Enhancement of Ganoderic Acid Accumulation by Overexpression of an N-Terminally Truncated 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Gene in the Basidiomycete Ganoderma lucidum

Abstract

Ganoderic acids produced by Ganoderma lucidum, a well-known traditional Chinese medicinal mushroom, exhibit antitumor and antimetastasis activities. Genetic modification of G. lucidum is difficult but critical for the enhancement of cellular accumulation of ganoderic acids. In this study, a homologous genetic transformation system for G. lucidum was developed for the first time using mutated sdhB, encoding the iron-sulfur protein subunit of succinate dehydrogenase, as a selection marker. The truncated G. lucidum gene encoding the catalytic domain of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) was overexpressed by using the Agrobacterium tumefaciens-mediated transformation system. The results showed that the mutated sdhB successfully conferred carboxin resistance upon transformation. Most of the integrated transfer DNA (T-DNA) appeared as a single copy in the genome. Moreover, deregulated constitutive overexpression of the HMGR gene led to a 2-fold increase in ganoderic acid content. It also increased the accumulation of intermediates (squalene and lanosterol) and the upregulation of downstream genes such as those of farnesyl pyrophosphate synthase, squalene synthase, and lanosterol synthase. This study demonstrates that transgenic basidiomycete G. lucidum is a promising system to achieve metabolic engineering of the ganoderic acid pathway.

INTRODUCTION

Medicinal mushrooms are a rich source of therapeutically useful, biologically active agents. Ganoderma lucidum, a well-known traditional Chinese medicinal mushroom, has been used as a medication for the prevention and treatment of various human diseases for centuries in Asia. Ganoderic acids, a kind of highly oxygenated C30 lanostane-type triterpenoids produced by G. lucidum, exhibit a number of significant pharmacological activities such as cytotoxicity to hepatoma cells and antitumor, antimetastasis, and anti-HIV activity (50, 53). The biosynthesis of ganoderic acids was considered to start from acetyl coenzyme A (acetyl-CoA) and termed as mevalonate (MVA) pathway, where MVA was considered to be the only precursor. This pathway involves the sequential conversion of farnesyl diphosphate to squalene, 2, 3-oxidosqualene, and lanosterol (50). Some structural genes in the early stages of ganoderic acid biosynthetic pathway that encode 3-hydroxy-3-methylglutaryl CoA reductase (HMGR), farnesyl-diphosphate synthase (FPS), squalene synthase (SQS), and lanosterol synthase (LS) have been isolated and characterized (33). Although previous reports indicated that lanosterol is subsequently converted to ganoderic acids in G. lucidum (35), the final steps from lanosterol to ganoderic acids including a series of oxidation, reduction, and acylation reactions remain unclear (50).

Ganoderic acids receive extensive attention due to their important bioactivities. Thus, several approaches are adopted to improve their accumulation in submerged fermentation of G. lucidum, such as the manipulation of fermentation conditions, the addition of inducers, and the development of new bioprocessing strategies (18, 26, 39, 40, 42, 52, 56). However, higher yield of ganoderic acids in G. lucidum mycelia is needed for commercial applications (33). Genetic engineering has been successfully used to enhance the yields of bioactive compounds (55) and some enzymes such as laccase (1, 13) and versatile peroxidase MnP2 (41) in basidiomycete Agaricomycetes. However, no study reported the enhancement of terpenes accumulation through genetic manipulation of basidiomycetes.

The availability of practical transformation systems is a limiting factor for the genetic improvement of basidiomycetous mushrooms for biotechnological applications (11, 12, 14). Basidiomycete mushrooms generally exhibit higher resistance to genetic transformation compared to ascomycetous fungi (37). Despite the great requirement for G. lucidum, only a few reports exist regarding its genetic transformation using heterologous resistance genes as selection marker (16, 34, 38). In addition, the application of these methods to express other genes except marker genes has never been reported. Based on our experience, poor expression of heterologous genes, instability, and the formation of false positives possibly contribute to this situation.

A suitable transformation system is required to increase ganoderic acid accumulation in G. lucidum via molecular manipulation. Generally, a suitable selection marker gene and a stable transformation method are necessary for the development of a stable transformation system. The homologous marker gene is more efficient in establishing transformation system of basidiomycete mushrooms (15), which is also expected to be maintained and expressed more stably in the mycelium (10). Agrobacterium tumefaciens-mediated transformation (ATMT) is an efficient fungal transformation method and that shows a greater degree of stability for transgenes (5, 7, 45). Therefore, a homologous selection marker gene, cbx^r, conferred by sdhB mutation and ATMT were used here to obtain stable transformants of G. lucidum. A homologous drug resistance marker that confers dominant resistance to fungicide carboxin has been used in some mushrooms such as Pleurotus ostreatus (10), Lentinula edodes (12), and Coprinopsis cinerea (15). This marker gene encodes a mutant iron-sulfur protein subunit of succinate dehydrogenase (SdhB). To the best of our knowledge, there has been no report of a homologous transformation system for G. lucidum.

HMGR is a key enzyme in the MVA-isoprenoid pathway that leads to the synthesis of various intermediates (8, 22), used for the biosynthesis of various terpenes. Constitutive overexpression of HMGR gene highly increases accumulation of monoterpenes (27), sesquiterpenes (2, 28), diterpenes (4), and tetraterpenes (43). Mutations of the HMGR gene also decrease triterpenoid levels in Arabidopsis thaliana (24). These observations reinforce the pivotal function of HMGR in the biosynthesis of terpenoids. The G. lucidum HMGR gene was cloned and characterized, and its expression exhibited a positive correlation with triterpenoid content according to reverse transcription-PCR (RT-PCR) data (32, 49). However, no direct evidence was found for the regulatory function of HMGR gene in the biosynthesis of triterpenoids in G. lucidum. Therefore, the regulation of ganoderic acid biosynthesis by overexpression of HMGR gene remains to be elucidated.

In the present study, a homologous genetic transformation system for G. lucidum was developed and successfully used for the genetic engineering of G. lucidum for greater a accumulation of ganoderic acids. The MVA pathway in G. lucidum was deregulated by the overexpression of the catalytic subunit of HMGR gene under the control of the G. lucidum glyceraldehyde-3-phosphate dehydrogenase gene (gpd) promoter. The effect of genetic modification on ganoderic acid biosynthesis was investigated by quantitatively analyzing ganoderic acid accumulation, intermediate formation, and gene expression of the key enzymes.

MATERIALS AND METHODS

Strains and growth conditions.

The strain G. lucidum CGMCC 5.616 from China General Microbiological Fermentation Center was maintained on potato dextrose agar and used as the recipient host strain for transformation. For plasmid construction, Escherichia coli strain DH5α was used and grown on Luria-Bertani (LB) agar plates containing 100 μg of ampicillin or 50 μg of kanamycin/ml, when appropriate. Agrobacterium tumefaciens EHA105 was used as a transfer DNA (T-DNA) donor for fungal transformation. The details of culture medium and culture conditions for G. lucidum are as follows. Preculture medium consisted of the following components (g/liter): glucose, 35; peptone, 5; yeast extract, 2.5; KH₂PO₄·H₂O, 1; MgSO₄·7H₂O, 0.5; and vitamin B₁, 0.05. For the first preculture, 40 ml of medium at an initial pH of 5.5 was prepared in a 250-ml flask, and then 10 ml of mycelium suspension from a slant culture was inoculated, followed by incubation for 5 days at 30°C on a rotary shaker (120 rpm). For the second preculture, 45 ml of medium was prepared in a 250-ml flask and inoculated with 5 ml of preculture broth (with ca. 600 to 700 mg [dry weight] of cells per liter), followed by 3 days of incubation at 30°C on a rotary shaker (120 rpm), as reported earlier (40). CYM medium (1% maltose, 2% glucose, 0.2% yeast extract, 0.2% tryptone, 0.05% MgSO₄, 0.46% KH₂PO₄, 0.6 M mannitol, 1% agar) was used for the regeneration of protoplasts from G. lucidum. LB agar was used for the transformation of A. tumefaciens EHA105. Minimal medium [MM; 10 mM K₂HPO₄, 10 mM KH₂PO₄, 2.5 mM NaCl, 2 mM MgSO₄, 0.7 mM CaCl₂, 9 μM FeSO₄, 4 mM (NH4)₂SO₄, 10 mM glucose (pH 7.0)] was used for cultivation of A. tumefaciens EHA105. Induction medium [IM; MM containing 0.5% (wt/vol) glycerol, 200 μM acetosyringone, 40 mM 2-(N-morpholino)ethanesulfonic acid, and 0.6 M mannitol (pH 5.3)] was used with A. tumefaciens EHA105 to infect G. lucidum protoplasts.

Nucleic acid extraction and cDNA synthesis.

G. lucidum mycelia were harvested, frozen in liquid nitrogen, and ground to a fine powder with a mortar and pestle. The genomic DNA was extracted using the CTAB (cetyltrimethylammonium bromide) method, and the total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA). The quality and quantity of DNA and RNA samples were determined by using ethidium bromide-stained agarose gel electrophoresis and a spectrophotometer. Residual genomic DNA in isolated total RNA was removed using RNase-free DNase I (MBI Fermentas, Canada) according to the manufacturer's protocol. Reverse transcription was achieved by using total RNA as the starting material and a Superscript RNase H⁻ First-Strand synthesis kit (Invitrogen).

Isolation and mutation of the G. lucidum sdhB.

Initially, the G. lucidum sdhB partial sequence of the genomic DNA was isolated by PCR amplification using the degenerate primers sdhB-pF and sdhB-pR (Table 1) designed on the basis of the highly conserved amino acid regions of known SdhB. After amplification, a 780-bp DNA fragment was obtained. The amplification products were cloned into pMD18-T vector (TaKaRa, Dalian, China) and sequenced. An attempt was then made to obtain the complete sequence of the sdhB by SEFA-PCR (46). PCR amplification of the 5′ end of the genomic DNA and promoter region was performed using three gene specific primers (sdhB-5sp1, sdhB-5sp2, and sdhB-5sp3) (Table 1) according to the acquired 780-bp sequence. PCR amplification of the 3′ end of the genomic DNA and terminator region was performed using three specific primers (sdhB-3sp1, sdhB-3sp2, and sdhB-3sp3) (Table 1), which were also designed based on the acquired 780-bp sequence. Self-formed adaptor-PCR (SEFA-PCR) was conducted in accordance with the manufacturer's protocol (46). We cloned and sequenced an ∼2.3-kb PCR product, including the 5′-untranslated region, and a 1.1-kb product, including the 3′-untranslated region. To amplify the whole genomic DNA of the sdhB (including the promoter and the terminator), the oligonucleotide primers sdhB-DF and sdhB-DR (Table 1) were designed based on the sequences of DNA obtained by SEFA-PCR. The thermal cycling parameters were as follows: an initial denaturation at 95°C for 10 min, followed by 30 cycles of 95°C for 30 s, 66°C for 30 s, and 72°C for 3.5 min, with a final extension at 72°C for 10 min. The amplification products were cloned into pMD18-T vector and sequenced.

Table 1.

Oligonucleotide primers used in this study

Primer	Sequence (5′–3′)a
sdhB-pF	CGGCTCGTGYGCVATGAAC
sdhB-pR	GGTTGAGRCCCTTBGGACA
sdhB-5sp1	CCGTCGAGCTTCTTCCTGTCCTCCTGC
sdhB-5sp2	TTGCTTGTAGAATTGGGTGAGGTCGGGC
sdhB-5sp3	ATGGGTAATATGCGAACGNNNNNNNNNGAAGGG
sdhB-3sp1	GTGCCCGACCTCACCCAATTCTACAAGC
sdhB-3sp2	GTCATTGGCTATCCCGTTGCTCGTTTCG
sdhB-3sp3	GGCGGACTCTCGGGTATGNNNNNNNNTCCTTC
sdhB-DF	TCTGCTCTTCCCGATTGCTGCATTTGT
sdhB-DR	CTATGTCTTGCCTTGTCTCGCGTCAACC
sdhB-MR	GAAGATCGTGAGGCAGCGGTATAGGC
sdhB-MF	GCCTATACCGCTGCCTCACGATCTTC
gpd-F	TCCAAAGCCGCTCTCATGGCATGGCAC
gpd-SOE-R	CCGCACGCATGTTGAGAGGGGGATGAAGAGTGAGTAAGAAG
hmgr-SOE-F	CCCTCTCAACATGCGTGCGGTCCGCAGCCAAG
hmgr-R	TCACTTCGCCTCGACGACGTACCC
cbx-F	TGCGTTCAGCATGTATGAG
cbx-R	CAATCTAGCCCTGCGTTA
gpd-F2	AGTTTCTGTGGTGCTGTTGC
hmgr-R2	CGAGTTAGCTTCGTCCGTCT
thmgr-F	TCCCGTGGAGCCTATTACC
thmgr-R	GGATGACCTCTTCGTCGTTC

^aDNA letter code: Y = C or T; R = A or G; V = A, C, or G; B = T, C, or G; N = A, T, G, or C.

A point mutation (CAC to CTC) that causes an amino acid substitution (His₂₁₆ to Leu) was introduced into the sdhB of G. lucidum. First, a 2,644-bp DNA fragment containing the sdhB promoter and coding sequence was amplified using the primers sdhB-DF and sdhB-MR (5′-GAAGATCGTGAGGCAGCGGTATAGGC-3′, where A indicates the site of base substitution). A 546-bp DNA fragment, including the sdhB coding and terminator sequence, was amplified using the primers sdhB-MF (5′-GCCTATACCGCTGCCTCACGATCTTC-3′, where T indicates the site of base substitution) and sdhB-DR. The template DNA used for amplification of the two fragments was genomic DNA of G. lucidum. Thermal cycling parameters for the former fragment were as follows: an initial denaturation at 95°C for 10 min, followed by 35 cycles of 95°C for 30 s, 66°C for 30 s, and 72°C for 3 min, with a final extension at 72°C for 10 min. The amplification conditions of the latter fragment were as follows: an initial denaturation at 95°C for 10 min, followed by 35 cycles of 95°C for 30 s, 66°C for 30 s, and 72°C for 1 min, with a final extension at 72°C for 10 min. The DNA fragments were separated on a 0.8% agarose gel and purified. Subsequently, the two fragments were combined by PCR to form one 3,171-bp fragment using the sdhB-DF and sdhB-DR primers and the two purified fragments as templates. The amplification was initiated with a 10-min denaturation at 95°C, followed by 35 cycles of 95°C for 30 s, 66°C for 30 s, and 72°C for 4 min. The PCR product was subcloned into the pMD18-T vector, designated pMD18TCBX, and sequenced to confirm the base substitution.

Vector construction.

T-DNA binary vectors were constructed on the backbone of pCAMBIA1301 (Cambia, Canberra, Australia). The mutated sdhB cassette was amplified from plasmid pMD18TCBX using the primers sdhB-DF and sdhB-DR (Table 1) and Pfu DNA polymerase (Fermentas). Binary plasmid vector pJW (Fig. 1) was made by digesting pBAMBIA1301 with both PmlI and XhoI to remove the hygromycin B phosphotransferase gene (hph) and the β-glucuronidase gene (gus) and inserting the mutated sdhB cassette by blunt end ligation. Another binary vector pJW-tHMGR (Fig. 1) was constructed as follows. The promoter sequence (1,210 bp) for the gpd of G. lucidum (48) was obtained by PCR amplification using the primers gpd-F and gpd-SOE-R (Table 1) with genome DNA as a template. The catalytic domain of the HMGR gene (1,908 bp) of G. lucidum (32) was amplified from genome DNA using the primers hmgr-SOE-F and hmgr-R (Table 1). DNA fragments were separated on a 0.8% agarose gel and purified. Subsequently, the two fragments were combined by PCR to form one 3,109-bp fragment (Pgpd-tHMGR) using the gpd-F and hmgr-R primers and the two purified fragments as templates. Intermediate plasmid pBAR-PGPD-tHMGR was generated by digesting pBARGPE1 (University of Kansas Medical Center, Kansas City, KS) with XhoI and inserting the Pgpd-tHMGR fragment after filling the sticky end. Finally, plasmid pJW-tHMGR was constructed by excising the PGPD-tHMGR-trpC terminator fragment from plasmid pBAR-PGPD-tHMGR using EcoRV and NotI and inserting this fragment by blunt end ligation at the AseI site in plasmid pJW.

Fig 1.

Structure of plasmids used for G. lucidum transformation. See Materials and Methods for descriptions of the construction of these plasmids.

Agrobacterium-mediated fungal transformation.

The transformation protocol was a modification of the method developed by de Groot et al. (5). Protoplasts of G. lucidum were prepared as described by Sun et al. (38). A. tumefaciens strain EHA105, containing the binary vector pJW or pJW-tHMGR, was grown at 28°C for 2 days in MM supplemented with kanamycin (50 μg/ml) and rifampin (50 μg/ml). The A. tumefaciens cells were diluted to an optical density at 600 nm (OD₆₀₀) of 0.15 in IM in the presence or absence of 200 μM acetosyringone. After preincubation for 6 to 8 h at 28°C on a rotary shaker (220 rpm) to an OD₆₀₀ of 0.6 to 0.8, 200 μl of the bacterial cell suspension was mixed with an equal volume of a protoplast suspension (10⁷/ml) from G. lucidum and then spread onto nitrocellulose membranes. The membranes were placed on a cocultivation medium (same as IM except containing 1% low-melting-point agar) and incubated at 25°C for 3 days. After cocultivation, the membranes were transferred to select medium (CYM medium) containing 2 μg of carboxin (Sigma, St. Louis, MO)/ml as a selection agent for transformants and carbenicillin (400 μg/ml) to kill the A. tumefaciens cells. After 10 to 14 days of incubation at 30°C, hyphae from visible fungal colonies were transferred to fresh CYM medium containing carboxin (2 μg/ml), which was repeated three times to obtain stable transformants. Control experiments were performed without acetosyringone. G. lucidum mycelia of transformants were scraped from surface culture and stained on a glass slide by using DAPI (4′,6′-diamidino-2-phenylindole; Sigma) at a concentration of 10 μg/ml in 0.1 M phosphate-buffered saline (pH 6.8) for 2 min. The mycelia were then washed and stained by calcofluor white (Sigma) at a concentration of 1 μg/ml in Tris-HCl buffer (pH 8.5) for 2 min. The morphology of mycelia was observed and photographed using an Olympus SP-51OUZ digital camera (Olympus, Japan).

Insertion analysis for the genomic DNA of transformants.

For PCR analysis, the 0.49 bp of the mutant sdhB fragments were amplified by using the primers cbx-F and cbx-R (Table 1). The amplification products were cloned into pMD18-T vector and sequenced. The fusion fragment of gpd promoter and the tHMGR gene was detected by using the primers gpd-F2 and hmgr-R2 (Table 1).

For genomic Southern blot analysis, 10 μg of DNA samples from transformed and nontransformed strains was digested with BamHI and separated on 0.8% agarose gel. The mutant sdhB fragment (0.49 kb) amplified from plasmid pJW with the primers cbx-F and cbx-R was used as the probe. DNA probe labeling and hybridization were performed under conditions recommended for the digoxigenin (DIG) hybridization system by Roche (Mannheim, Germany).

Analyses of dry cell weight and ganoderic acids.

Mycelia were harvested by centrifuging a sample at 10,000 × g for 10 min, and the precipitated cells were washed for three times with distilled water and then dried at 50°C to constant weight. The dry cell weight was measured by the gravimetric method. Ganoderic acids were extracted and measured according to a method described elsewhere (40).

Extraction and analysis of squalene and lanosterol.

Cellular squalene and lanosterol were extracted according to the methods of Yue et al. (51) and Mantzouridou et al. (21), with some modifications. Dried mycelia (50 mg) were saponified by 2 ml of 10% (wt/vol) KOH–75% (vol/vol) ethanol solution at 50°C for 2 h. The mixture was extracted with 2 ml of hexane for three times. The hexane layer was collected and evaporated to dryness under N₂. The residue was dissolved in 0.5 ml of acetonitrile for subsequent high-pressure liquid chromatography (HPLC) analysis. Agilent 1200 series HPLC apparatus equipped with an Agilent G1315B diode array detector and an Agilent Zorbax SB-C18 column (250 by 4.6 mm, 5 μm) were used. The separation of squalene and lanosterol was achieved by using a mobile phase of 100% acetonitrile at a constant flow rate of 1.5 ml/min and a mobile phase of 100% methanol at a constant flow rate of 1.0 ml/min, respectively. The squalene and lanosterol were monitored at wavelengths of 195 and 210 nm, respectively. The peaks of squalene and lanosterol were identified based on their retention time and UV spectra against those obtained from squalene and lanosterol standards (Sigma), respectively. The quantification was performed according to the external calibration graphs obtained from the peak areas versus different concentrations of squalene and lanosterol standards, respectively.

Measurement of hmgr, fps, sqs, and ls gene expressions by qRT-PCR.

The transcription levels of the hmgr, fps, sqs, and ls genes (which encode the enzymes HMGR, FPS, SQS, and LS, respectively) were analyzed by real-time quantitative RT-PCR (qRT-PCR). The sequences of the primers for the amplification of the 18S rRNA gene, fps, sqs, and ls were described previously (49, 52). For hmgr, the primers thmgr-F and thmgr-R (Table 1) were used. The 18S rRNA gene was used as the internal control gene because its expression was found to be stable under our experimental conditions. The expression level of the different genes was normalized with respect to the 18S rRNA expression level. For each gene, an expression level of 1 was assigned to the samples from the wild-type (WT) strain, and the expression levels in the control transgenic strain and the pJW-HMGR-transformed strain are presented as the fold changes relative to this reference level.

Statistical analysis.

Data are the averages of three independent sample measurements. The error bars indicate the standard deviations from the means of triplicates. The data were analyzed with the Student t test. The difference between contrasting treatments was considered significant when P was <0.05 in a two-tailed analysis.

Nucleotide sequence accession number.

The GenBank accession number of the G. lucidum gene sdhB examined in the present study, including its promoter and terminator, was JN377411.

RESULTS

Establishment of a homologous transformation system for G. lucidum with the selection marker cbx^r conferred by sdhB mutation.

Mutation of sdhB confers dominant resistance to carboxin in basidiomycetes (10, 12, 15). Thus, sdhB (including the promoter and terminator) from the genome of G. lucidum was amplified. The genomic sequence was submitted in the DDBJ/EMBL/GenBank nucleotide sequence databases under accession no. JN377411. The sdhB gene was mutagenized, as described in Materials and Methods, to obtain a variant expected to mediate carboxin resistance upon transformation into G. lucidum. Fungal colonies appeared on the selection medium containing 2 μg of carboxin/ml after the transformation of G. lucidum protoplasts with plasmid pJW via ATMT. No resistant colonies were observed when the acetosyringone was omitted. The transformation frequency was 10 transformants to 15 transformants per 10⁷ protoplasts. Ten transformants were repeatedly transferred to a nonselective medium to investigate the mitotic stability of the integrated T-DNA. Clones were transferred to selective CYM medium after five rounds of growth on a nonselective medium (without carboxin). All tested transformants continued to grow on the selective medium. Moreover, the transformants exhibited 100% mitotic stability for the cbx^r selection marker.

PCR amplification and Southern blotting were performed on genomic DNA from the wild-type (WT) strain and randomly selected transformants to confirm the presence of cbx^r in the carboxin-resistant colonies. The expected product size of 0.49 kb was amplified from the genomic DNA of the WT strain and all transformants using the cbx-F and cbx-R primers (data not shown). Sequencing analysis revealed that the transformants carried the cbx^r (Fig. 2). The presence of transgenic cbx^r in the genome of the transformants was further tested by molecular hybridization. DNA from the transformants, and the WT strain was digested with BamHI and probed with a cbx^r fragment (Fig. 3). The analysis confirmed that cbx^r was integrated into the genome of the analyzed G. lucidum transformants.

Fig 2.

Detection of the introduced cbx^r gene in transformants. PCR products amplified from genomic DNA of transformants or the wild-type strain were directly sequenced. Sequencing chromatograms are shown for mutation site of the sdhB in the wild type and in the carboxin-resistant transformants. Any two overlapping peaks indicate the nucleotide from the endogenous sdhB and the transformed cbx^r. Arrowheads indicate the mutated nucleotides.

Fig 3.

Detection of wild-type and transgenic mutant copies of sdhB in three randomly selected G. lucidum transformants. (Top) Schematic representation of the restriction enzyme-probe combination used to detect the transgenic mutated allele of sdhB. White boxes are the left and right border regions of T-DNA, respectively. The large gray arrow represents the carboxin resistance cassette cbx^r. An asterisk (*) indicates the position of single nucleotide mutation responsible for carboxin resistance in sdhB. The position of the single BamHI site within the T-DNA is indicated by a black arrow. (Bottom) Random integration of T-DNA copies into the G. lucidum genome. WT, G. lucidum wild-type strain; TR-1 to TR-3, independent transformants obtained after ATMT using plasmid pJW. The genomic copy of the sdhB is indicated by arrow on the right.

Deregulated overexpression of an N-terminally truncated HMGR gene in G. lucidum.

The plasmid pJW-tHMGR, encoding a truncated G. lucidum HMGR that lacks the N-terminal membrane-binding domain of the enzyme, was used to transform the WT strain using the established transformation system. The truncated HMGR (tHMGR) gene was controlled by the strong constitutive gpd promoter of G. lucidum and the trpC terminator of Aspergillus nidulans in the plasmid pJW-tHMGR (Fig. 1). Resistance to carboxin was used to select putative transformants. The integration of the catalytic domain of the HMGR gene in the carboxin-resistant strains was confirmed by PCR. The PCR product showed a clear band for the fusion gpd promoter and the tHMGR gene fragment (938 bp) in the HMGR transformant (pJW-HMGR-transformed strain), but no corresponding band was observed in the WT strain and the control transgenic (TR) strain (Fig. 4). In addition, no morphological difference was observed between the HMGR transformant and the control. Total RNA was isolated from different strains. qRT-PCR analysis was conducted to compare HMGR gene expression levels in the transformant and WT. The results showed that HMGR gene was overexpressed in the HMGR transformant, which was ∼3-fold higher than the control on day 4 (see Fig. 6).

Fig 4.

Identification and characterization of the tHMGR gene-overexpressing strains. Amplification patterns were obtained with primers for the fusion gpd promoter-tHMGR gene fragment in genomic DNA isolated from different strains. Lane N, negative control; lane WT, wide-type strain; lane TR, the strain transformed with pJW; lane H, the tHMGR overexpressed strain; lane P, pJW-tHMGR as a positive control; lane M, DL 2000 DNA marker.

Fig 6.

Transcriptional levels of biosynthetic genes in the WT strain (□), the strain transformed with pJW (▨), and the tHMGR overexpressed strain (■). Expression of the samples from the WT strain is defined as 1.0, and the expression levels in TR and HMGR strains are displayed as the fold increase over the reference sample. *, statistical significance (P < 0.05) compared to the WT strain. d, days.

Enhanced ganoderic acid biosynthesis in G. lucidum overexpressing the tHMGR gene.

The maximal biomass and contents of GA and intermediates (squalene and lanosterol) were assayed in the WT and TR strains and in three strains of tHMGR-overexpressing transformants. The maximal biomass and GA content of all strains were reached on day 12, and the maximal intermediates were obtained on day 4. The results, summarized in Table 2, confirm the consistency in HMGR overexpression. From the information obtained in Table 2, one overexpressing transformant (H3) was chosen with WT and TR strains to study the kinetic profiles of cell growth, ganoderic acid content, and intermediate (squalene and lanosterol) accumulation. Figure 5A shows that the overexpression of the tHMGR gene slightly affected cell growth compared to WT and TR strains. The maximum dry cell weights in the WT, TR, and HMGR strains were 8.73, 8.10, and 7.33 g/liter, respectively. The ganoderic acid content of the WT and TR strains did not change substantially during the entire fermentation, whereas the HMGR strain content significantly increased and reached a maximal value at the end of fermentation. The maximum content in the HMGR strain was 29.4 mg/g (dry weight), which was ∼2-fold of that obtained in the WT strain (14.1 mg/g [dry weight]) (Fig. 5B). Squalene and lanosterol are important intermediates in the ganoderic acid biosynthetic pathway. Thus, their accumulations in WT, TR, and HMGR strains were analyzed. The results showed that more squalene and lanosterol accumulated in the HMGR strain than in control strains throughout the cultivation (Fig. 5C and D). The overexpression of the tHMGR gene increased squalene content (86.6 μg/g [dry weight] versus 12.8 μg/g [dry weight] relative to the WT strain) at day 0. Although the content of squalene decreased to 26.4 μg/g (dry weight) in the HMGR strain at day 16, it still maintained a higher level than that of the WT (6.16 μg/g [dry weight]). The amount of lanosterol increased to a maximum of 2.97 mg/g (dry weight) at day 4 but dropped to 1.21 mg/g (dry weight) at the end of fermentation in the HMGR strain. The lanosterol content of the HMGR strain was 3.8- and 1.7-fold higher than that of the WT strain on days 4 and 16, respectively. The levels of HMGR, FPS, SQS, and LS mRNAs were also analyzed in different strains by qRT-PCR. Figure 6 shows that no significant differences existed in the gene expression between the WT and TR strains. The overexpression of the tHMGR gene caused the obvious accumulation of HMGR mRNA throughout the cultivation period. The transcription level of hmgr on day 12 in the HMGR strain was ∼10-fold higher than that of the WT strain. Some downstream genes in the isoprenoid biosynthetic pathway (fps, sqs, and ls) were also transcriptionally activated by the overexpression of tHMGR gene in the fermentation process. The highest transcription level of fps in the HMGR strain was 6.8-fold higher than that of the control on day 16. The highest change in the transcription profile for sqs was observed on day 12 when it was upregulated by 6.8-fold in the HMGR strain. The expression level of ls also increased by 9.1-fold on day 16 in the HMGR strain.

Table 2.

Maximum content of ganoderic acids, squalene, and lanosterol in different cell lines

Cell line	Mean value ± SDa
	Biomass (g/liter)	GA content (mg/g DW)	Squalene content (μg/g DW)	Lanosterol content (mg/g DW)
WT	9.18 ± 0.29	14.13 ± 0.71	15.24 ± 0.83	1.96 ± 0.22
TR	8.80 ± 0.35	14.21 ± 1.58	9.82 ± 1.11*	2.64 ± 0.43
H1	7.31 ± 0.24*	30.39 ± 1.98*	46.77 ± 4.08*	6.80 ± 0.14*
H2	7.31 ± 0.14*	27.22 ± 1.03*	46.00 ± 4.30*	5.39 ± 0.26*
H3	7.72 ± 0.18*	30.69 ± 1.27*	47.88 ± 5.35*	6.01 ± 0.41*

^aThe maximal contents for ganoderic acids (GA), lanosterol, and squalene were reached on days 12, 4, and 4, respectively. g DW, gram dry weight. *, significantly different from value for wild type (P < 0.05).

Fig 5.

Kinetic profiles of cell growth (A), content of ganoderic acids (B), and accumulation of squalene (C) and lanosterol (D) in the wild-type strain (○), the strain transformed with pJW (□), and the tHMGR overexpressed strain (△). The error bars indicate the standard deviations from three independent samples. *, statistical significance (P < 0.05) compared to the WT strain. d, days.

DISCUSSION

Structural genes such as hmgr, fps, sqs, and ls involved in ganoderic acid biosynthesis have been cloned from the basidiomycete G. lucidum (33). However, no report on the enhancement of ganoderic acid content by genetic engineering is available. In the present study, a homologous transformation system for G. lucidum was developed using a modified sdhB as a dominant selectable marker. This system was used to increase ganoderic acid accumulation through overexpression of G. lucidum tHMGR gene, which encodes the catalytic domain of HMGR.

Traditionally, obtaining stable transformants of basidiomycetes is more difficult compared to the process for obtaining transformants in filamentous ascomycetes, partially due to the inefficient expression of heterologous (prokaryotic) selection marker genes in some basidiomyctes (47). We initially attempted to transform the protoplasts of G. lucidum with plasmids pLG-hph (containing hygromycin resistance gene) (9) and pBARGPE1 (containing the bialaphos resistance gene) by electroporation and restriction enzyme-mediated integration (REMI) methods (16, 38). However, no stable transformants were obtained. The background growth was observed even at high concentrations of hygromycin (200 mg/liter). A. tumefaciens-mediated transformation of G. lucidum protoplasts with plasmid pCAMBIA1301 also failed to achieve hygromycin resistance transformants (data not shown), possibly because the constructs containing the heterologous gene may not be functional in G. lucidum. Previous studies reported that the hygromycin resistance gene and phleomycin resistance gene cannot work in the basidiomycetes Schizophyllum commune and Clitopilus passeckerianus unless the appropriate N terminus and appropriate introns were present within the coding sequences (14, 30). In the present study, a homologous selection marker gene cbx^r was developed and used to transform basidiomycete by ATMT to establish a stable transformation system for G. lucidum. Transformation with plasmid pJW resulted in dominant resistance to carboxin. Southern blot analysis revealed that the cbx^r cassette was stably integrated in the genome of the transformants. This success may be due to the fact that the homologous selection marker used for the G. lucidum transformation contains introns and is suitable for expression. Our results indicated that cbx^r can be used as a dominant selective marker for the transformation of G. lucidum. The success of carboxin resistance selection indicates that it is a useful selection system based on host-derived gene rather than heterologous expression. The transformation efficiency obtained is comparable to that obtained using electroporation and REMI methods (16, 38). The mycelia were transformed in the present study via ATMT; however, no stable transformants were obtained, possibly due to the mycelial cell wall (29). Monokaryons were probably obtained from dikaryotic mycelia by protoplasting because the nuclei were separated and no clamp connections were observed in some mycelia of the transformants (data not shown). A similar case was reported in the mushroom Lyophyllum shimeji (20). Therefore, the transformation system described here is a practical method for the genetic improvement of this well-known traditional medicinal mushroom.

The expression of heterologous genes and cDNAs in basidiomycetes is hindered by several factors. In the S. commune model, the hygromycin B resistance gene is inactivated by methylation (23), AT-rich sequences hamper the expression of the bacterial Geneticin resistance gene and the hygromycin B resistance gene (30, 31), and introns are required for the efficient mRNA accumulation of the Agaricus bisporus hydrophobin gene ABH1 and the hygromycin B resistance gene (19, 30). Therefore, the tHMGR gene from the genome that contained introns was used to overexpress in G. lucidum, thereby avoiding the above-mentioned problems. The deregulated overexpression of tHMGR gene led to enhanced ganoderic acid accumulation, which was 2-fold higher than that of the control, suggesting that HMGR is a key enzyme for ganoderic acid biosynthesis in G. lucidum. Our study is the first report on the enhanced accumulation of triterpene via the overexpression of biosynthetic gene(s) in basidiomycetous mushroom. This report is similar to other examples in Saccharomyces cerevisiae (2, 28), Candida utilis, and Neurospora crassa (36, 43). Comparison of intermediate contents in different strains of G. lucidum revealed that more squalene (6.7-fold) and lanosterol (3.8-fold) accumulated in the tHMGR gene-overexpressing strain than in the WT. The results suggest that increased ganoderic acid accumulation may be due to the increased supply of precursors. Similar observations were also reported for S. cerevisiae, in which the overexpression of tHMGR gene also resulted in more accumulation of squalene and lanosterol (6, 21, 25). Constitutive expression of HMGR gene in tobacco led to a >100-fold increase in the level of cycloartenol, the analogue of lanosterol in fungi (3). The deregulated overexpression of tHMGR gene in G. lucidum also increased the transcription levels of the downstream genes in the MVA pathway, such as fps, sqs, and ls, indicating that downstream genes in the MVA pathway are transcriptionally activated by the overexpression of tHMGR gene. This result is similar to that previously described in Arabidopsis and Panax ginseng, in which the overexpression of HMG-CoA synthase and SQS genes resulted in an upregulation of the downstream genes in sterol and triterpene biosynthesis, respectively (17, 44). Therefore, changes in the production of MVA-derived precursors may stimulate the transcription of downstream genes involved in triterpene biosynthesis (17).

The time courses of ganoderic acid accumulation showed that the level of ganoderic acid started to increase sharply on day 8 in the HMGR strain. This result is consistent with the increased expressions of fps, sqs, and ls starting on day 8, suggesting that the enhanced ganoderic acid content in the transgenic strain may be related to increased transcription of biosynthetic genes. This observation was in accordance with previous reports that the increased production of ganoderic acids accompanied the upregulated expression of hmgr, fps, sqs, and ls (18, 26, 49).

In conclusion, we demonstrated here that the mutant G. lucidum sdhB is an excellent selection marker for the successful gene manipulation of this important medicinal mushroom, which is well known for its transformation resistance. Moreover, the overexpression of tHMGR gene leads to the upregulation of an existing MVA pathway and increased accumulation of antitumor ganoderic acid in G. lucidum. The homologous transformation system described here constitutes a useful tool for its molecular breeding. In addition, the engineered strain developed here represents a suitable platform for the further development of an industrial process for the hyperproduction of the antitumor secondary metabolite. Moreover, the related information is helpful for the genetic improvement and metabolic engineering of other mushrooms, which are an important source of biopharmaceuticals and functional foods (53, 54).