Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2012 Nov;86(22):12115–12128. doi: 10.1128/JVI.01632-12

Epitope Mapping of Broadly Neutralizing HIV-2 Human Monoclonal Antibodies

Rui Kong a,b,*, Hui Li b, Ivelin Georgiev c, Anita Changela c, Frederic Bibollet-Ruche b, Julie M Decker a, Sarah L Rowland-Jones d, Assan Jaye e, Yongjun Guan f, George K Lewis f, Johannes P M Langedijk g,*, Beatrice H Hahn b, Peter D Kwong c, James E Robinson h, George M Shaw b,✉
PMCID: PMC3486499  PMID: 22933274

Abstract

Recent studies have shown that natural infection by HIV-2 leads to the elicitation of high titers of broadly neutralizing antibodies (NAbs) against primary HIV-2 strains (T. I. de Silva, et al., J. Virol. 86:930–946, 2012; R. Kong, et al., J. Virol. 86:947–960, 2012; G. Ozkaya Sahin, et al., J. Virol. 86:961–971, 2012). Here, we describe the envelope (Env) binding and neutralization properties of 15 anti-HIV-2 human monoclonal antibodies (MAbs), 14 of which were newly generated from 9 chronically infected subjects. All 15 MAbs bound specifically to HIV-2 gp120 monomers and neutralized heterologous primary virus strains HIV-27312A and HIV-2ST. Ten of 15 MAbs neutralized a third heterologous primary virus strain, HIV-2UC1. The median 50% inhibitory concentrations (IC50s) for these MAbs were surprisingly low, ranging from 0.007 to 0.028 μg/ml. Competitive Env binding studies revealed three MAb competition groups: CG-I, CG-II, and CG-III. Using peptide scanning, site-directed mutagenesis, chimeric Env constructions, and single-cycle virus neutralization assays, we mapped the epitope of CG-I antibodies to a linear region in variable loop 3 (V3), the epitope of CG-II antibodies to a conformational region centered on the carboxy terminus of V4, and the epitope(s) of CG-III antibodies to conformational regions associated with CD4- and coreceptor-binding sites. HIV-2 Env is thus highly immunogenic in vivo and elicits antibodies having diverse epitope specificities, high potency, and wide breadth. In contrast to the HIV-1 Env trimer, which is generally well shielded from antibody binding and neutralization, HIV-2 is surprisingly vulnerable to broadly reactive NAbs. The availability of 15 human MAbs targeting diverse HIV-2 Env epitopes can facilitate comparative studies of HIV/SIV Env structure, function, antigenicity, and immunogenicity.

INTRODUCTION

Human immunodeficiency virus type 1 (HIV-1) and HIV-2 originated from evolutionarily divergent primate lentiviruses (simian immunodeficiency virus [SIV]) whose natural hosts are chimpanzees (SIVcpz) and sooty mangabey monkeys (SIVsmm), respectively (17, 24, 60). HIV-1 and HIV-2 Env gp160 glycoproteins share 40% amino acid identity and 75% amino acid similarity, their amino acid alignments are unambiguous, and their structure-function relationships are highly conserved (8, 23, 26, 35, 79). Like HIV-1, primary strains of HIV-2 utilize CD4 and CCR5 as receptors for cell entry (22, 40, 42, 50, 61). However, because of their widely divergent primary sequences, HIV-1 and HIV-2 generally share little antigenic cross-reactivity, especially in regard to neutralizing antibodies (NAbs) (13, 31, 72), the exception being highly conserved epitopes in the respective bridging sheets, which are targeted by CD4-induced (CD4i) antibodies (13).

The antigenic properties and neutralization sensitivities of primary HIV-1 strains have been the subject of intensive investigation, since such information is believed to hold critical insights for rational vaccine design. During natural HIV-1 infection, antibodies are elicited against numerous Env regions, including the variable loops (1, 11, 26, 28, 63, 64), CD4 binding site (9, 76, 77, 81, 82), CD4i sites (13, 35, 65), conserved glycopeptides on the gp120 surface protein (5, 6, 69, 70), and the membrane-proximal external region (MPER) of gp41 (7, 44, 84, 85), as well as innumerable epitopes or regions accessible on the gp120 and gp41 monomers, but not on the native Env trimer (2, 29, 46). However, the native HIV-1 Env trimer employs several nonredundant strategies of immune evasion to avoid antibody recognition and neutralization, including oligomeric exclusion, glycan shielding, conformational masking, and sequence variation (32, 35, 48, 71, 79). This results in neutralizing-antibody titers in plasma against autologous virus strains that can be quite high but that generally show limited breadth and potency against heterologous primary HIV-1 strains (3, 18, 20, 59, 71). Exceptional individuals (generally less than 10 to 20% of HIV-1-infected subjects) with chronic infection exhibit broadly neutralizing antibodies against a diverse spectrum of primary virus strains representing different subtypes, but even then, NAb titers are generally in the range of 1:100 to 1:1,000 and only rarely higher (15, 16, 38, 55, 57, 58, 69, 70, 76, 77).

A surprising recent finding by our laboratory and two others is that HIV-2-infected patients almost invariably exhibit broadly reactive, high-titer NAbs that effectively neutralize most heterologous primary HIV-2 strains. For example, we found that plasma specimens from 64 of 64 subjects with chronic HIV-2 infection neutralized three heterologous primary virus strains with median reciprocal 50% inhibitory concentrations (IC50s) ranging from 2.8 × 104 to 1.7 × 105 (31). de Silva and colleagues (14) and Ozkaya Sahin and colleagues (45) made similar observations. These results indicate not only that HIV-2 is highly immunogenic in natural infection, but that primary virus strains derived from such individuals are generally highly susceptible to neutralization, a property that distinguishes primary strains of HIV-2 from primary strains of HIV-1. Elucidation of epitopes on HIV-2 Env that are vulnerable to attack by NAbs could potentially provide insights into vulnerabilities on HIV-1 Env and into mechanisms of virus persistence in the face of potent and broadly reactive NAbs that are relevant to both HIV-2 and HIV-1 infection (74). In addition, such information could inform our understanding of the relevance of different SIV- and simian-human immunodeficiency virus (SHIV)-macaque infection models to HIV immunopathogenesis and prevention.

Human neutralizing MAbs specific for HIV-1 have proven to be invaluable reagents for probing the structure, antigenicity, and neutralization susceptibility of HIV-1. Unlike HIV-1, however, where numerous neutralizing MAbs have been isolated and characterized (33, 57, 58, 62, 69, 70, 76, 77), few HIV-2-specific MAbs have been identified and reported. Previously, we isolated four MAbs (1.7A, B23, 1.10C, and 26C) by Epstein-Barr virus (EBV) transformation of B cells derived from an HIV-2-infected individual from the Ivory Coast. MAbs 1.7A, B23, and 1.10C showed neutralizing activities against the related simian immunodeficiency virus SIV/17E-CL (10, 53), and 1.7A was later shown to have potent neutralizing activity against several HIV-2 strains (13). 26C is a nonneutralizing antibody (10, 13, 53, 54). The epitope(s) recognized by 1.7A, B23, and 1.10C were not defined, although preliminary data showed that they competed among themselves and with a group of rhesus MAbs (2.10F, 3.11E, 3.2C, 1.6A, 1.5A, and E31) for binding monomeric SIV/17E-CL gp120 glycoprotein (10, 53). Recently, we (31) and others (14) observed that 1.7A has potent neutralizing activity against a large number of primary HIV-2 strains. This surprising observation prompted us to undertake a reassessment of the immunogenicity of HIV-2 Env in natural human infection and the susceptibility of HIV-2 Env to neutralization by heterologous HIV-2-positive patient plasma, by 1.7A and by other anti-HIV-2 human MAbs that we had recently cloned. In the present study, we report the isolation and characterization of 14 new MAbs from 9 Gambian patients with chronic HIV-2 infection using EBV transformation of B cells or direct molecular cloning of the immunoglobulin (Ig) genes from memory B cells. We used peptide-scanning (pepscan) analysis, site-directed mutagenesis, and alanine scanning to map the epitopes of two of the most potent and broadly reactive neutralizing MAbs, 6.10F and 1.7A. We then used competition enzyme-linked immunosorbent assay (ELISA) and differential neutralization patterns to categorize the 15 MAbs in groups with generally nonoverlapping reactivities. Three major epitope-reactive groups of NAbs were identified, including those specific for linear epitopes on the V3 region (CG-I), conformational epitopes involving the C terminus of the V4 region (CG-II), and conformational epitopes associated with CD4 and coreceptor binding sites (CG-III).

MATERIALS AND METHODS

Monoclonal antibodies.

Fourteen MAbs were isolated from nine treatment-naïve Gambian subjects chronically infected with HIV-2. These subjects generally had normal or near-normal CD4 T-cell counts and, where known, low viral loads (Table 1). Six MAbs (6.10F, 6.10B, 1.4H, 1.4B, 5.9D, and 7.4H) were produced by EBV transformation of human B cells (53, 54) and eight (9.1A, 18.9G, 11.2B, 17.9C, 1.1F, 10.3G, 19.11F, and 20.3D) were molecularly cloned from HIV-2 Env-specific human memory B cells (21, 68). The memory B cells were enriched from purified human B cells by positive selection using anti-CD27 microbeads. These cells were then seeded at 100 cells per well in 96-well U-bottom microplates and stimulated by incubation with complete medium containing CpG and interleukin 2 (IL-2) or R848 and IL-2 (21, 68). After 2 weeks, the supernatant fluid was collected from each well and screened for HIV-2 gp120 glycoprotein binding by enzyme-linked immunosorbent assay (ELISA) using previously described methods (10, 53). Cells from wells with positive gp120 binding were harvested for RNA extraction. Human Ig heavy (H) chain and κ and λ light (L) genes were amplified by reverse transcription (RT)-PCR, cloned into expression vectors, and expressed in 293T cells for recombinant antibody production, as described previously (21, 66). The isotype of these MAbs was determined in an ELISA using mouse monoclonal antibodies specific for human IgG1, IgG2, IgG3, and IgG4. All HIV-2 MAbs are IgG1. The neutralizing MAb 1.7A and a nonneutralizing MAb, 2.6C, used in this study were isolated from an HIV-2-infected patient from the Ivory Coast as previously reported (10, 53). Patient and MAb information is summarized in Table 1.

Table 1.

Summary of MAbs isolated from patients with chronic HIV-2 infection

HIV-2 MAb Patient ID Location Viral load CD4 count Isolation gp120 binding
Neutralization titers (IC50 [μg/ml])
HIV-27312A HIV-2ST SIVmac239 HIV-1SF162 HIV-27312A HIV-2ST HIV-2UC1
1.7A NAa Ivory Coast NA NA Eb +d + + − 0.007 0.002 0.001
5.9D N37235 Gambia NA 650 E + + + − 0.003 0.003 0.006
7.4H N37235 Gambia NA 650 E + + + − 0.002 0.002 0.003
9.1A N043417 Gambia 181 900 Mc + + + − 0.001 0.001 0.002
18.9G N042813 Gambia 100 520 M + + + − 0.007 0.002 0.060
11.2B N043283 Gambia NA 820 M + + −e − 4.139 0.117 >10
17.9C N042840 Gambia 181 670 M + + + − 0.001 0.001 >10
10.3G N042651 Gambia 2732 1090 M + + + − 0.005 0.003 0.022
20.3D N041184 Gambia NA 650 M + + − − 0.003 0.003 >10
6.10F N37235 Gambia NA 650 E + + + − 0.007 0.004 0.011
1.4B N37126 Gambia NA 300 E + + − − 0.141 0.133 >10
6.10B N37126 Gambia NA 300 E + + + − 0.094 0.040 0.655
1.1F N004832 Gambia NA NA M + + + − 0.025 0.023 >10
1.4H N37126 Gambia NA 300 E + + + − 0.782 0.043 0.028
19.11F N042840 Gambia 181 670 M + + − − 0.019 0.012 0.022
a

NA, not available.

b

E, EBV transformation of B cells.

c

M, molecular cloning of immunoglobulin genes of Env-specific memory B cells.

d

+, the MAb binds to the gp120 in ELISA.

e

−, the MAb does not bind to the gp120 in ELISA.

Competition ELISA.

Solubilized HIV-2ST gp120 glycoproteins produced in 293T cells were captured in 96-well ELISA plates coated with 5 μg/ml human MAb 2.6C (10, 13, 31). The wells were washed and then blocked with phosphate-buffered saline (PBS) containing 4% whey and 0.5% Tween 20 at 25°C for 30 min and incubated with serially diluted HIV-2 MAb (starting at 10 μg/ml) or buffer without MAbs at room temperature for 30 min. Biotinylated MAb was added to the wells for 60 min at concentrations that permitted unsaturated binding. Sequential incubation with peroxidase-conjugated streptavidin and tetramethylbenzidine-H2O2 allowed color development, which was stopped by the addition of 1 M phosphoric acid. The absorbance was read as the optical density at 450 nm (OD450). To test whether MAbs could block binding of soluble CD4 (sCD4) to HIV-2ST gp120 immobilized on 2.6C-coated plates, wells were first incubated with MAb or buffer and then with sCD4 (0.5 μg/ml). The wells were washed and incubated sequentially with a biotinylated guinea pig anti-CD4 preparation and peroxidase-conjugated streptavidin. Color was developed with TMB-H2O2 substrate and stopped with 1 M phosphoric acid. Reduction of absorbance by >70% by a MAb indicated blocking of sCD4 binding to gp120. To test whether MAb binding with HIV gp120 was enhanced by preincubation with sCD4, wells were first incubated with sCD4 at a concentration of 0.5 μg/ml and then with biotinylated MAbs. Color was developed and then stopped as described above, and the absorbance was read at OD450.

Pepscan analysis.

Linear and cyclic peptide libraries containing 643 15-mer peptides with an overlap of 14 were synthesized to cover the entire ectodomain of HIV-27312A Env glycoprotein and tested for MAb binding as described previously (36, 67). The peptides were synthesized on polypropylene supports (minicards), and MAbs were tested for binding at 5 μg/ml in PBS containing 1% bovine serum albumin (BSA) and 1% (vol/vol) Tween 80. Pepscan peptide-binding analysis was carried out in an ELISA-based format in which the colored substrate was quantified with a charge-coupled device (CCD) camera and an image-processing system. The values mostly ranged from 0 to 3,000, a log scale similar to 1 to 3 on a standard 96-well plate ELISA reader.

HIV-2 strains.

HIV-2 proviral clones pJK7312A and pSTsxb1 and 13 chimeric clones with an HIV-2 gp160 ectodomain inserted into an HIV-27312A backbone, p7/SNAG, were generated from primary virus env genes (HIV-21871/5-5, HIV-21871/5-10, HIV-21871/5-14, HIV-21871/5-9, HIV-260415K-2, HIV-2227011-5, HIV-2226711-11, HIV-2226711-21, HIV-2A2240-7, HIV-2SLRH4, and HIV-21958_1-32) or T-cell line-adapted env genes (HIV-2MVP11971-16 and HIV-2MVP151321-3), as previously described (13, 31). These clones were transfected into 293T cells using Fugene 6 (Roche Applied Science, Indianapolis, IN) for producing virus stocks, as previously described (11). The HIV-2UC1 stocks were generated by cotransfection of 293T cells with the env expression construct pSM-UC1 and the backbone construct pJK7312AΔEnv (31).

V4 and V5 chimeric viruses.

The chimeric clones p7/SNAG-HIV-21871/5-5_C10V4 and p7/SNAG-HIV-21871/5-5_C10V5 were made by inserting the V4 or V5 sequence of HIV-21871/5-10, respectively, into the proviral clone p7/SNAG-HIV-21871/5-5 using approaches described previously (3, 11, 19). These clones were transfected into 293T cells to prepare virus stocks.

Site-directed mutagenesis.

To generate nucleotide substitutions in the env genes of HIV-27312A, HIV-21871/5-5, and HIV-21871/5-10, a gp160 ectodomain gene fragment containing the desired substitution was first generated by recombinant PCR (43). In brief, two overlapping DNA fragments were amplified from the template env gene in first-step PCR using the forward primer 7312Aenv1-F (5′ATGTGTGGTAAGAATCTACTATTTGTTG3′) and a 43-bp reverse primer with the substitutions located in the center or using a 43-bp forward primer with the substitutions located in the center and the reverse primer 7312Aenv2287-R (5′TTAGGAAGTGGATGTATTCGATCTGC3′). In a second-step PCR (recombinant PCR), these two fragments with 43-bp overlapping sequences were annealed and extended. The final ectodomain gene fragment containing the substitutions was then amplified using primers SnaB1-F (5′CCAAATACGTAACTGTTTTTTATGGC3′) and AgeI-R (5′GAAAACCGGTCTATAGCCCTTTCTAAG3′). Recombinant PCR conditions were as follows: 98°C for 30 s (1 cycle); 98°C for 10 s, 37°C for 30 s, and 72°C for 50 s (3 cycles); 98°C for 10 s, 60°C for 15 s, and 72°C for 50 s (15 cycles); and 72°C for 7 min (1 cycle). The PCR products were digested and ligated into the p7/SNAG vector using restriction enzymes SnaB1 and AgeI (31).

TZM-bl single-cycle virus entry assay.

The 293T cell-grown virus stocks were first titrated on TZM-bl reporter cells (8129; NIH AIDS Research and Reference Reagent Program) as previously described (11). The titer of virus stock was measured and represented as relative light units (RLU) per μl. The neutralization titers of MAbs were assessed as described previously (11, 31, 71). TZM-bl cells were seeded in 96-well plates. After 24 h, a mixture of 5 × 104 RLU virus stocks and 5-fold serially diluted MAbs was made in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS) and 40 μg/ml DEAE-dextran (Sigma-Aldrich, St. Louis, MO) and incubated at 37°C for 1 h. The medium in the wells was then replaced with 100 μl virus-plasma mixture. After 48 h of incubation at 37°C, the cells were lysed and the luciferase activity was measured. Background and maximum (100%) infections were defined as the luciferase activities in medium-only and virus-only wells, respectively.

Sequence alignment.

Sequence alignments were made using ClustalX 2.0.12.

Structure modeling.

A structural representation of gp120 from HIV-2 primary strain 7312A was constructed from crystal structures of HIV-1 gp120 core with complete N and C termini (47) and HIV-1 gp120 core with V3 (26). The GlyProt server (4) was used to model basic glycans at accessible potential N-linked glycosylation sites. Modeling of the oligomeric viral spike was based on structures from cryoelectron microscopy (25, 39, 73, 75).

RESULTS

Neutralizing MAbs from HIV-2-infected subjects.

A comparative analysis of the binding and neutralization properties of the 15 HIV-2 Env-specific IgG1 MAbs was performed (Table 1). All 15 MAbs bound monomeric HIV-2 gp120 glycoprotein based on ELISA, and most of them bound SIVmac239 gp120. None of the HIV-2 MAbs bound HIV-1SF162 gp120 with or without preincubation with sCD4 (Table 1). In the TZM-bl single-round virus entry assay, all MAbs neutralized the primary HIV-2 strains HIV-27312A and HIV-2ST, and 10 out of 15 neutralized the primary HIV-2 strain HIV-2UC1 (Table 1) (13, 31). HIV-27312A and HIV-2ST belong to phylogenetic group A, and HIV-2UC1 belongs to group B (31). The median IC50 titers were 0.007 μg/ml, 0.003 μg/ml, and 0.028 μg/ml, respectively. These data, while showing broad and potent heterologous neutralization, could suggest a degree of group-specific neutralizing activity; however, we have no information regarding the infecting virus strains to support or refute this conjecture.

Three cross-competition binding and neutralization patterns distinguish HIV-2 MAbs.

The 15 MAbs were tested against one another in competitive binding ELISAs for recognition of the HIV-2ST gp120 glycoprotein (Table 2). Three principal competition groups (CG) were identified. They are CG-I, which includes 6.10F and 1.4B; CG-II, which includes 1.7A, 5.9D, 7.4H, 9.1A, 10.3G, 17.9C, 18.9G, 20.3D, and 11.2B; and CG-III, which includes 19.11F, 6.10B, 1.1F, and 1.4H. Two antibodies exhibited binding patterns that overlapped CG-I and CG-II (1.4B) or CG-I and CG-III (19.11F). To compare cross-competition Env gp120 binding patterns with neutralization patterns, we analyzed a representative subset of the MAbs for neutralization titers against a panel of 14 HIV-2 strains in the TZM-bl assay. CG-II MAbs (1.7A, 5.9D, and 7.4H) exhibited virtually identical neutralization profiles that distinguished them from the other MAbs (Table 3). These MAbs potently neutralized the same 10 HIV-2 strains and failed to neutralize 4 others. The CG-I MAb 6.10F and MAb 1.4B showed very similar but not identical patterns of neutralization that distinguished them from the other MAbs. Two CG-III MAbs (6.10B and 1.4H) also showed similar but not identical patterns of neutralization that distinguished them from the other MAbs. The potencies of the 7 MAbs in neutralizing different subsets of the 14-virus test panel, 12 of which were cloned either from a primary virus isolate (HIV-27312A) or from uncultured human lymphocytes or plasma (31), were notable. Among those viruses that were sensitive to MAb neutralization (IC50 < 1 μg/ml), the mean IC50 titers were as follows: 6.10F, 0.009 μg/ml; 1.4B, 0.207 μg/ml; 1.7A, 0.021 μg/ml; 5.9D, 0.014 μg/ml; 7.4H, 0.014 μg/ml; 6.10B, 0.124 μg/ml; and 1.4H, 0.125 μg/ml. The neutralization patterns of all the MAbs tested generally corresponded to their cross-competition binding patterns. These results suggested that there were distinct antigenic regions on the HIV-2 Env monomer and native trimer that were recognized by the different NAb competition groups.

Table 2.

Cross-competition pattern of HIV-2 MAbs

graphic file with name zjv999096777t002.jpg

aB.6.10F, biotin-labeled MAb 6.10F.

b++, competition (>70% inhibition).

c+, competition (50% to 69% inhibition).

d0, no or insignificant competition (<30% inhibition).

Table 3.

Neutralization titers of MAbs against HIV-2 strains

HIV-2 strain Primary or laboratory adapteda Neutralization titer (IC50 μg/ml)b
CG-I
CG-II
CG-III
6.10F 1.4B 1.7A 5.9D 7.4H 6.10B 1.4H
HIV-27312A P 0.007 0.141 0.007 0.003 0.002 0.094 0.782
HIV-21871/5-5 P 0.012 0.947 >1 >1 >1 0.183 0.038
HIV-21871/5-10 P 0.003 0.046 0.008 0.010 0.006 0.053 0.042
HIV-21871/5-14 P 0.008 0.220 0.032 0.019 0.023 >1 >1
HIV-21871/5-9 P 0.004 0.086 0.005 0.009 0.005 0.035 0.137
HIV-260415k-2 P 0.008 0.079 >1 >1 >1 0.078 0.016
HIV-2227011-5 P 0.004 0.149 >1 >1 >1 0.077 0.066
HIV-2226711-11 P 0.014 0.069 0.038 0.005 0.003 0.104 0.034
HIV-2226711-21 P 0.025 0.142 0.029 0.005 0.003 0.430 0.169
HIV-2A2240-7 P >1 >1 >1 >1 >1 >1 >1
HIV-2SLRH4 P 0.011 0.195 0.009 0.009 0.005 0.079 >1
HIV-219581-32 P 0.007 >1 0.003 0.034 0.069 0.140 0.031
HIV-2MVP11971-16 L >1 >1 0.007 0.003 0.002 0.095 0.016
HIV-2MVP151321-3 L >1 >1 0.071 0.044 0.022 >1 0.044
a

P, primary strain; L, laboratory-adapted strain.

b

Mean IC50s were as follows: 6.10F, 0.009; 1.4B, 0.207; 1.7A, 0.021; 5.9D, 0.014; 7.4H, 0.014; 6.10B, 0.124; 1.4H, 0.125.

CG-I MAbs 6.10F and 1.4B recognize overlapping linear epitopes in the V3 loop.

Of the 15 HIV-2 MAbs tested, 6.10F exhibited the greatest potency and breadth of neutralization (mean IC50, 0.009 μg/ml) (Table 3) (14, 31)). To determine the epitope specificity of 6.10F, we first performed a pepscan analysis. We used both linear and cyclic peptides for epitope mapping to increase the binding mimicry possibilities for both 6.10F and 1.4B MAbs. In theory, the linear peptides are flexible and able to adapt to the surface of the paratope, but a cyclized peptide can be forced into conformations that are not occupied or are hardly occupied by linear peptides, and therefore, it increases the probability of binding the antibody by better mimicry of the original protein surface and/or decreases the entropy loss. It has been shown previously that, due to the conformational stability of the cyclized peptide libraries, more complex epitopes can be mapped (36, 67). Two synthetic peptide libraries (linear and cyclic) containing 643 15-mer peptides with an overlap of 14 amino acids were designed to cover the entire ectodomain of the HIV-27312A Env glycoprotein. They were used to test for 6.10F binding. As shown in Fig. 1A and B, a narrowly defined set of overlapping linear and cyclic V3 peptides exhibited strong reactivity with 6.10F, suggesting that the epitope corresponds to the linear sequence 318-(T)LMSGLVF-325. To corroborate this finding in antibody neutralization assays, single alanine substitutions were made for each of these residues in the replication-competent HIV-27312A molecular clone. Two mutants, G322A and L323A, completely lost sensitivity to 6.10F, and the mutant V324A exhibited 6.10F sensitivity reduced by more than 5-fold (Table 4). Other alanine mutants tested had little or no effect on MAb-mediated neutralization. Although the residue T318 was required for linear peptide binding in the pepscan analysis, it was not essential for cyclic peptide binding or for antibody neutralization of HIV-27312A. In addition, the residues L319 and F325 were indispensable for linear and cyclic peptide binding, but L319A and F325A mutants lost infectivity and could not be tested in neutralization assays (Table 4). These results suggest that 6.10F recognizes a linear epitope, LMSGLVF, in the V3 region, in which the residues L319, G322, L323, and F325 are essential for binding.

Fig 1.

Fig 1

Pepscan analysis of HIV-27312A for 6.10F and 1.4B epitopes. The reactivity of each peptide in the linear (A and C) or cyclic (B and D) peptide library against 6.10F and 1.4B is represented in bar graphs. The peptide numbers are according to the HIV-27312A sequence. The sequences of peptides with significant binding are shown, and the most important region is highlighted in red. The peptide reactivity with 1.4B is shown in parentheses (C and D).

Table 4.

Alanine scanning the V3 region of HIV-27312A Env for 6.10F and 1.4B neutralizationb

graphic file with name zjv999096777t004.jpg

aMutant virus lost infectivity.

b

>1, IC50 was not reached at 1 μg/ml. The color indicates increase of the IC50 as follows: red, >100 fold; orange, 5- to 100-fold. ND, not determined.

MAb 1.4B cross-competed with both 6.10F and CG-II MAbs for HIV-2 gp120 binding (Table 2), and it showed a neutralization pattern similar but not identical to that of 6.10F (Table 3). In the pepscan analysis, 1.4B reacted strongly with a cyclic V3 peptide, 319-CLMSGLVFHSQPINKRC-333 (Fig. 1D), and modestly with the corresponding linear peptide (Fig. 1C), suggesting that 1.4B recognizes a continuous epitope in the V3 loop with dependence on conformation. This finding was further supported by alanine-scanning analysis, in which the residues G322, V324, N331, and R333 were demonstrated to be essential for 1.4B neutralization (Table 4). Interestingly, alanine substitutions for 2 residues near the base of the V4 region (N399 and H422) also impaired 1.4B neutralization (Table 5). These findings suggest that 6.10F and 1.4B, which exhibit similarities in Env binding competition patterns (Table 2) and neutralization profiles against a panel of primary HIV-2 strains (Table 3), bind similar but not identical epitopes in the V3 loop on the HIV-2 Env glycoprotein.

Table 5.

Alanine scanning HIV-27312A Env for neutralization by 1.7A, 5.9D, 7.4H, and 1.4Bb

graphic file with name zjv999096777t005.jpg

aMutant virus lost infectivity.

b

>1, IC50 was not reached at 1 μg/ml. The color indicates increase of the IC50 as follows: red, >100 fold; orange, 5- to 100-fold; blue, 3- to 5-fold. ND, not determined.

CG-II MAbs recognize a conformational epitope involving the C terminus of V4.

1.7A is the prototype of a large group of CG-II neutralizing MAbs. They are potent and broadly reactive against diverse primary HIV-2 strains, as well as multiple strains of SIVsmm/SIVmac (Table 3) (10, 31). Previous work suggested that the epitope of 1.7A may be restricted to the carboxy half of gp120 and may involve V4 (10), but a precise definition of the epitope and its location was not possible. These earlier studies suggested that 1.7A binds with a 45-kDa fragment resulting from V8 protease digestion of purified SIVmac251 gp110 protein (10) and that V4 deletions (Δ420-423KPKE or Δ422-425KEQH) in the SIVmac239 gp120 interfered with gp120 binding (10, 53). To further investigate the epitope specificities of 1.7A and two related CG-II MAbs, 5.9D and 7.4H, we first screened their reactivities against the HIV-27312A peptide libraries used to localize 6.10F and 1.4B binding. No specific binding was observed, suggesting that 1.7A, 5.9D, and 7.4H recognize a conformational epitope. Next, we compared the amino acid sequences of HIV-2 strains that were sensitive or resistant to 1.7A neutralization for potential signatures of 1.7A binding. We noted that two closely related HIV-2 Env clones, HIV-21871/5-5 and HIV-21871/5-10 (Fig. 2), derived from the same subject, showed markedly different sensitivities to 1.7A neutralization, as well as 5.9D and 7.4H. HIV-21871/5-5 was resistant to neutralization by 1.7A, 5.9D, and 7.4H, whereas HIV-21871/5-10 was exquisitely sensitive to these three antibodies. In contrast, the sensitivities of the two virus clones to other MAbs, including 6.10F, 6.10B, and 1.4H, were comparable (Table 3), suggesting that substitutions between the two variants specifically affected the 1.7A epitope. Because previous studies indicated that the 1.7A binding site was in the carboxy half of gp120, we constructed chimeric env gp160 genes in which the V4 and V5 regions of HIV-21871/5-5 were replaced with corresponding regions of HIV-21871/5-10. Replacement of the V4 region created a chimeric HIV-21871/5-5_C10V4 virus that was extremely sensitive to 1.7A, but replacement of the V5 region had no effect on neutralization sensitivity (Fig. 3). Because HIV-21871/5-5_C10V4 differs from HIV-21871/5-5 by just 3 amino acids, RTV→KP, in V4, we asked if these residues are directly targeted by 1.7A. Two mutants were created in the HIV-21871/5-10 Env clone to test this possibility: HIV-21871/5-10_ENK (ENK→AAA) and HIV-21871/5-10 P411V (P→V). Both retained sensitivity to 1.7A, suggesting that the ENKP peptide is not a direct binding epitope of 1.7A (Fig. 3C). We also asked if the additional N-linked glycosylation site (NGS) in HIV-21871/5-5 V4 shielded the 1.7A epitope by generating a ΔNGS mutant, HIV-21871/5-5 N409A. This mutant showed modestly increased sensitivity to 1.7A but did not recapitulate the neutralization sensitivity of HIV-21871/5-10 and HIV-21871/5-5 C10V4 (Fig. 3C). In addition, a V411P substitution, alone or in combination with the N409A substitution, did not further enhance the sensitivity of the mutant to 1.7A neutralization (Fig. 3C). Taken together, these results suggested that the “RTV/KP” region in V4 contributes to antibody accessibility but is not itself the epitope.

Fig 2.

Fig 2

Envelope gp120 alignment for HIV-21871/5-5, HIV-21871/5-10, and HIV-27312A. The variable regions (V1/V2, V3, V4, and V5) are indicated by green bars as described previously (13). The cleavage site of V8 protease (10, 27) is indicated by the arrow. The amino acid substitutions between HIV-21871/5-5 and HIV-21871/5_10 are highlighted in yellow. The residues (N409 and P411) contributing to the site mutagenesis and alanine scanning on HIV-27312A (K307 to I427) are also indicated. The numbering is according to the HIV-27312A sequence.

Fig 3.

Fig 3

1.7A neutralization against HIV-21871/5 V4 and V5 chimeric viruses and site-directed mutants. (A) The V4 and V5 sequences of the parental strains (HIV-21871/5-5 and HIV-21871/5-10) and chimeras (HIV-21871/5-5_C10V4 and HIV-21871/5-5_C10V5) are shown, and the regions contributing to the switch are highlighted in blue (original sequence from parental strains) or red (swapped sequence). The V4 sequences of the site-directed mutants are also shown, and the mutations are highlighted in red. The numbering is according to the HIV-27312A sequence. (B) Neutralization of the parental strains and chimeras by 1.7A. (C) Neutralization of parental strains and site-directed mutants by 1.7A. The error bars indicate standard error of the mean.

To further characterize the epitope specificity of 1.7A, alanine scanning followed by neutralization sensitivity testing was performed on the V3-C3-V4-C4 regions of the HIV-27312A Env glycoprotein (Table 5). Four mutants (W406A, Q415A, H416A, and N417A) showed greater than 100-fold reduction in neutralization sensitivity, whereas a Y418F mutant revealed 10-fold-lower sensitivity than the parental strain, HIV-27312A. 5.9D and 7.4H showed similar dependence on these critical residues (W406, H416, N417, and Y418). Residues W406 and N417 showed the greatest effects on neutralization by all three MAbs. Interestingly, although 1.7A, 5.9D, and 7.4H showed close similarities in their neutralization patterns against the alanine scan mutants, they were not identical. In particular, changes in the N terminus of C3 (W340 and/or F341) had a dramatic effect on 5.9D and 7.4H neutralization but no effect on 1.7A neutralization. This suggested that their epitopes are similar but not identical. Mutation of other residues in the V3 base (R333A), the V4 region (W402), and the N terminus of the C4 region (I423 and Q425) also affected 5.9D and 7.4H neutralization, but less significantly. As a control, 1.4B neutralization was not affected by the critical 1.7A-related mutations W340A, W406A, Q415A, H416A, N417A, Y418F, and Y418W. The residues in the V3 tip were not screened for 1.7A neutralization because a recombinant 7312A gp120 glycoprotein with a deletion in this region retained 1.7A binding (A. Changela and P. D. Kwong, unpublished data).

Env mutants containing 1.7A-dependent mutations W340A, H416A, N417A, and Y418W were further tested for neutralization by other CG-II MAbs (9.1A, 18.9G, 17.9C, 10.3G, and 20.3D). Three CG-II MAbs, 9.1A, 18.9G, and 20.3D, showed dependence on all four residues. MAb 17.9C showed dependence on three V4 residues, H416A, N417A, and Y418W, and MAb 10.3G showed dependence on W340A, H416A, and Y418W (Table 6). Given the cross-competition between 1.4B and CG-II MAbs, we also tested four V3 mutants that were critical to 1.4B and/or 6.10F neutralization. The mutant R333A reduced neutralization sensitivity to MAb 18.9G by more than 100-fold and to MAb 10.3G by 9-fold, whereas the mutant G322 reduced neutralization sensitivity to MAb 17.9C by 13-fold (Table 6). Taken together, the CG-II MAbs showed overlapping but not identical patterns of neutralization against the alanine mutants. The C terminus of V4 was critical for neutralization mediated by all 8 CG-II MAbs tested, with residue W340 in the N terminus of C3 critical to most CG-II MAbs, except 1.7A and 17.9C. The residues G322 and R333 in the V3 loop were important to some, but not all, CG-II MAbs.

Table 6.

Neutralization titers of MAbs against HIV-27312A Env mutants

graphic file with name zjv999096777t006.jpg

a>1, IC50 was not reached at 1 μg/ml. The color indicates increase of the IC50 as follows: red, >100 fold; orange, 5- to 100-fold. ND, not determined.

CG-III MAb binding to HIV-2 gp120 is modulated by sCD4.

The CG-III MAbs (6.10B, 1.1F, 1.4H, and 19.11F) showed a distinct pattern of cross-competition binding and neutralization compared with other neutralizing MAbs that were tested (Tables 2 and 3). We screened the linear and cyclic HIV-27312A Env peptide libraries for 6.10B and 1.4H binding but found no evidence of linear epitope recognition (data not shown). We also screened the HIV-27312A Env V3 mutants (G322A, L323A, N331A, and R333A) that were resistant to neutralization mediated by 6.10F and/or 1.4B and the V4 mutants (W340A, H416A, N417A, and Y418W) that are critical to CG-II MAb recognition. Neither 1.1F nor 19.11F was affected by these mutations (Table 6). Thus, lacking evidence for either V3 or V4 as a likely epitope, we tested 6.10B, 1.1F, 1.4H, and 19.11F for the ability to block sCD4 binding to HIV-2ST gp120 glycoprotein by ELISA. This assay had been used previously to show that the HIV-1-specific MAb b12 competes specifically with sCD4 for binding to its Env ligand (41, 52). 6.10B and 1.1F efficiently blocked sCD4 binding by >90%, whereas 19.11F and 1.4H showed little or no effect (Fig. 4). This suggested that 6.10B and 1.1F bind to epitopes close to CD4bs. Conversely, we found that sCD4 enhanced the binding of 19.11F and 1.4H to the HIV-2 gp120 glycoprotein (Fig. 5), as it does the binding of the HIV-1 CD4i MAbs 17b, 19e, and 21c (13). No enhancement in the binding of 6.10B and 1.1F to the gp120 glycoprotein occurred in the presence of sCD4 (Fig. 5). The CG-I and CG-II MAbs were neither inhibited nor enhanced in their binding to HIV-2 Env by sCD4. The cross-competition of HIV-2 CD4bs and CD4i MAbs in gp120 binding that we observed is consistent with previous reports for HIV-1 CD4bs and CD4i MAbs (41), which reflects the proximity of receptor and coreceptor binding sites on the HIV-1 gp120 core structure (35, 78).

Fig 4.

Fig 4

Blocking of sCD4-gp120 binding by 6.10B and 1.1F. Wells with HIV-2ST gp120 immobilized in 2.6C-coated plates were preincubated with 10 μg/ml HIV-2 MAbs or buffer, washed, and then incubated with sCD4. The percent inhibition of sCD4 binding by MAbs is shown in the bar graph. More than 70% inhibition was considered blocking of sCD4-gp120 binding. Similar results were obtained in at least three independent experiments. The error bars indicate standard error of the mean.

Fig 5.

Fig 5

sCD4-induced gp120 binding of 19.11F and 1.4H. Wells with HIV-2ST gp120 immobilized in 2.6C-coated plates were preincubated with sCD4 (0.5 μg/ml) or buffer, washed, and then incubated with biotinylated MAbs. Similar results were obtained in three independent experiments. The error bars indicate standard error of the mean.

DISCUSSION

HIV-2 is highly immunogenic in natural infection and sensitive to neutralization mediated by autologous and heterologous NAbs (14, 31, 45). Elucidating the NAb epitopes on HIV-2 Env that contribute to its remarkable immunogenicity and neutralization sensitivity is important for understanding the contribution of NAbs to containment of HIV-2 replication in vivo and for comparative virologic analyses with HIV-1, SIVsmm/SIVmac, and other SIV strains and lineages. We previously showed that four human MAbs (1.7A, 6.10F, 6.10B, and 1.4H) potently neutralized a set of 32 primary HIV-2 strains, with IC50s of less than 0.1 μg/ml in most cases (31). In the present study, we characterized the epitope specificities of these 4 MAbs plus 11 others. These 15 MAbs were obtained from a total of 9 different HIV-2-infected subjects. All 15 MAbs potently neutralized the group A primary HIV-2 strains HIV-27312A (median IC50, 0.007 μg/ml) and HIV-2ST (median IC50, 0.003 μg/ml), and 10 out of 15 MAbs potently neutralized the group B primary HIV-2 strain HIV-2UC1 (median IC50, 0.028 μg/ml) (Table 1). When tested on an expanded HIV-2 panel, 7 representative MAbs (1.7A, 5.9D, 7.4H, 6.10F, 1.4B, 6.10B, and 1.4H) showed potent neutralization (median IC50 range, 0.005 to 0.1415 μg/ml) against at least 10 out of 15 strains (Table 3). Such NAb titers are comparable to or higher than those of the HIV-1 broadly reactive NAbs VRC01/02/03, VRC-PG04, PG9, PG16, PGT 121 to 123 and 125 to 128, 3BNC117, NIH45 to -46, b12, 2G12, 2F5, and 4E10 tested against a large number of primary HIV-1 strains (57, 58, 69, 70, 76, 77). The HIV-2 neutralizing MAbs were categorized into three principal competition groups (CG-I, -II, and -III) based on their cross-competition binding and neutralization patterns. Epitope mapping using pepscan analysis and alanine-scanning analysis indicated that linear V3 regions were recognized by CG-I MAbs (6.10F and 1.4B). MAbs 6.10F and 1.4B were found to recognize the overlapping linear sequences 319-LMSGLVF-325 and 319-LMSGLVFHSQPINKR-333 in the HIV-27312A V3 loop by pepscan analysis (Fig. 1 and Table 4). These mapping results likely explain the neutralization resistance to these MAbs observed in some HIV-2 strains, since substitutions L323W in HIV-2MVP11971-16 and L323F and V324K in HIV-2MVP151321-3 lie within the epitope of 6.10F and substitutions R333K in HIV-2MVP11971-16 and V324K in HIV-2MVP151321-3 lie within the epitope of 1.4B (Tables 3 and 4 and Fig. 1 and 6), though further mutational studies will be required to confirm these conjectures.

Fig 6.

Fig 6

Sequence alignments of V3, the N terminus of C3, V4, and the N terminus of C4 for HIV-2 and SIV strains. The HIV-2 sequences were aligned with HIV-27312A, and the SIVsmm/SIVmac sequences were aligned with SIVmac239. The linear 6.10F and 1.4B epitopes on V3 and critical residues involved in 1.7A recognition are indicated in red. The numbering is according to the HIV-27312A sequence.

Alignment of 20 HIV-2 V3 sequences and 14 SIVsmm/SIVmac V3 sequences revealed a high degree of amino acid conservation of this region, especially in the critical positions for neutralization mediated by 6.10F (L/I319, G322, L323, V324, and F325) and 1.4B (G322, V324, N331, and R333) (Fig. 6 and Table 4). This is in agreement with the observed neutralization breadth of MAbs 6.10F and 1.4B, as well as the HIV-2-infected patient plasma samples, which compete with 6.10F for binding to Env (Tables 1 and 3) (14, 31). Interestingly, the corresponding region on HIV-1 V3 also showed considerable conservation (49, 83). NAbs directed to HIV-1 V3 were discovered in most clade B and C plasma samples (11, 12), and in particular, two HIV-1 MAbs, 447-52D and F425 B4e8, recognize a similar region on the HIV-1 V3 loop (1, 11, 63). The V3 loops in HIV-1 and HIV-2 Env are both highly immunogenic in vivo, although primary HIV-1 Envs are almost always resistant to neutralization by V3 antibodies as a result of conformational masking (32). Remarkably, primary HIV-2 Envs lack such masking both in the context of the native HIV-2 Env trimer and when the V3 region of HIV-1 is inserted into an HIV-2 Env background. In the latter case, such chimeric viruses become exquisitely sensitive to HIV-1-specific V3-reactive MAbs and to polyclonal antibodies in HIV-1-infected patient sera (11, 12).

The CG-II MAbs (1.7A, 5.9D, 7.4H, 9.1A, 18.9G, 17.9C, 10.3G, and 20.3D) recognized a conformational epitope involving the C terminus of V4. Alignment of the HIV-2 and SIV V4 sequences (Fig. 6) showed considerable conservation in most amino acid positions found to be important to neutralization sensitivity, including W340, F341, W402, W406, Q415, H416, N417, Y418, and I423. This observation suggests an explanation for the breadth of neutralization exhibited by CG-II MAbs. Two lines of evidence suggested that CG-II 1.7A-like NAbs are commonly elicited in HIV-2 infection (31) and in SIV-infected rhesus macaques: (i) several rhesus MAbs competed with 1.7A in gp120 binding and lost binding to SIVmac239 Env after truncating V4 (10); (ii) two previous studies showed early viral escape mutants involving the C terminus of V4 and the N terminus of C3, which correlated well with the defined CG-II MAb epitopes but not other regions on the SIV Env in five rhesus macaques acutely infected with either SIVmac251 or SIVmac239 (56, 80). The immunodominance and antigenicity of HIV-2 V4 contrast with HIV-1, where V4 has not been found to be a common target of NAbs.

Because CG-I, CG-II, and CG-III MAbs exhibited unexpected breadth and potency of HIV-2 neutralization, we asked if the extent of antibody somatic hypermutation or the length of CDRH3 might be responsible, as is the case for some broadly reactive HIV-1 neutralizing MAbs (70, 76, 77). As shown in Table 7, the somatic hypermutation frequencies of the heavy chains and the light chains of HIV-2 MAbs (VH, 7.99% to 22.22%, and VL, 3.37% to 16.09%) are generally lower than those of the VRC series of HIV-1 NAbs (VH, 23% to 32%, and VL, 15% to 20%) but higher than those of antibodies from healthy donors (mean VH, 5.9%, and mean VL, 2.0%) (76, 77). The CDRH3 lengths of HIV-2 MAbs (14 to 28 amino acids; median, 18) are modestly longer than those of VRC series HIV-1 bNAbs and healthy donors but shorter than those of PG9 and PG16 (70). These results suggest that a high somatic mutation frequency and a long CDRH3 may contribute to but are not necessary for broad and potent HIV-2 neutralization.

Table 7.

Gene family analysis of HIV-2 MAbsa

MAb CG Heavy chain
Light chain
IGHV IGHD IGHJ CDRH3 length VH mutation frequency (%) IGKVd/LVe IGKJd/LJe CDRH3 length VK/VL mutation frequency (%)
6.10F I 4-59*01 IR1*01R 6*03 19 14 3-11*01d 4*01d 5 14.77
5.9D II 1-69*09 3-03*01 1*01 17 20 1-33*01d 4*01d 9 12.88
7.4H II 1-69*09 3-03*01 1*01 17 19 1-33*01d 4*01d 9 14.02
9.1A II 1-69*01 1-14*01R 5*02 21 12 2-40*01/2D40d 2*01d 9 5.67
10.3G II 1-24*01 3-03*01 4*02 14 9 3-20*01d 5*01d 9 5.62
17.9C II 1-69*11 3-16*01 2*01 16 17 3-20*01d 3*01d 5 7.49
18.9G II 1-24*01 6-19*01 4*02 22 16 3-1*01e 1*01e 9 16.09
11.2B II 1-69*01 IR1*01R 5*02 19 22 1D-39*01d 4*01d 9 1.89
19.11F III 1-69*01 2-21*02 6*03 19 15 4-1*01d 2*01d 8 8.16
1.4H III 1-69*05 4-17*01 6*02 28 11 1-39*01d 1*01d 9 6.82
6.10B III 1-69*05 1-07*01 6*02 16 8 3-20*01d 2*03d 9 3.37
1.1F III 1-02*02 3-10*01 6*03 17 10 1-44*01e 3*02e 13 7.87
VRC seriesb 14–16 23–32 5 15–20
PG9 and PG16 30 14–15 10 48
PGT seriesb 20–34 12–23 9–12 9–24
Healthy donorsc 15 5.9 9 2.0
a

Analysis was performed on nucleotide sequences using IMGT Joinsolver database (76).

b

Gene family analysis of the VRC series (VRC01, VRC03, PG04, PG04b, CH30, CH31, CH32, CH33, and CH34) was reported previously (77); gene family analysis of the PGT series (PGT121 to -123, -125 to -128, -130, -131, -135 to -137, and -141 to -145) was reported previously using Kabat definition (69); the CDRH3 lengths were adjusted to the IMGT definition here for comparison.

c

Analysis of healthy donors was reported previously (76).

d

K, kappa chain.

e

L, lambda chain.

The most surprising finding of the current study is not that HIV-2 Env is highly immunogenic and elicits antibody responses to V3, V4, CD4bs, and CD4i, since HIV-1 Env does the same (11, 12, 13, 38, 76). Rather, the surprise is that these epitopes on the native HIV-2 Env trimer are accessible to antibody binding and neutralization (Fig. 7). This feature of primary HIV-2 strains is remarkably different from the Env properties of primary HIV-1 strains, where the native Env trimer is well guarded from antibody recognition by a nonredundant set of highly effective mechanisms that generally prevent broad and potent antibody neutralization (34, 48). These mechanisms include a dense glycan shield that is recognized by the human immune system as “self” and that blocks antibody access to underlying protein surfaces, an inverted tetrahedral trimer configuration where much of the nonglycosylated protein surface is inwardly directed and thus protected from antibodies by quaternary steric hindrance, hypervariability of peptide sequences that are surface exposed, and conformational masking that allows the unliganded trimer to undergo conformational fluctuations that minimize the stable presentation of antigenic surfaces, which become stabilized only following receptor engagement (32, 35, 48, 71, 79). How HIV-2 persists in vivo in the face of these potent and broadly reactive NAbs is unknown, but the possibility of cell-to-cell virus transmission has been suggested (31).

Fig 7.

Fig 7

Epitope mapping of the CG-I, CG-II, and CG-III groups on HIV-2 structural models. (A) A model of the gp120 molecule for HIV-2 primary strain 7312A is shown with highlighted V3, V4, CD4bs, CD4i, and α2 regions. Potential N-linked glycans are modeled as pink spheres. (B) Schematic of approximate locations of V3, V4, CD4bs, CD4i, and α2 on the Env trimer.

What could account for the enhanced antibody accessibility and sensitivity of HIV-2 compared to HIV-1? Clues may come from other comparisons between HIV-2 and HIV-1 Env glycoproteins. We previously noted that the relative sensitivities of HIV-2 and HIV-1 primary Envs to inhibition by sCD4 are quite different (31). We determined the IC50s of sCD4 for HIV-27312A (9 nM), HIV-2UC1 (3 nM), and HIV-2ST (25 nM) and found them to be well below the mean and median values (both greater than 100 nM) for a large number of HIV-1 transmitted/founder and primary chronic Envs (30). Importantly, laboratory-adapted strains of HIV-1, which generally exhibit enhanced sensitivity to NAbs, are also extremely sensitive to inhibition by sCD4 (IC50 < 1 nM). These findings suggest that the HIV-2 Env glycoprotein may exist in a conformational state more akin to those of laboratory-adapted strains of HIV-1 that lack the full benefits of conformational masking (32). Second, we performed a comparative analysis of Env sequences between many strains of HIV-1 and HIV-2 and found a significantly higher number of potential V4 glycosylation sites for a diverse set of HIV-1 strains (mean = 4.34; median = 4; range = 2 to 7) than for a panel of HIV-2 strains, including those used in this study (mean = 2.48; median = 2; range = 2 to 3; P < 0.0001; Mann-Whitney test) (31). Such a reduction in glycosylation in HIV-2 could result in a more open “glycan shield” surrounding V4, thereby allowing better antibody access and neutralization. This again is in agreement with previous studies in HIV-1, which showed that insertion of an epitope for a FLAG antibody into V4 of HIV-1, which presumably protruded beyond the glycan shield, resulted in potent virus neutralization by that antibody (51). This may explain the extraordinary potency of 1.7A and other CG-II MAbs.

The availability of a large panel of HIV-2/SIV-reactive neutralizing MAbs can facilitate structure, function, and antigenicity analyses of virus strains relevant to studies of SIV transmission and vaccine protection. Recently, we analyzed an SIVsmmE660 vaccine challenge stock (37) and Env clones derived from it for sensitivity to a number of the MAbs described in the present study, including those targeting V3 (6.10F), V4 (1.7A), CD4bs (6.10B), and CD4i (1.4H). Each of these MAbs potently neutralized the SIVsmmE660 isolate and the majority of Env clones derived from it with IC50 titers ranging from 0.001 to 1.0 μg/ml. Such analyses can be an important adjunct to vaccine protection studies using different SIV immunogens and challenge stocks going forward (74).

ACKNOWLEDGMENTS

We thank P. Crystal for manuscript preparation and the clinical and DNA sequencing core facilities of the University of Alabama at Birmingham and the University of Pennsylvania Centers for AIDS Research.

This work was supported by intramural funding to the Vaccine Research Center, NIAID, and by grants from the NIH (AI67854, AI88564, AI87383), and grants from the Bill and Melinda Gates Foundation.

Footnotes

Published ahead of print 29 August 2012

REFERENCES

  • 1. Bell CH, et al. 2008. Structure of antibody F425-B4e8 in complex with a V3 peptide reveals a new binding mode for HIV-1 neutralization. J. Mol. Biol. 375:969–978 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Binley JM, et al. 1996. Human antibody responses to HIV type 1 glycoprotein 41 cloned in phage display libraries suggest three major epitopes are recognized and give evidence for conserved antibody motifs in antigen binding. AIDS Res. Hum. Retroviruses 12:911–924 [DOI] [PubMed] [Google Scholar]
  • 3. Binley JM, et al. 2008. Profiling the specificity of neutralizing antibodies in a large panel of plasmas from patients chronically infected with human immunodeficiency virus type 1 subtypes B and C. J. Virol. 82:11651–11668 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Bohne-Lang A, von der Lieth CW. 2005. GlyProt: in silico glycosylation of proteins. Nucleic Acids Res. 33:W214–W219 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Calarese DA, et al. 2005. Dissection of the carbohydrate specificity of the broadly neutralizing anti-HIV-1 antibody 2G12. Proc. Natl. Acad. Sci. U. S. A. 102:13372–13377 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Calarese DA, et al. 2003. Antibody domain exchange is an immunological solution to carbohydrate cluster recognition. Science 300:2065–2071 [DOI] [PubMed] [Google Scholar]
  • 7. Cardoso RM, et al. 2005. Broadly neutralizing anti-HIV antibody 4E10 recognizes a helical conformation of a highly conserved fusion-associated motif in gp41. Immunity 22:163–173 [DOI] [PubMed] [Google Scholar]
  • 8. Chen B, et al. 2005. Structure of an unliganded simian immunodeficiency virus gp120 core. Nature 433:834–841 [DOI] [PubMed] [Google Scholar]
  • 9. Chen L, et al. 2009. Structural basis of immune evasion at the site of CD4 attachment on HIV-1 gp120. Science 326:1123–1127 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Cole KS, et al. 2001. Characterization of neutralization epitopes of simian immunodeficiency virus (SIV) recognized by rhesus monoclonal antibodies derived from monkeys infected with an attenuated SIV strain. Virology 290:59–73 [DOI] [PubMed] [Google Scholar]
  • 11. Davis KL, et al. 2009. Human immunodeficiency virus type 2 (HIV-2)/HIV-1 envelope chimeras detect high titers of broadly reactive HIV-1 V3-specific antibodies in human plasma. J. Virol. 83:1240–1259 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Davis KL, et al. 2009. High titer HIV-1 V3-specific antibodies with broad reactivity but low neutralizing potency in acute infection and following vaccination. Virology 387:414–426 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Decker JM, et al. 2005. Antigenic conservation and immunogenicity of the HIV coreceptor binding site. J. Exp. Med. 201:1407–1419 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. de Silva TI, et al. 2012. Potent autologous and heterologous neutralizing antibody responses occur in HIV-2 infection across a broad range of infection outcomes. J. Virol. 86:930–946 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Dhillon AK, et al. 2007. Dissecting the neutralizing antibody specificities of broadly neutralizing sera from human immunodeficiency virus type 1-infected donors. J. Virol. 81:6548–6562 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Doria-Rose NA, et al. 2009. Frequency and phenotype of human immunodeficiency virus envelope-specific B cells from patients with broadly cross-neutralizing antibodies. J. Virol. 83:188–199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Gao F, et al. 1999. Origin of HIV-1 in the chimpanzee Pan troglodytes troglodytes. Nature 397:436–441 [DOI] [PubMed] [Google Scholar]
  • 18. Gnanakaran S, et al. 2010. Genetic signatures in the envelope glycoproteins of HIV-1 that associate with broadly neutralizing antibodies. PLoS Comput. Biol. 6:e1000955 doi:10.1371/journal.pcbi.1000955 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Gray ES, et al. 2009. Broad neutralization of human immunodeficiency virus type 1 mediated by plasma antibodies against the gp41 membrane proximal external region. J. Virol. 83:11265–11274 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Gray ES, et al. 2009. Antibody specificities associated with neutralization breadth in plasma from human immunodeficiency virus type 1 subtype C-infected blood donors. J. Virol. 83:8925–8937 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Guan Y, et al. 2009. Discordant memory B cell and circulating anti-Env antibody responses in HIV-1 infection. Proc. Natl. Acad. Sci. U. S. A. 106:3952–3957 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Guillon C, et al. 1998. Coreceptor usage of human immunodeficiency virus type 2 primary isolates and biological clones is broad and does not correlate with their syncytium-inducing capacities. J. Virol. 72:6260–6263 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Guyader M, et al. 1987. Genome organization and transactivation of the human immunodeficiency virus type 2. Nature 326:662–669 [DOI] [PubMed] [Google Scholar]
  • 24. Hahn BH, Shaw GM, De Cock KM, Sharp PM. 2000. AIDS as a zoonosis: scientific and public health implications. Science 287:607–614 [DOI] [PubMed] [Google Scholar]
  • 25. Hu G, Liu J, Taylor KA, Roux KH. 2011. Structural comparison of HIV-1 envelope spikes with and without the V1/V2 loop. J. Virol. 85:2741–2750 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Huang CC, et al. 2005. Structure of a V3-containing HIV-1 gp120 core. Science 310:1025–1028 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Javaherian K, et al. 1994. Studies of the conformation-dependent neutralizing epitopes of simian immunodeficiency virus envelope protein. J. Virol. 68:2624–2631 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Jiang X, et al. 2010. Conserved structural elements in the V3 crown of HIV-1 gp120. Nat. Struct. Mol. Biol. 17:955–961 [DOI] [PubMed] [Google Scholar]
  • 29. Karwowska S, et al. 1992. Production of human monoclonal antibodies specific for conformational and linear non-V3 epitopes of gp120. AIDS Res. Hum. Retroviruses 8:1099–1106 [DOI] [PubMed] [Google Scholar]
  • 30. Keele BF, et al. 2008. Identification and characterization of transmitted and early founder virus envelopes in primary HIV-1 infection. Proc. Natl. Acad. Sci. U. S. A. 105:7552–7557 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Kong R, et al. 2012. Broad and potent neutralizing antibody responses elicited in natural HIV-2 infection. J. Virol. 86:947–960 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Kwong PD, et al. 2002. HIV-1 evades antibody-mediated neutralization through conformational masking of receptor-binding sites. Nature 420:678–682 [DOI] [PubMed] [Google Scholar]
  • 33. Kwong PD, Mascola JR, Nabel GJ. 2011. Rational design of vaccines to elicit broadly neutralizing antibodies to HIV-1. Cold Spring Harb. Perspect. Biol. 1:a007278 doi:10.1101/cshperspect.a007278 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Kwong PD, Wilson IA. 2009. HIV-1 and influenza antibodies: seeing antigens in new ways. Nat. Immunol. 10:573–578 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Kwong PD, et al. 1998. Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature 393:648–659 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Langedijk JP, Meloen RH, Taylor G, Furze JM, van Oirschot JT. 1997. Antigenic structure of the central conserved region of protein G of bovine respiratory syncytial virus. J. Virol. 71:4055–4061 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Letvin NL, et al. 2011. Immune and genetic correlates of vaccine protection against mucosal infection by SIV in monkeys. Sci. Transl. Med. 3:81ra36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Li Y, et al. 2007. Broad HIV-1 neutralization mediated by CD4-binding site antibodies. Nat. Med. 13:1032–1034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Liu J, Bartesaghi A, Borgnia MJ, Sapiro G, Subramaniam S. 2008. Molecular architecture of native HIV-1 gp120 trimers. Nature 455:109–113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. McClure MO, et al. 1987. HIV infection of primate lymphocytes and conservation of the CD4 receptor. Nature 330:487–489 [DOI] [PubMed] [Google Scholar]
  • 41. Moore JP, Sodroski J. 1996. Antibody cross-competition analysis of the human immunodeficiency virus type 1 gp120 exterior envelope glycoprotein. J. Virol. 70:1863–1872 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Morner A, et al. 1999. Primary human immunodeficiency virus type 2 (HIV-2) isolates, like HIV-1 isolates, frequently use CCR5 but show promiscuity in coreceptor usage. J. Virol. 73:2343–2349 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Musiani M, Gallinella G, Venturoli S, Zerbini M. 2007. Competitive PCR-ELISA protocols for the quantitative and the standardized detection of viral genomes. Nat. Protoc. 2:2511–2519 [DOI] [PubMed] [Google Scholar]
  • 44. Muster T, et al. 1993. A conserved neutralizing epitope on gp41 of human immunodeficiency virus type 1. J. Virol. 67:6642–6647 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Ozkaya Sahin G, et al. 2012. Potent intratype neutralizing activity distinguishes human immunodeficiency virus type 2 (HIV-2) from HIV-1. J. Virol. 86:961–971 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Palker TJ, et al. 1987. A conserved region at the COOH terminus of human immunodeficiency virus gp120 envelope protein contains an immunodominant epitope. Proc. Natl. Acad. Sci. U. S. A. 84:2479–2483 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Pancera M, et al. 2010. Structure of HIV-1 gp120 with gp41-interactive region reveals layered envelope architecture and basis of conformational mobility. Proc. Natl. Acad. Sci. U. S. A. 107:1166–1171 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Pantophlet R, Burton DR. 2006. GP120: target for neutralizing HIV-1 antibodies. Annu. Rev. Immunol. 24:739–769 [DOI] [PubMed] [Google Scholar]
  • 49. Pinter A. 2007. Roles of HIV-1 Env variable regions in viral neutralization and vaccine development. Curr. HIV Res. 5:542–553 [DOI] [PubMed] [Google Scholar]
  • 50. Reeves JD, Doms RW. 2002. Human immunodeficiency virus type 2. J. Gen. Virol. 83:1253–1265 [DOI] [PubMed] [Google Scholar]
  • 51. Ren X, Sodroski J, Yang X. 2005. An unrelated monoclonal antibody neutralizes human immunodeficiency virus type 1 by binding to an artificial epitope engineered in a functionally neutral region of the viral envelope glycoproteins. J. Virol. 79:5616–5624 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Roben P, et al. 1994. Recognition properties of a panel of human recombinant Fab fragments to the CD4 binding site of gp120 that show differing abilities to neutralize human immunodeficiency virus type 1. J. Virol. 68:4821–4828 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Robinson JE, et al. 1998. Production and characterization of SIV envelope-specific rhesus monoclonal antibodies from a macaque asymptomatically infected with a live SIV vaccine. AIDS Res. Hum. Retroviruses 14:1253–1262 [DOI] [PubMed] [Google Scholar]
  • 54. Robinson JE, Holton D, Pacheco-Morell S, Liu J, McMurdo H. 1990. Identification of conserved and variant epitopes of human immunodeficiency virus type 1 (HIV-1) gp120 by human monoclonal antibodies produced by EBV-transformed cell lines. AIDS Res. Hum. Retroviruses 6:567–579 [DOI] [PubMed] [Google Scholar]
  • 55. Sather DN, et al. 2009. Factors associated with the development of cross-reactive neutralizing antibodies during human immunodeficiency virus type 1 infection. J. Virol. 83:757–769 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Sato S, et al. 2008. Potent antibody-mediated neutralization and evolution of antigenic escape variants of simian immunodeficiency virus strain SIVmac239 in vivo. J. Virol. 82:9739–9752 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Scheid JF, et al. 2009. Broad diversity of neutralizing antibodies isolated from memory B cells in HIV-infected individuals. Nature 458:636–640 [DOI] [PubMed] [Google Scholar]
  • 58. Scheid JF, et al. 2011. Sequence and structural convergence of broad and potent HIV antibodies that mimic CD4 binding. Science 333:1633–1637 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Seaman MS, et al. 2010. Tiered categorization of a diverse panel of HIV-1 Env pseudoviruses for assessment of neutralizing antibodies. J. Virol. 84:1439–1452 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Sharp PM, Hahn BH. 2011. Origins of HIV and the AIDS pandemic. Cold Spring Harb. Perspect. Med. 1:a006841 doi:10.1101/cshperspect.a006841 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Sol N, et al. 1997. Usage of the coreceptors CCR-5, CCR-3, and CXCR-4 by primary and cell line-adapted human immunodeficiency virus type 2. J. Virol. 71:8237–8244 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Stamatatos L, Morris L, Burton DR, Mascola JR. 2009. Neutralizing antibodies generated during natural HIV-1 infection: good news for an HIV-1 vaccine? Nat. Med. 15:866–870 [DOI] [PubMed] [Google Scholar]
  • 63. Stanfield RL, Gorny MK, Williams C, Zolla-Pazner S, Wilson IA. 2004. Structural rationale for the broad neutralization of HIV-1 by human monoclonal antibody 447-52D. Structure 12:193–204 [DOI] [PubMed] [Google Scholar]
  • 64. Stanfield RL, Gorny MK, Zolla-Pazner S, Wilson IA. 2006. Crystal structures of human immunodeficiency virus type 1 (HIV-1) neutralizing antibody 2219 in complex with three different V3 peptides reveal a new binding mode for HIV-1 cross-reactivity. J. Virol. 80:6093–6105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Thali M, et al. 1993. Characterization of conserved human immunodeficiency virus type 1 gp120 neutralization epitopes exposed upon gp120-CD4 binding. J. Virol. 67:3978–3988 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Tiller T, et al. 2008. Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning. J. Immunol. Methods 329:112–124 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Timmerman P, Beld J, Puijk WC, Meloen RH. 2005. Rapid and quantitative cyclization of multiple peptide loops onto synthetic scaffolds for structural mimicry of protein surfaces. ChemBioChem 6:821–824 [DOI] [PubMed] [Google Scholar]
  • 68. Traggiai E, et al. 2004. An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nat. Med. 10:871–875 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Walker LM, et al. 2011. Broad neutralization coverage of HIV by multiple highly potent antibodies. Nature 477:466–470 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70. Walker LM, et al. 2009. Broad and potent neutralizing antibodies from an African donor reveal a new HIV-1 vaccine target. Science 326:285–289 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71. Wei X, et al. 2003. Antibody neutralization and escape by HIV-1. Nature 422:307–312 [DOI] [PubMed] [Google Scholar]
  • 72. Weiss RA, et al. 1988. HIV-2 antisera cross-neutralize HIV-1. AIDS 2:95–100 [DOI] [PubMed] [Google Scholar]
  • 73. White TA, et al. 2010. Molecular architectures of trimeric SIV and HIV-1 envelope glycoproteins on intact viruses: strain-dependent variation in quaternary structure. PLoS Pathog. 6:e1001249 doi:10.1371/journal.ppat.1001249 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74. Wu F, et al. 2012. Sequential evolution and escape from neutralization of simian immunodeficiency virus SIVsmE660 clones in rhesus macaques. J. Virol. 86:8835–8847 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75. Wu SR, et al. 2010. Single-particle cryoelectron microscopy analysis reveals the HIV-1 spike as a tripod structure. Proc. Natl. Acad. Sci. U. S. A. 107:18844–18849 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76. Wu X, et al. 2010. Rational design of envelope identifies broadly neutralizing human monoclonal antibodies to HIV-1. Science 329:856–861 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77. Wu X, et al. 2011. Focused evolution of HIV-1 neutralizing antibodies revealed by structures and deep sequencing. Science 333:1593–1602 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. Wyatt R, et al. 1998. The antigenic structure of the HIV gp120 envelope glycoprotein. Nature 393:705–711 [DOI] [PubMed] [Google Scholar]
  • 79. Wyatt R, Sodroski J. 1998. The HIV-1 envelope glycoproteins: fusogens, antigens, and immunogens. Science 280:1884–1888 [DOI] [PubMed] [Google Scholar]
  • 80. Yeh WW, et al. 2010. Autologous neutralizing antibodies to the transmitted/founder viruses emerge late after simian immunodeficiency virus SIVmac251 infection of rhesus monkeys. J. Virol. 84:6018–6032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81. Zhou T, et al. 2010. Structural basis for broad and potent neutralization of HIV-1 by antibody VRC01. Science 329:811–817 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82. Zhou T, et al. 2007. Structural definition of a conserved neutralization epitope on HIV-1 gp120. Nature 445:732–737 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83. Zolla-Pazner S. 2005. Improving on nature: focusing the immune response on the V3 loop. Hum. Antibodies 14:69–72 [PubMed] [Google Scholar]
  • 84. Zwick MB, et al. 2005. Anti-human immunodeficiency virus type 1 (HIV-1) antibodies 2F5 and 4E10 require surprisingly few crucial residues in the membrane-proximal external region of glycoprotein gp41 to neutralize HIV-1. J. Virol. 79:1252–1261 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85. Zwick MB, et al. 2001. Broadly neutralizing antibodies targeted to the membrane-proximal external region of human immunodeficiency virus type 1 glycoprotein gp41. J. Virol. 75:10892–10905 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES