, or MdoD-GFP by cells grown in LB medium with 6% NaCl. Cell and growth medium fractions of B. subtilis strains producing AmiA-GFP, DmsA-GFP, or MdoD-GFP (A) or YwbN-Myc (B) were separated by centrifugation and used for SDS-PAGE and Western blotting with specific antibodies. For this purpose, the cells of tatAyCy, tatAdCd, or total-tat mutant strains or the parental strain 168 were grown for 7 h in LB medium, supplemented with 6% NaCl. Protein loading was corrected for OD600. Lanes are labeled as described in the legend to Fig. 2, and the positions of precursor and mature forms of GFP and YwbN-Myc are marked with arrows. Positions of Mw markers are indicated on the left.
Fig 7.

Fluorescence microscopic analysis of AmiA-GFP, DmsA-GFP, or MdoD-GFP production by cells grown in LB medium with 6% NaCl. Cells of B. subtilis 168 producing AmiA-GFP (AmiA), DmsA-GFP (DmsA), MdoD-GFP (MdoD), or no GFP (strain containing the empty vector pHB201) were grown in LB medium with 6% NaCl for 7 h. Cells were spotted onto M9 agarose slides with 6% NaCl and analyzed by phase contrast and fluorescence microscopy. The cellular fluorescence values indicated in the fluorescence panels were determined as arbitrary gray scale units of the cells and have been corrected for average background fluorescence. Please note that the production levels of AmiA-GFP, DmsA-GFP, and MdoD-GFP are much lower than the production levels of the subtilin-induced GFP constructs shown in Fig. 4.
Fig 8.
Fluorescence microscopic analysis of GFP production by cells grown in LB medium with 1% or 6% NaCl. Cells of B. subtilis 168 (pGFP) producing “unfused” GFP were grown in LB medium with 1% or 6% NaCl till an OD600 of 1.0. The strains were then induced with subtilin by the addition of spent medium from B. subtilis ATCC 6633 (1%, vol/vol) and grown for 2 additional hours. After this time period, cells were spotted onto M9 agarose slides with 1% or 6% NaCl and analyzed by fluorescence microscopy.
DISCUSSION
The present studies were aimed at investigating the possible Tat-dependent secretion in B. subtilis of hybrid GFP precursor proteins that contain the RR signal peptides of the E. coli AmiA, DmsA, or MdoD proteins. While these precursors were previously shown to be transported to the periplasm of E. coli by the heterologously expressed TatAdCd or TatAyCy translocases of B. subtilis (4, 5), we now show that these precursors are not accepted by the B. subtilis TatAC translocases when expressed in B. subtilis. Instead, Tat-independent secretion of GFP was observed in strains producing the AmiA-GFP or MdoD-GFP precursors under standard growth conditions (i.e., LB medium with 1% NaCl), and this Tat-independent secretion was significantly enhanced when the strains were grown in LB medium with 6% NaCl. While cells expressing the DmsA-GFP precursor under standard growth conditions did not secrete GFP, these cells did secrete GFP Tat independently when grown in LB with 6% NaCl. Under these high-salinity growth conditions, we also observed Tat-independent secretion of the known B. subtilis Tat substrate YwbN. These findings imply that the Sec avoidance of B. subtilis RR precursor proteins under standard growth conditions is suppressed under high-salinity growth conditions.
To investigate whether a full-size Tat-dependent protein might serve as a carrier for Tat-dependent translocation of GFP in B. subtilis, the possible secretion of a YwbN-GFP fusion protein was investigated. However, the results showed unambiguously that this fusion protein was not exported Tat dependently, as was the case when only the YwbN signal peptide was fused to GFP. While YwbN-GFP was effectively produced, degradation within the B. subtilis cells was observed, and small amounts were found to be secreted Tat independently. The finding that the YwbN signal peptide can direct Tat-independent secretion is in agreement with previous studies indicating that this RR signal peptide is able to direct either Tat- or Sec-dependent secretion of particular proteins to which it was fused (25, 27). This was even true for the authentic E. coli Tat substrate SufI, which was secreted Tat independently in B. subtilis when fused to the YwbN signal peptide (25). In contrast to the AmiA-GFP, DmsA-GFP, or MdoD-GFP, no difference in GFP secretion was observed when the strains producing YwbN-GFP or SpYwbN-GFP were grown in LB with 6% NaCl (data not shown). This suggests that the altered behavior of AmiA-GFP, DmsA-GFP, or MdoD-GFP under high-salinity growth conditions may relate to specific properties of the respective signal peptides.
Previous studies have indicated that the Tat pathway in B. subtilis is able to facilitate the secretion of GFP, albeit in an inactive state (32). It is therefore not clear why the B. subtilis TatAC translocases do not facilitate the secretion of mature GFP when the AmiA-GFP, DmsA-GFP, MdoD-GFP, SpYwbN-GFP, or YwbN-GF precursors are produced in B. subtilis. At least three possible reasons for this finding are conceivable. First, the respective RR signal peptides may not be presented to the TatAC translocases in the right way. This would then expose these signal peptides to the Sec machinery of B. subtilis, resulting in Tat-independent GFP secretion via the Sec pathway. Consistent with this idea, the RR motifs in the AmiA, DmsA, and MdoD signal peptides do not show a perfect match with the consensus RR motif (S/T)RRXFLK (Fig. 1). Nevertheless, at least under high-salinity growth conditions, the RR signal peptides of AmiA, DmsA, and MdoD seem to be recognized somehow by TatAyCy, as was evidenced by the observation that Tat-independent GFP secretion was enhanced in B. subtilis strains lacking tatAyCy. Second, the GFP attached to the AmiA, DmsA, or MdoD signal peptides may not fold rapidly enough in B. subtilis to allow Tat-dependent translocation of the fusion proteins. This seems to be the case for the SpYwbN-GFP fusion, the production of which resulted in substantially lower levels of cell fluorescence than the production of GFP without an attached signal peptide. This was despite the protein production levels of GFP with or without the YwbN signal peptide being very similar (Fig. 3). Furthermore, foci of fluorescence were observed in cells producing SpYwbN-GFP or YwbN-GFP, suggesting that aggregation of GFP might occur, thereby precluding its efficient export via Tat. On the other hand, the identification of GFP foci at the cell poles is in agreement with previous reports, which showed a polar and septal localization of Tat machinery components in B. subtilis (31, 41). However, mutations in the tatAyCy or tatAdCd genes did not seem to influence the appearance of GFP foci, suggesting that this phenomenon is not directly related to interactions with the Tat machinery. Third, B. subtilis may be missing some chaperones that are needed to coordinate the export of the investigated GFP fusion proteins. This might apply to the fusions containing E. coli RR signal peptides, like the DmsA signal peptide, which is known to be recognized by the DmsD chaperone (38, 43). On the other hand, if the absence of an appropriate chaperone were the main problem, we would expect that fusing GFP to a native Tat substrate of B. subtilis, such as YwbN, would result in productive Tat-dependent GFP export provided that the fused GFP is folded.
Analyses of cells producing AmiA-GFP, DmsA-GFP, or MdoD-GFP by fluorescence microscopy showed that these cells contained little or no active GFP. Furthermore, Western blotting revealed that some of the produced GFP is secreted Tat independently, possibly via the Sec pathway. Such secretion via Sec would suggest slow folding of GFP since the Sec pathway is known to translocate only proteins in an unfolded state. Notably, Tullman-Ercek et al. (49) reported that the signal peptides of AmiA, DmsA, and MdoD can direct attached proteins, such as GFP, the alkaline phosphatase PhoA, and the maltose-binding protein MBP, to both the Sec and Tat pathways of E. coli. The Tat specificity of the AmiA and MdoD signal peptides was found to be especially low when fused to the alkaline phosphatase PhoA, which is a regular Sec substrate (49). However, the Tat-independent export of GFP fused to the AmiA and MdoD signal peptides was also substantial (about 25 to 30%), which is consistent with our present finding that these hybrid precursors are Tat independently exported in B. subtilis. Furthermore, the export of DmsA-GFP in E. coli, as reported by Tullman-Ercek et al., was less than 10% Tat independent, which is in line with our present observations that the synthesis of this precursor does not lead to detectable levels of Tat-independent secretion of GFP. The observed strong Sec avoidance of DmsA-GFP is consistent with the presence of two positively charged residues in the C region of the DmsA signal peptide (i.e., Arg and His; Fig. 1). Such positively charged residues with a possible role in Sec avoidance are absent from the AmiA and MdoD signal peptides.
Interestingly, an increased salinity of the growth medium seems to result in a suppression of Sec avoidance, not only by the AmiA-GFP, DmsA-GFP, and MdoD-GFP precursors but also by authentic Tat-dependently secreted proteins, such as YwbN. It is at present not clear why this happens, but the finding suggests that electrostatic interactions and/or a salt-sensitive factor are involved in Sec avoidance. A possible involvement of electrostatic interactions in Sec avoidance would be in line with the finding that positively charged residues in the C region of the signal peptide facilitate Sec avoidance. However, high salinity of the growth medium might also slow down the folding of precursor proteins, for example, through changes in the cytoplasmic concentrations of compatible solutes, which would then make these proteins more attractive for the Sec translocase (11, 20, 50). One additional Sec avoidance determinant seems to be the TatAyCy translocase itself, since the absence of this translocase resulted in increased levels of GFP secretion under high-salinity growth conditions. It thus seems that TatAyCy can be directly involved in Sec avoidance, possibly by targeting unfolded GFP precursors for degradation or by redirecting them into the cytoplasm where they fold into a Sec incompatible state. Notably, in B. subtilis, an increased TatAdCd-dependent secretion in the absence of TatAyCy has previously been shown for the phosphodiestase PhoD (23). This supports the view that interactions of certain precursor proteins with TatAyCy may lead to the rejection of these precursors for translocation via Tat in B. subtilis.
In conclusion, the present results indicate that as-yet-unidentified control mechanisms reject the AmiA-GFP, DmsA-GFP, and MdoD-GFP fusion proteins for translocation by the B. subtilis Tat machinery and, at the same time, set limits to their Sec-dependent secretion. At least the Sec avoidance of all three hybrid GFP precursors seems to be overruled when cells are grown in LB medium with 6% NaCl. Further studies to characterize this phenomenon should involve the systematic mutagenesis of the C regions of the AmiA, DmsA, MdoD, and YwbN signal peptides. In addition, at least under these high-salinity growth conditions, the TatAyCy translocase seems to be a determinant in Sec avoidance, probably due to preferential signal peptide recognition. Most likely, the identification and subsequent elimination or modulation of the control systems that limit GFP secretion will be key to unlocking the B. subtilis Tat pathway for the production of heterologous proteins.
ACKNOWLEDGMENTS
We thank Jörg Müller for antibodies against PhoD and Jeanine de Keyzer and Arnold Driessen for antibodies against PhoB.
R.V.D.P., C.G.M., T.R.H.M.K., S.P., and J.M.V.D. were in part supported by the CEU projects LSHM-CT-2006-019064, LSHG-CT-2006-037469, PITN-GA-2008-215524, and 244093 and the transnational SysMO projects BACELL SysMO 1 and 2 through the Research Council for Earth and Life Sciences of the Netherlands Organization for Scientific Research. J.P.B. and C.R. were supported in part by a Biotechnology and Biological Sciences Research Council grant and the CEU projects LSHG-CT-2004-005257 and PITN-GA-2008-215524.
The authors declare that they have no competing interests.
Footnotes
Published ahead of print 24 August 2012
REFERENCES
- 1. Alami M, et al. 2003. Differential interactions between a twin-arginine signal peptide and its translocase in Escherichia coli. Mol. Cell 12:937–946 [DOI] [PubMed] [Google Scholar]
- 2. Antelmann H, et al. 2003. The extracellular proteome of Bacillus subtilis under secretion stress conditions. Mol. Microbiol. 49:143–156 [DOI] [PubMed] [Google Scholar]
- 3. Antelmann H, et al. 2001. A proteomic view on genome-based signal peptide predictions. Genome Res. 11:1484–1502 [DOI] [PubMed] [Google Scholar]
- 4. Barnett JP, Eijlander RT, Kuipers OP, Robinson C. 2008. A minimal Tat system from a Gram-positive organism: a bifunctional TatA subunit participates in discrete TatAC and TatA complexes. J. Biol. Chem. 283:2534–2542 [DOI] [PubMed] [Google Scholar]
- 5. Barnett JP, et al. 2009. The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements. FEBS J. 276:232–243 [DOI] [PubMed] [Google Scholar]
- 6. Berks BC. 1996. A common export pathway for proteins binding complex redox cofactors? Mol. Microbiol. 22:393–404 [DOI] [PubMed] [Google Scholar]
- 7. Bogsch E, Brink S, Robinson C. 1997. Pathway specificity for a delta pH-dependent precursor thylakoid lumen protein is governed by a ‘Sec-avoidance’ motif in the transfer peptide and a ‘Sec-incompatible’ mature protein. EMBO J. 16:3851–3859 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Bolhuis A, Mathers JE, Thomas JD, Barrett CM, Robinson C. 2001. TatB and TatC form a functional and structural unit of the twin-arginine translocase from Escherichia coli. J. Biol. Chem. 276:20213–20219 [DOI] [PubMed] [Google Scholar]
- 9. Bongers RS, Veening JW, Van Wieringen M, Kuipers OP, Kleerebezem M. 2005. Development and characterization of a subtilin regulated expression system in Bacillus subtilis: strict control of gene expression by addition of subtilin. Appl. Environ. Microbiol. 71:8818–8824 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Bron S, et al. 1998. Protein secretion and possible roles for multiple signal peptidases for precursor processing in bacilli. J. Biotechnol. 64:3–13 [DOI] [PubMed] [Google Scholar]
- 11. Bursy J, Pierik AJ, Pica N, Bremer E. 2007. Osmotically induced synthesis of the compatible solute hydroxyectoine is mediated by an evolutionarily conserved ectoine hydroxylase. J. Biol. Chem. 282:31147–31155 [DOI] [PubMed] [Google Scholar]
- 12. Chaddock AM, et al. 1995. A new type of signal peptide: central role of a twin-arginine motif in transfer signals for the delta pH-dependent thylakoidal protein translocase. EMBO J. 14:2715–2722 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Cline K, Mori H. 2001. Thylakoid DeltapH-dependent precursor proteins bind to a cpTatC-Hcf106 complex before Tha4-dependent transport. J. Cell Biol. 154:719–729 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Cristobal S, de Gier JW, Nielsen H, von Heijne G. 1999. Competition between Sec- and TAT-dependent protein translocation in Escherichia coli. EMBO J. 18:2982–2990 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. DeLisa MP, Tullman D, Georgiou G. 2003. Folding quality control in the export of proteins by the bacterial twin-arginine translocation pathway. Proc. Natl. Acad. Sci. U. S. A. 100:6115–6120 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Driessen AJ, Nouwen N. 2008. Protein translocation across the bacterial cytoplasmic membrane. Annu. Rev. Biochem. 77:643–667 [DOI] [PubMed] [Google Scholar]
- 17. Eijlander RT, Jongbloed JD, Kuipers OP. 2009. Relaxed specificity of the Bacillus subtilis TatAdCd translocase in Tat-dependent protein secretion. J. Bacteriol. 191:196–202 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Gasson MJ. 1983. Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J. Bacteriol. 154:1–9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Harwood CR, Cranenburgh R. 2008. Bacillus protein secretion: an unfolding story. Trends Microbiol. 16:73–79 [DOI] [PubMed] [Google Scholar]
- 20. Hoper D, Bernhardt J, Hecker M. 2006. Salt stress adaptation of Bacillus subtilis: a physiological proteomics approach. Proteomics 6:1550–1562 [DOI] [PubMed] [Google Scholar]
- 21. Jongbloed JD, et al. 2002. Selective contribution of the twin-arginine translocation pathway to protein secretion in Bacillus subtilis. J. Biol. Chem. 277:44068–44078 [DOI] [PubMed] [Google Scholar]
- 22. Jongbloed JD, et al. 2004. Two minimal Tat translocases in Bacillus. Mol. Microbiol. 54:1319–1325 [DOI] [PubMed] [Google Scholar]
- 23. Jongbloed JD, et al. 2000. TatC is a specificity determinant for protein secretion via the twin-arginine translocation pathway. J. Biol. Chem. 275:41350–41357 [DOI] [PubMed] [Google Scholar]
- 24. Jongbloed JD, van der Ploeg R, van Dijl JM. 2006. Bifunctional TatA subunits in minimal Tat protein translocases. Trends Microbiol. 14:2–4 [DOI] [PubMed] [Google Scholar]
- 25. Kolkman MA, et al. 2008. The twin-arginine signal peptide of Bacillus subtilis YwbN can direct either Tat- or Sec-dependent secretion of different cargo proteins: secretion of active subtilisin via the B. subtilis Tat pathway. Appl. Environ. Microbiol. 74:7507–7513 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Kouwen TR, et al. 2007. Thiol-disulphide oxidoreductase modules in the low-GC Gram-positive bacteria. Mol. Microbiol. 64:984–999 [DOI] [PubMed] [Google Scholar]
- 27. Kouwen TR, et al. 2009. Overflow of a hyper-produced secretory protein from the Bacillus Sec pathway into the Tat pathway for protein secretion as revealed by proteogenomics. Proteomics 9:1018–1032 [DOI] [PubMed] [Google Scholar]
- 28. Kunst F, Rapoport G. 1995. Salt stress is an environmental signal affecting degradative enzyme synthesis in Bacillus subtilis. J. Bacteriol. 177:2403–2407 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Lewis PJ, Marston A. 1999. GFP vectors for controlled expression and dual labelling of protein fusions in Bacillus subtilis. Gene 227:101–110 [DOI] [PubMed] [Google Scholar]
- 30. Maillard J, et al. 2007. Structural diversity in twin-arginine signal peptide-binding proteins. Proc. Natl. Acad. Sci. U. S. A. 104:15641–15646 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Meile J-C, Wu LJ, Ehrlich SD, Errington J, Noirot P. 2006. Systematic localisation of proteins fused to the green fluorescent protein in Bacillus subtilis: identification of new proteins at the DNA replication factory. Proteomics 6:2135–2146 [DOI] [PubMed] [Google Scholar]
- 32. Meissner D, Vollstedt A, van Dijl JM, Freudl R. 2007. Comparative analysis of twin-arginine (Tat)-dependent protein secretion of a heterologous model protein (GFP) in three different Gram-positive bacteria. Appl. Microbiol. Biotechnol. 76:633–642 [DOI] [PubMed] [Google Scholar]
- 33. Mendel S, et al. 2008. The Escherichia coli TatABC system and a Bacillus subtilis TatAC-type system recognise three distinct targeting determinants in twin-arginine signal peptides. J. Mol. Biol. 375:661–672 [DOI] [PubMed] [Google Scholar]
- 34. Muller JP, An Z, Merad T, Hancock IC, Harwood CR. 1997. Influence of Bacillus subtilis phoR on cell wall anionic polymers. Microbiology 143:947–956 [DOI] [PubMed] [Google Scholar]
- 35. Natale P, Bruser T, Driessen AJ. 2008. Sec- and Tat-mediated protein secretion across the bacterial cytoplasmic membrane—distinct translocases and mechanisms. Biochim. Biophys. Acta 1778:1735–1756 [DOI] [PubMed] [Google Scholar]
- 36. Nicolas P, et al. 2012. Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science 335:1103–1106 [DOI] [PubMed] [Google Scholar]
- 37. Palmer T, Berks BC. 2012. The twin-arginine translocation (Tat) protein export pathway. Nat. Rev. Microbiol. 10:483–496 [DOI] [PubMed] [Google Scholar]
- 38. Palmer T, Sargent F, Berks BC. 2005. Export of complex cofactor-containing proteins by the bacterial Tat pathway. Trends Microbiol. 13:175–180 [DOI] [PubMed] [Google Scholar]
- 39. Panahandeh S, Maurer C, Moser M, Delisa MP, Muller M. 2008. Following the path of a twin-arginine precursor along the TatABC translocase of Escherichia coli. J. Biol. Chem. 283:33267–33275 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Pommier J, Mejean V, Giordano G, Iobbi-Nivol C. 1998. TorD, a cytoplasmic chaperone that interacts with the unfolded trimethylamine N-oxide reductase enzyme (TorA) in Escherichia coli. J. Biol. Chem. 273:16615–16620 [DOI] [PubMed] [Google Scholar]
- 41. Ridder AN, de Jong EJ, Jongbloed JD, Kuipers OP. 2009. Subcellular localization of TatAd of Bacillus subtilis depends on the presence of TatCd or TatCy. J. Bacteriol. 191:4410–4418 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Robinson C, Bolhuis A. 2004. Tat-dependent protein targeting in prokaryotes and chloroplasts. Biochim. Biophys. Acta 1694:135–147 [DOI] [PubMed] [Google Scholar]
- 43. Robinson C, et al. 2011. Transport and proofreading of proteins by the twin-arginine translocation (Tat) system in bacteria. Biochim. Biophys. Acta 1808:876–884 [DOI] [PubMed] [Google Scholar]
- 44. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]
- 45. Sargent F. 2007. The twin-arginine transport system: moving folded proteins across membranes. Biochem. Soc. Trans. 35:835–847 [DOI] [PubMed] [Google Scholar]
- 46. Stanley NR, Palmer T, Berks BC. 2000. The twin arginine consensus motif of Tat signal peptides is involved in Sec-independent protein targeting in Escherichia coli. J. Biol. Chem. 275:11591–11596 [DOI] [PubMed] [Google Scholar]
- 47. Tjalsma H, et al. 2004. Proteomics of protein secretion by Bacillus subtilis: separating the “secrets” of the secretome. Microbiol. Mol. Biol. Rev. 68:207–233 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Tjalsma H, Bolhuis A, Jongbloed JD, Bron S, van Dijl JM. 2000. Signal peptide-dependent protein transport in Bacillus subtilis: a genome-based survey of the secretome. Microbiol. Mol. Biol. Rev. 64:515–547 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Tullman-Ercek D, et al. 2007. Export pathway selectivity of Escherichia coli twin arginine translocation signal peptides. J. Biol. Chem. 282:8309–8316 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. van der Ploeg R, et al. 2011. Environmental salinity determines the specificity and need for Tat-dependent secretion of the YwbN protein in Bacillus subtilis. PLoS One 6:e18140 doi:10.1371/journal.pone.0018140 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. van Dijl JM, et al. 2002. Functional genomic analysis of the Bacillus subtilis Tat pathway for protein secretion. J. Biotechnol. 98:243–254 [DOI] [PubMed] [Google Scholar]
- 52. van Roosmalen ML, et al. 2004. Type I signal peptidases of Gram-positive bacteria. Biochim. Biophys. Acta 1694:279–297 [DOI] [PubMed] [Google Scholar]
- 53. Yuan J, Zweers JC, van Dijl JM, Dalbey RE. 2010. Protein transport across and into cell membranes in bacteria and archaea. Cell. Mol. Life Sci. 67:179–199 [DOI] [PMC free article] [PubMed] [Google Scholar]






