Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2012 Nov;50(11):3478–3484. doi: 10.1128/JCM.01311-12

A PCR-Based Intergenic Spacer Region-Capillary Gel Electrophoresis Typing Method for Identification and Subtyping of Nocardia Species

M C Wehrhahn a,*,✉, M Xiao b,c, F Kong a, Y-C Xu b,c, SC-A Chen a
PMCID: PMC3486202  PMID: 22875897

Abstract

While 16S rRNA sequence-based identification of Nocardia species has become the gold standard, it is not without its limitations. We evaluated a novel approach encompassing the amplification of the Nocardia 16S-23S rRNA intergenic spacer (IGS) region followed by fragment analysis by capillary gel electrophoresis (CGE) of the amplified product for species identification of Nocardia. One hundred forty-five Nocardia isolates (19 species) and four non-Nocardia aerobic actinomycetes were studied. Reproducibility testing was performed in a subset (21%) of isolates. Ninety-five different electropherograms were identified, with heterogeneity within species being a general observation. Among common Nocardia species (e.g., Nocardia cyriacigeorgica, N. nova, N. farcinica), 2 or 3 dominant electropherogram subgroups were typical. While only a minority (8/19; 42%) of the different Nocardia species contained isolates displaying unique fragment sizes that were predictive of a particular species, virtually all isolates (142/145; 98%) could be assigned to the correct species using IGS-CGE typing based on the number and size of amplified fragments. The median number of fragments for each isolate was 2 (range, 1 to 5) with only a minority (17%) having a single fragment detected. The majority (93%) of amplified fragments were between 408 and 461 bp. The technique was also non-operator dependent, highly reproducible, and quicker and less expensive than 16S sequencing. In summary, PCR-based IGS-CGE typing is relatively simple, accurate, reproducible, and cost-effective and offers a potential alternative to 16S rRNA sequencing for identifying and subtyping Nocardia isolates.

INTRODUCTION

Nocardia species are ubiquitous environmental branching Gram-positive bacilli that cause a wide variety of clinical syndromes ranging from localized cutaneous infection to systemic infection, with a recognized predilection for central nervous system involvement (1, 13). Although immunocompromised patients are at particular risk, immunocompetent hosts are also affected (1). More than 80 species of Nocardia have been described, with at least 30 documented to cause human infection (9). Species identification is important to determine clinical associations and for epidemiological studies.

Historically, species distinction has relied on phenotypic and biochemical identification methods and distinct antimicrobial susceptibility profiles (1, 17). However, these approaches are time-consuming and are inadequately discriminatory for resolving many species (1, 4). DNA sequencing of the 16S rRNA gene has been the gold standard for species identification of the nocardiae (1) but is expensive and not easily adaptable to the clinical laboratory. Furthermore, a substantial number of 16S rRNA gene sequences deposited in the GenBank database (www.ncbi.nlm.nih.gov/GenBank/) represent misidentified isolates or contain errors (7). This may in part be due to horizontal transfer of genetic material that may include multiple different copies of the 16S rRNA gene in several Nocardia species (2, 3).

The recent development of multilocus sequence analysis (MLSA) for Nocardia was an attempt to resolve this problem, but this procedure is also costly (11). While proteomic approaches such as matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) may provide species identification of Nocardia (16), this method is also dependent on the availability of validated reference spectra within the reference database.

To bypass these problems, we developed and explored the use of a novel approach encompassing the amplification of the Nocardia 16S-23S rRNA intergenic spacer (IGS) region followed by fragment analysis by sequencer-based capillary gel electrophoresis (CGE) of the amplified product as an alternative to 16S rRNA sequencing for species identification of Nocardia. Unlike traditional gel electrophoresis, CGE uses 5′-end fluorescein-labeled primers and a DNA analyzer, with resultant rapid and accurate resolution of amplicons. Although this technique has not been applied in the identification of the nocardiae, it has shown good discriminatory power in comparison with other genotyping methods based on conventional gel electrophoresis in the identification and subtyping of other bacteria, including Clostridium difficile in conjunction with 16S-23S rRNA IGS region amplification (6, 20), Vibrio species (IGS region amplification) (5), and group B Streptococcus and Staphylococcus aureus in conjunction with multilocus variable-repeat assay (MLVA) (12, 15).

In the present study, with fragment analysis via CGE viewed as a fast, simple, and accurate method that permits interlaboratory comparison, we hypothesized that this technique may play a role in improving the identification and subtyping of Nocardia isolates. We compared the results obtained with those of partial 5′end (606-bp) 16S rRNA gene sequencing.

MATERIALS AND METHODS

Nocardia isolates.

DNA extracts of 145 Nocardia isolates, previously characterized by standard phenotypic methods (1) and identified to the species level by 16S rRNA gene sequencing (7, 8, 18, 19), were studied (Table 1). Extracts were retrieved from −80°C storage. Routine protocols in our laboratory have indicated minimal degradation of nocardial DNA with storage under these conditions and maintenance of good-quality DNA (results not shown).

Table 1.

Nocardia isolates and related aerobic actinomycetes studied by IGS-CGE

Organism Total no. of strains (no./designation of reference strain[s]) studied
Nocardia species
    N. abscessus 4 (1/ATCC BAA-279T)
    N. aobensis 1
    N. asteroides 1 (1/ATCC 19247T)
    N. beijingensis 1
    N. blacklockiae 1
    N. brasiliensis 11 (1/ATCC 19296T)
    N. brevicatena 2 (1/ATCC 15333T)
    N. carnea 1 (1/ATCC 6847T)
    N. cyriacigeorgica 35
    N. elegans 1
    N. farcinica 22 (2/ATCC 3308, ATCC 3318T)
    N. nova 34 (1/ATCC 33726T)
    N. otitidiscaviarum 5 (1/ATCC 14629T)
    N. paucivorans 11 (1/ATCC BAA-278T)
    N. rhamnosiphila 1
    N. thailandica 1
    N. transvalensis 2 (1/ATCC 6865T)
    N. veterana 10 (1/ATCC BAA-509)
    N. vinacea 1
Other aerobic actinomycetes
    Dietzia maris 1 (1/ATCC 35013T)
    Gordonia bronchialis 1 (1/ATCC 25592T)
    Rhodococcus equi 1 (1/ATCC 6939)
    Tsukamurella paurometabola 1 (1/ATCC 8368T)

Amplification of the intergenic spacer region.

The nocardial IGS region was amplified using a 16S-USA forward primer, 5′ GTGCGGCTGGATCACCTCCT 3′, and 23Sr-A3 reverse primer, 5′ GACAGCTCCCCGAGGCTTATCGCA 3′ (Sigma-Aldrich, Castle Hill, NSW, Australia). PCR was performed in a total volume of 25 μl as follows: each reaction mixture contained 2 μl template DNA, 0.1 μl of forward and reverse primers (50 pmol/μl), 1 μl deoxynucleoside triphosphates (dNTPs) (2.5 mM each dNTP), 0.5 μl magnesium, 2.5 μl 10× PCR buffer (Qiagen, Doncaster, Victoria, Australia), 0.1 μl Qiagen HotStar Taq polymerase (5 U/μl), and 25 μl molecular biology grade H2O (Eppendorf, North Ryde, NSW, Australia). The PCR was performed according to the Qiagen HotStar Taq polymerase kit instructions: 95°C for 10 min, 30 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min, followed by a final extension at 72°C for 10 min.

Sequencer-based capillary gel electrophoresis.

PCR fragment analysis was performed using the ABI 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA) employing a 48-capillary 50-cm POP-7 gel (a separation matrix polymer customized for DNA sequencing and fragment analysis). Amplified PCR products were diluted 1:30 with molecular biology grade H2O (Eppendorf) to a final volume of 30 μl before loading onto the gel. Sample injection was at 1.6 kV over 15 s with a total running time of 6,200 s at 15-kV run voltage. A 30- to 1,200-bp LIZ 1200 ladder (Chimerx, Madison, WI) was used as an internal marker for each sample. The size of each peak was determined using GeneMapper 4.0 software (Applied Biosystems).

Data analysis.

Amplified fragments, represented as one or more peaks according to fragment size (Fig. 1) on the CGE analysis, were observed for all isolates, with occasional double peaks seen at a single location. Heights of peaks as determined by the GeneMapper software had to attain at least 10% of the height of the largest peak for a given isolate (6). If double peaks were noted, both peaks were counted if the fragment sizes showed a ≥1.0-bp difference in addition to meeting the 10% height rule. If the two peaks were <1.0 bp apart, only the largest of the two peaks was counted. Fragment sizes that were found in at least 20% of isolates belonging to a particular species were defined as “common,” and those that were seen only within a particular species were defined as “unique.” Isolates within a particular species that contained the same fragment(s) were considered to belong to the same subtype, while those that shared at least one common fragment size (if more than one fragment size was detected) were defined as belonging to the same subgroup.

Fig 1.

Fig 1

Representative IGS-CGE patterns for common Nocardia species, showing size of each peak (in bp).

In the present study, the pattern of peaks was noted in addition to the number and numeric values for the fragments with sizes rounded up or down to the nearest whole number. The number of fragments/peaks, their length(s), and their general pattern as represented by the GeneMapper software, including whether smaller peaks (<10% of the highest peak) were present, were studied to determine the correlation of species identification by CGE pattern (electropherogram) with that of 16S rRNA gene sequencing (7, 19). Isolates of one species matching those of another species based on the above-described criteria were analyzed further to determine if they could be separated based on the exact value to two decimal places of their fragments and pattern as depicted by the GeneMapper software, with a difference of ≥0.5 bp considered significant based on the results of subsequent reproducibility testing.

Reproducibility and specificity.

A proportion of the above-described DNA extracts (30/145, 21%) were also tested by two independent operators (M.C.W. and M.X.) to test interoperator reproducibility. In addition, DNA extracts from reference strains of four closely related aerobic actinomycetes (Rhodococcus equi ATCC 6939, Tsukamurella paurometabola ATCC 8368, Dietzia maris ATCC 35013, and Gordonia bronchialis ATCC 25592) were analyzed to test the specificity of the IGS-CGE approach. These isolates were chosen because they may be mistaken for Nocardia, as they have similar Gram stain characteristics and typically give a weakly positive result using a modified acid-fast stain (10).

RESULTS

A total of 145 Nocardia isolates representing 19 species were studied comprising 12 reference strains from the American Type Culture Collection (ATCC, Manassas, VA) and 133 clinical isolates (Table 1). For nine species, only a single isolate was available for study (Table 1).

PCR amplification of the IGS region and CGE analysis.

Amplification with the primers 16S-USA and 23Sr-A3 yielded a PCR product in all instances, confirming the adequate quality of the stored DNA.

CGE analysis of the 12 reference strains revealed unique electropherograms and established the premise of evaluating clinical strains. In total, CGE analysis revealed 95 different electropherograms for the 145 different isolates. Table 2 summarizes the fragment profiles, listing the numbers of different combinations of fragments, typical number of fragments for each species (and range), and the common and unique fragment sizes for each species. Figure 1 depicts examples of electropherograms for common subtypes of the respective Nocardia species, while Fig. 2 gives a representation of N. cyriacigeorgica isolates belonging to the same subtype (411 bp + 438 bp).

Table 2.

IGS-CGE fragment size profiles for Nocardia and related species

Species IDa by 16S rRNA sequencing (no. of strains studied) No. of subtypes Avg no. of fragments per isolate (range) Common (≥20% of isolates) fragment sizes in bp (n) Unique fragment sizes (bp)
Nocardia species
    N. abscessus (4) 2 1 432 (2), 450 (2)
    N. aobensis (1) 2 431, 433
    N. asteroides (1) 3 430, 434, 440
    N. beijingensis (1) 2 439, 446
    N. blacklockiae (1) 3 419, 432, 436
    N. brasiliensis (11) 10 3 (1–3) 439 (3), 451 (4) 510
    N. brevicatena (2) 2 (1–2) 441 (1), 445 (1), 461 (1) 461
    N. carnea (1) 1 433
    N. cyriacigeorgica (35) 19 2 (1–5) 411 (8), 438 (15), 442 (8) 428, 442
    N. elegans (1) 4 430, 434, 435, 439
    N. farcinica (22) 13 2 (1–4) 439 (6), 443 (8) 417, 424, 456, 457, 520
    N. nova (34) 18 2 (1–3) 436 (15), 438 (14)
    N. otitidiscaviarum (5) 5 2 (2–3) 408 (2), 423 (2), 429 (2) 408, 427
    N. paucivorans (11) 7 1 (1–2) 437 (3), 452 (5) 532
    N. rhamnosiphila (1) 2 432, 447 447
    N. thailandica (1) 2 430, 434
    N. transvalensis (2) 2 2 435, 438, 439, 440
    N. veterana (10) 8 2 (1–4) 434 (4), 436 (8)
    N. vinacea (1) 2 437, 453
Other aerobic actinomycetes
    Dietzia maris (1) 1 453
    Gordonia bronchialis (1) 4 412, 429, 431, 533 412, 533
    Rhodococcus equi (1) 3 436, 443, 445
    Tsukamurella paurometabola (1) 2 512, 519 512, 519
a

ID, identification.

Fig 2.

Fig 2

Electropherograms for N. cyriacigeorgica subtype, 411 bp + 438 bp.

The number of subtypes varied with the species (Table 2). While the largest numbers of subtypes were observed for N. cyriacigeorgica (n = 19) and N. nova (n = 18) followed by N. farcinica (n = 13) and N. brasiliensis (n = 10), heterogeneity was most apparent within N. brasiliensis (10 different subtypes among 11 isolates) and N. veterana (8 different subtypes among 10 isolates) among those species for which at least 10 strains were studied (Table 2). Of note, there were five distinct CGE types among five N. otitidiscaviarum strains (Table 2). For all species of which more than one isolate was studied, more than one subtype was observed. The median number of fragments per isolate was 2 (range, 1 to 5) with only a minority (24/145, 17%) yielding a single fragment size. Of the more common isolates, all N. abscessus isolates were found to have just a single fragment size, while the majority of isolates belonging to the other species generally had just two fragment sizes. In the majority of isolates, fragment sizes were within the range of 408 to 461 bp with only 10/145 (7%) containing fragments larger than this (range, 496 to 724 bp). Unique fragment sizes were observed in 24/145 (17%) of Nocardia isolates, belonging to 8/19 (42%) of Nocardia species. The number of unique fragment sizes was greatest for N. farcinica, which as a species contained 6/22 (27%) isolates containing one or more unique fragment sizes (Table 2).

Further analysis of the different subtypes within a particular species generally lent itself to classification by subgroup with an average of 2 or 3 dominant subgroups (data not shown). For example, among 22 N. farcinica isolates, three dominant subgroups were seen: subgroup A, containing eight isolates carrying either a 417- or 419-bp (A1) or a 444-bp (A2) fragment; subgroup B, containing five isolates with a 439-bp fragment; and subgroup C, containing five isolates with either a 430-bp (C1) or a 443-bp (C2) fragment. Three of the four remaining isolates spanned the three dominant subgroups (two isolates with 417- and 443-bp fragments and one isolate with 439- and 444-bp fragments), while the last isolate appeared to be an outlier (containing a 424-bp fragment and a 457-bp fragment).

In contrast to the electropherograms of the different Nocardia species, uniquely different electropherograms were obtained for the non-Nocardia aerobic actinomycetes (Fig. 3).

Fig 3.

Fig 3

Electropherograms for three non-Nocardia aerobic actinomycetes, showing size of each peak (in bp).

Reproducibility testing.

A total of 30/145 (21%) Nocardia isolates belonging to each of the major species, in particular those with multiple fragments, were retested by an independent operator. Results are shown in Table 3. Amplicons were detected in 29/30 (97%) isolates, with all displaying the same pattern on electropherograms but 2 differing by one peak compared with the initial tests (based on the 10% height rule). One isolate had one extra peak on the initial test (at 10.3% of the highest peak, which was likely too small to be detected on the repeat test). The other isolate had an extra peak on the repeat test (11% of the highest peak, so just meeting the 10% rule), which was present but not counted in the initial test (only 4% of the highest peak). The average difference in the most discrepant fragment size for a given isolate was 0.25 bp (overall range for individual isolates, 0.04 to 0.52 bp; average range for species, 0.18 bp [N. farcinica] to 0.31 bp [N. nova]). Overall, the most discrepant fragment differed in 66% of retested isolates by <0.3 bp, while 97% differed by <0.5 bp.

Table 3.

Comparison of fragment size results by IGS-CGE assay after independent repeat testing

Species (assigned strain number)a Fragment size(s) (bp) by first and second IGS-CGE testsb Maximum size difference in bp (avg for species)
N. abscessus (39) 431.71 0.08
431.63
N. abscessus (61) 449.97 0.37 (0.23)
449.6
N. brasiliensis (18) 496.59, 510.37, 722.81 0.40
496.75, 510.38, 723.41
N. brasiliensis (19) 496.68, 510.29, 723.06 0.07
496.61, 510.3, 723.05
N. brasiliensis (41) 437.76, 450.48 0.52
438.12, 450.8
N. brasiliensis (125) 434.59, 439.2 0.20 (0.30)
434.39, 439.01
N. brevicatena (75) 444.71, 461.36 0.36
444.36, 461
N. cyriacigeorgica (56) 410.47, 437.71 0.27
410.74, 437.91
N. cyriacigeorgica (57) 431.33, 441.36 0.32
431.65, 441.65
N. cyriacigeorgica (58)c 437.7, 442.7 0.34
437.92, 443.02
437.91, 443.04
N. cyriacigeorgica (153) 438.04, 443.17 0.13
437.99, 443.04
N. cyriacigeorgica (176) 438.21, 443.37 0.42
437.83, 442.95
N. cyriacigeorgica (187) 429.47, 431.59, 441.7 0.04
429.51, 431.59, 441.66
N. cyriacigeorgica (195) 429.62, 431.84, 439.82,d 441.89 0.26 (0.25)
429.49, 431.58, 441.66
N farcinica (1) 439.12, 445.39, 450.07, 456.38 0.13
439.11, 445.37, 450.11, 456.51
N. farcinica (4) 439.1, 445.37, 450.02, 456.42 0.26
439.36, 445.39, 450.07, 456.38
N. farcinica (43) 422.79, 437.2, 438.74 0.27
422.99, 437.47, 439.01
N. farcinica (204) 430.35, 443.45 0.07 (0.18)
430.28, 443.41
N. nova (24) 430.7, 437.77 0.25
430.95, 437.96
N. nova (71) 431.93, 433.33, 436.06 0.41
431.52, 432.95, 435.72
N. nova (164) 434.13, 435.62, 438.16 0.13
434.0, 435.64, 438.18
N. nova (252) 432.28, 435.97, 443.94 0.45 (0.31)
432.73, 436.41, 444.37
N. otitidiscaviarum (8) 407.83, 427.37, 428.7 0.28
408.11, 427.38, 428.82
N. otitidiscaviarum (20) 410.87, 422.89 0.14 (0.21)
410.73, 422.87
N. paucivorans (32) 532.3 0.18
532.12, 452.01e
N. paucivorans (121) 440.99, 452.46 0.16
440.83, 452.34
N. paucivorans (139) 437.51, 452.7 0.45 (0.26)
437.18, 452.25
N. veterana (182) 433.92, 436.39 0.28
433.64, 436.2
N. veterana (186) 428.93, 433.68, 436.32 0.09 (0.19)
428.94, 433.64, 436.23
a

Number of the strain assigned within that species in our culture collection.

b

Results from the second test are on the line below those from the first test for each organism.

c

The test for N. cyriacigeorgica (58) was repeated one more time because it was selected as the control for each of the two runs.

d

Note the presence of an extra fragment size of 439.82 bp (which was 10.3% of the highest peak) on initial testing that was not seen on repeat testing.

e

Note the presence of an additional fragment size of 452.01 bp (the additional peak was 11% of the highest peak in the second test but only 4% in the initial test).

Based on the combinations of fragment sizes (if more than one size was detected), species-specific patterns were generally observed. Only a tiny proportion (3/145; 2%) of tested strains were not able to be resolved, using the current methodology of fragment sizes being considered different if they showed a ≥0.5-bp difference. These three strains showed identical electropherograms depicting a single 436-bp fragment (two N. nova strains, 435.94 and 436.12 bp, and one N. veterana strain, 436.15 bp). Thus, 142 of 145 (98%) strains tested were able to be identified as a single species using PCR-based IGS-CGE typing.

Cost analysis and turnaround time.

Comparison costs for IGS-CGE and 16S rRNA gene sequencing are $3.50 per amplicon and ∼$12 per isolate (for sequencing of the 5′ 606-bp end), respectively. The entire process for CGE, which can analyze 96 isolates per run, takes 1 to 2 days, which is comparable to the time required for DNA sequencing.

DISCUSSION

Molecular identification of Nocardia spp. remains a challenge with the increasing recognition of novel species and taxonomic reassignment (1, 14, 19). The present study demonstrates the potential of combining a novel IGS-directed PCR with CGE to generate Nocardia species-specific CGE electropherograms to identify clinically relevant Nocardia isolates, including uncommon species. This is the first time that this approach has been applied to the characterization of the nocardiae.

The initial investigation and proof of concept were established by comparing the electropherograms of the 12 ATCC strains, which showed individual species-specific patterns. Furthermore, the nocardia electropherograms differed sufficiently from those of four phylogenetically related non-Nocardia aerobic actinomycete ATCC strains, indicating specificity for this technique.

Subsequent analysis of 133 clinical isolates provided further evidence that the IGS-CGE assay was highly sensitive (98%) in differentiating the 19 Nocardia species studied and assigning them to the correct species. This approximated the sensitivity of a combined 16S and 16S-23S IGS PCR-based reverse line blot (RLB) assay previously described by our group (19). While a minority (about 1 in 5) of isolates in our collection were found to have a unique or “signature” fragment size, it was usually the combination of fragments that provided discriminating power due to the fact that the majority of Nocardia species yielded at least two different fragment lengths. Additional information was occasionally obtained from analyzing the electropherogram pattern. This sometimes consistently depicted small excluded peaks of uncertain significance but that may represent minor subclones within a genotype such as was seen with the N. nova ATCC strain (Fig. 1) and the common N. cyriacigeorgica subtype (Fig. 2). Different-sized peaks (which appeared to usually be roughly twice the height of another peak within an isolate) were also frequently seen (e.g., N. nova ATCC strain [Fig. 1]) and were thought to possibly be due to duplication of the target genes and hence twice the amount of amplified product. Apart from the N. nova-N. veterana complex that included the three single-fragment isolates that were indistinguishable on their electropherograms, all other species were easily distinguished from each of the others.

Not only did we find that associated with each Nocardia species was a group of typical electropherograms consisting of number, length, and pattern of fragments, but also within each species, heterogeneity was the rule, with a large number of different subtypes existing, as has been described previously for species such as N. cyriacigeorgica, N. nova, and N. farcinica (4, 14, 19). Of note, a large number (n = 19) of different subtypes were found within the N. cyriacigeorgica group, in contrast to a previous study describing three genotypes (14). The intrinsic heterogeneity found by PCR-based IGS-CGE typing for this species lends itself well to epidemiologic studies or to situations where typing may be required, and this assay would appear to be a much simpler method, without the inherent limitations of having probes that capture all intraspecies variants with RLB (19).

Another interesting finding was the apparent similarity of clusters of subtypes displaying, for example, a particular fragment size, which suggested that while significant heterogeneity was the rule for all of the more common Nocardia strains studied, the majority of subtypes fit into 2 or 3 subgroups. In another study, this tendency to find 2 or 3 clusters or subgroups was also found for a number of Nocardia species such as N. cyriacigeorgica, N. farcinica, N. otitidiscaviarum, N. nova, and N. veterana (4).

The IGS-CGE assay has a number of advantages over other methods for species identification of nocardiae. It involves a straightforward PCR followed by analysis of the amplified product using CGE. The time and labor associated with traditional agar gel production and electrophoresis are not required. Similarly, compared with 16S rRNA gene sequencing as the current preferred method for the identification of Nocardia, PCR-based IGS CGE-typing is less expensive and may be quicker to perform, depending on workflow conditions. Smaller laboratories that are without expensive MALDI-TOF MS machines or pyrosequencers may have access to PCR and capillary electrophoresis machines, which can be provided by most commercial sequencing companies. The surprising finding of how highly reproducible and accurate this method was also suggests consideration of PCR-based IGS-CGE typing as a feasible adjunctive method for the diagnosis of infections by nocardiae. Also in its favor compared with traditional agar gel electrophoresis is the assay's potential portability or conduciveness to interlaboratory comparison as suggested by other investigators studying Clostridium difficile (6, 20). As more Nocardia isolates of different species are added to such a collection, the appeal of having an openly accessible online database increases. Interested groups could then compare strains from different geographic regions, while contributions, particularly of less common species, would further develop the understanding of the relatedness of the nocardiae.

Limitations of this study include the relatively small number of less common nocardiae studied. In addition, isolates in our study may have different profiles from those found in other parts of the world. For example, the two N. farcinica ATCC isolates (ATCC 3308 and 3318) had the same IGS-CGE subtype but, apart from carrying the commonly found N. farcinica 339-bp fragment length, were different from all the other N. farcinica isolates in our collection. In contrast, the N. nova ATCC 33726 strain had the same subtype as seven other local N. nova isolates and belonged to the most common N. nova subtype. Other limitations include the small number of other aerobic actinomycetes profiled; CGE profiles for ATCC strains (Table 2) were clearly distinguishable from those of nocardiae, but testing of clinical strains representing these genera is warranted to support the findings obtained in this study. Finally, it would be of interest to compare CGE profiles of less closely related organisms such as the corynebacteria and rapidly growing mycobacteria, although based on their different staining properties (modified acid-fast/acid-fast negative and acid-fast positive, respectively), we focused on isolates most likely to be confused with the nocardiae (i.e., weakly modified acid-fast organisms).

In conclusion, we have shown that PCR-based IGS-CGE typing can be used to discriminate between the vast majority of Nocardia isolates and highlights the heterogeneous nature of this genus. The assay overcomes previously identified problems with certain species such as the N. nova group that may carry multiple different copies of a 16S rRNA gene. In addition, the technique is inherently suited to subtyping and strain tracking. Since it is relatively simple, cheap, and quick to use, with more experience and the construction of a database containing robust IGS-CGE profiles, this approach offers a potential alternative to 16S rRNA sequencing as a method for identification of the nocardiae.

Footnotes

Published ahead of print 8 August 2012

REFERENCES

  • 1. Brown-Elliott BA, Brown JM, Conville PS, Wallace RJ. 2006. Clinical and laboratory features of the Nocardia spp. based on current molecular taxonomy. Clin. Microbiol. Rev. 19:259–282 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Conville PS, Witebsky FG. 2005. Multiple copies of the 16S rRNA gene in Nocardia nova isolates and implications for sequence-based identification procedures. J. Clin. Microbiol. 43:2881–2885 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Conville PS, Witebsky FG. 2007. Analysis of multiple differing copies of the 16S rRNA gene in five clinical isolates and three type strains of Nocardia species and implications for species assignment. J. Clin. Microbiol. 45:1146–1151 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Helal M, et al. 2011. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data. PLoS One 6:e19517 doi:10.1371/journal.pone.0019517 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Hoffman M, et al. 2010. PCR-based method for targeting 16S–23S rRNA intergenic spacer regions among Vibrio species. BMC Microbiol. 10:90 doi:10.1186/1471-2180-10-90 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Indra A, et al. 2008. Characterization of Clostridium difficile isolates using capillary gel electrophoresis-based PCR ribotyping. J. Med. Microbiol. 57:1377–1382 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Kong F, et al. 2009. Assignment of reference 5′-end rDNA sequences and species-specific sequence polymorphisms improves species identification of Nocardia. Open Microbiol. J. 3:97–105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Kong F, et al. 2010. SecA1 gene sequence polymorphisms for species identification of Nocardia species and recognition of intraspecies genetic diversity. J. Clin. Microbiol. 48:3928–3934 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Liu WL, et al. 2011. Clinical and microbiological characteristics of infections caused by various Nocardia species in Taiwan: a multicentre study from 1998 to 2010. Eur. J. Clin. Microbiol. Infect. Dis. 30:1341–1347 [DOI] [PubMed] [Google Scholar]
  • 10. McNeil MM, Brown JM. 1994. The medically important aerobic Actinomycetes: epidemiology and microbiology. Clin. Microbiol. Rev. 7:357–417 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. McTaggart LR, Richardson SE, Witkowska M, Zhang SX. 2010. Phylogeny and identification of Nocardia species on the basis of multilocus sequence analysis. J. Clin. Microbiol. 48:4525–4533 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Radtke A, Lindstedt BA, Afset JE, Bergh K. 2010. Rapid multiple-locus variant-repeat assay (MLVA) for genotyping of Streptococcus agalactiae. J. Clin. Microbiol. 48:2502–2508 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Saubolle MA, Sussland D. 2003. Nocardiosis: review of clinical and laboratory experience. J. Clin. Microbiol. 41:4497–4501 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Schlaberg R, Huard RC, Della-Latta P. 2008. Nocardia cyriacigeorgica, an emerging pathogen in the United States. J. Clin. Microbiol. 46:265–273 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Schouls LM, et al. 2009. Multiple-locus variable number tandem repeat analysis of Staphylococcus aureus: comparison with pulsed-field gel electrophoresis and spa-typing. PLoS One 4:e5082 doi:10.1371/journal.pone.0005082 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Verroken A, et al. 2010. Evaluation of matrix-assisted laser desorption ionization–time of flight mass spectrometry for identification of Nocardia species. J. Clin. Microbiol. 48:4015–4021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Wallace RJ, Jr, Steele LC, Sumpter G, Smith JM. 1988. Antimicrobial susceptibility patterns of Nocardia asteroides. Antimicrob. Agents Chemother. 32:1776–1779 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Wang X, et al. 2010. Reverse line blot hybridization and DNA sequencing studies of the 16S-23S rRNA gene intergenic spacer regions of five emerging pathogenic Nocardia species. J. Med. Microbiol. 59:548–555 [DOI] [PubMed] [Google Scholar]
  • 19. Xiao M, et al. 2010. Identification of pathogenic Nocardia species by reverse line blot hybridization targeting the 16S rRNA and 16S-23S rRNA gene spacer regions. J. Clin. Microbiol. 48:503–511 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Xiao M, et al. 2012. Comparison of two capillary gel electrophoresis systems for Clostridium difficile ribotyping, using a panel of ribotype 027 isolates and whole-genome sequences as a reference standard. J. Clin. Microbiol. 50:2755–2760 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES