Abstract
A multicenter survey, carried out in 2010 in Argentina, showed an increased prevalence of extended-spectrum β-lactamase (ESBL)-producing enterobacteria, with some changes in the molecular epidemiology of circulating ESBLs. While enzymes of the CTX-M-2 group remain endemic, the emergence of CTX-M-15 and of enzymes of the CTX-M-8 and CTX-M-9 groups was observed. The CTX-M-15-positive isolates represented 40% of CTX-M producers and included representatives of Escherichia coli ST131 and Klebsiella pneumoniae ST11.
TEXT
Extended-spectrum cephalosporin resistance in enterobacteria is mostly mediated by extended-spectrum β-lactamases (ESBLs). Among them, the CTX-M-type ESBLs (initially reported in the second half of the 1980s) are the most prevalent enzymes worldwide (5, 6). To date, the CTX-M family of enzymes comprises at least 124 allotypes, subclassified by amino acid similarities into six sublineages, namely, CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9, CTX-M-25, and CTX-M-45 (http://www.lahey.org/Studies/) (23).
Since its first detection, CTX-M-2 has become the most prevalent ESBL in Argentina, and enzymes of the CTX-M-2 group have been the only CTX-Ms reported in this country (21, 22).
In this work, we report the results of a recent multicenter survey conducted to analyze the prevalence and nature of ESBLs in Argentina, which showed a notable evolution in the molecular epidemiology of circulating enzymes.
A total of 1,586 consecutive and nonrepetitive enterobacterial clinical isolates were recovered during October 2010 from patients at 15 community hospitals distributed in three different regions of Argentina: (i) Ciudad Autónoma de Buenos Aires (CABA) (n = 5) and Buenos Aires (n = 2), (ii) Santa Fe (n = 4), and (iii) Chubut (n = 4). Isolates were identified by both conventional and automated methods (Vitek; bioMérieux). Antimicrobial susceptibility tests were performed by the disk diffusion method according to the Clinical and Laboratory Standards Institute (CLSI) (9). ESBL confirmatory tests were performed by synergy tests using cefotaxime (CTX) and ceftazidime (CAZ) compared to CTX-clavulanic acid and CAZ-clavulanic acid-containing disks (10) for all noninducible AmpC-producing enterobacteria. In inducible AmpC producers, ESBL detection was performed using cefepime (FEP) compared to FEP-clavulanic acid-containing disks (M. Quinteros, M. Radice, P. Power, M. Matteo, M. Mollerach, J. Di Conza, N. Costa, and G. Gutkind, presented at the International Congress on Beta-Lactamases, L'Aquila, Italy, 1999). Screening for AmpC β-lactamases was assayed using a 300-μg phenyl boronic acid-containing disk placed 2 cm from the CAZ-containing disks (25).
Two hundred seven isolates exhibiting inhibition zones for CTX of ≤27 mm and/or CAZ of ≤22 mm were collected during the study period (13.1% of all screened enterobacterial isolates) (Table 1). Reduced susceptibility to expanded-spectrum cephalosporins was higher than the 9% observed in a surveillance study performed in Buenos Aires in 2003 (P < 0.05) (21), even if in that study only microorganisms recovered from inpatients were considered, while in the present study, samples recovered from both inpatients and outpatients were included.
Table 1.
Number of isolates of each species recovered within the study period, extended-spectrum cephalosporin resistance, and number of resistant isolates that were further studied
| Species | No. of isolates | No. (%) of ESCa-resistant isolates | ESC-resistant isolates recovered within 1 wk |
|
|---|---|---|---|---|
| No. of isolates | No. of ESBL producers/AmpC producers | |||
| Escherichia coli | 1,120 | 64 (5.7) | 16 | 14/2 |
| Klebsiella pneumoniae | 193 | 87 (45.1) | 22 | 22/0 |
| Proteus mirabilis | 115 | 14 (12.2) | 6 | 5/1 |
| Enterobacter cloacae | 37 | 11 (29.7) | 3 | 1/2 |
| Morganella morganii | 29 | 11 (37.9) | ||
| Klebsiella oxytoca | 20 | 6 (30) | 4 | 4/0 |
| Citrobacter freundii | 18 | 5 (27.8) | ||
| Serratia spp. | 18 | 5 (27.8) | 3 | 3/0 |
| Providencia spp. | 13 | 2 (15.4) | 1 | 1/0 |
| Citrobacter spp. | 8 | – | ||
| Proteus vulgaris | 7 | 2 (28.6) | ||
| Enterobacter aerogenes | 3 | |||
| Salmonella sp. | 2 | |||
| Shigella spp. | 2 | |||
| Proteus penneri | 1 | |||
| Total | 1,586 | 207 (13.1) | 55 | 50/5 |
ESC, extended-spectrum cephalosporin.
Confirmatory tests for ESBL production were performed with all of the isolates exhibiting reduced susceptibility to expanded-spectrum cephalosporins collected during the first week of the study (n = 55). This sample was considered to be representative of the whole study period, since the relative frequencies of the most prevalent species were similar during the whole month of study (Table 1). The molecular epidemiology of ESBL determinants was investigated in all confirmed ESBL-producing isolates (n = 50). The remaining 5 isolates were high-level AmpC producers (Table 1). Molecular detection of ESBL genes was conducted by PCR amplification using alkaline lysis-extracted total genomic DNA as the template and the primers listed in Table 2. Amplicons were sequenced in both strands using an ABI Prism 3700 DNA sequencer.
Table 2.
Primers used in this study
| Name | Sequence (5′→3′) | Reference |
|---|---|---|
| CTX-M-group-1F | GTTACAATGTGTGAGAAGCAG | 17 |
| CTX-M-group-1R | AACGGAATGAGTTTCCCCATT | 17 |
| CTX-M-group-2F | ACCAGGCTCAATTGTGGA | This study |
| CTX-M-group-2R | AGATGAGGGTTCGTTGCAA | This study |
| CTX-M-group-8F | CACGGATTCAATTTTCAGGAG | 3 |
| CTX-M-group-8R | GAGCGCTCCACATTTTTTAG | 3 |
| CTX-M-group-9F | GTTACAATGTGTGAGAAGCAG | 17 |
| CTX-M-group-9R | CAGCCAGAAAGTTATGGAG | This study |
| CTX-M-group-25F | GGATGATGAGAAAAAGCGTAAGGC | This study |
| CTX-M-group-25R | GGACTAATAACCGTCGGTGAC | This study |
Of the 50 ESBL producers, 47 were found to carry CTX-M-type determinants (94%) and the simultaneous presence of two different blaCTX-M determinants have been observed in 2 of them. Among the CTX-M producers, CTX-M-2 group determinants were found in 26 isolates (55%; 25 CTX-M-2 and 1 CTX-M-56), CTX-M-1 group determinants in 19 isolates (40%; all CTX-M-15), CTX-M-9 group determinants in 3 isolates (6%; all CTX-M-14), and CTX-M-8 group determinants in 1 isolate (2%; CTX-M-8) (Table 3).
Table 3.
CTX-M-producing enterobacteria collected during a 1-week studya in 15 hospitals distributed in different regions of Argentina
| Species (no. of isolates) | ESBL determinant(s) (no. of isolates) |
|---|---|
| Klebsiella pneumoniae (21) | blaCTX-M-15 (10) |
| blaCTX-M-2 (9) | |
| blaCTX-M-2 + blaCTX-M-15 (1) | |
| blaCTX-M-8 (1) | |
| Escherichia coli (13) | blaCTX-M-15 (7) |
| blaCTX-M-14 (3) | |
| blaCTX-M-2 (3) | |
| Proteus mirabilis (5) | blaCTX-M-2 (4) |
| blaCTX-M-56 (1) | |
| Klebsiella oxytoca (4) | blaCTX-M-2 (3) |
| blaCTX-M-2 + blaCTX-M-15 (1) | |
| Serratia spp. (3) | blaCTX-M-2 (3) |
| Providencia spp. (1) | blaCTX-M-2 (1) |
October 2010.
Although CTX-M enzymes remain the most prevalent ESBL determinants, the dominance of CTX-M-2 reported previously (21) was diluted by the emergence and remarkable spread of CTX-M-15 and, to a lesser extent, by the emergence of other CTX-M groups. The emergence of CTX-M-15 was observed in both Escherichia coli and Klebsiella spp.
The genetic environments surrounding the most prevalent CTX-M determinants, blaCTX-M-2 and blaCTX-M-15, were investigated by PCR mapping and sequencing. The blaCTX-M-2 gene was always located downstream of an ISCR1 element, as previously described (1, 13). Different genetic environments were found surrounding blaCTX-M-15: in 13 isolates, it was associated with a complete ISEcp1 located 48 bp upstream of blaCTX-M-15, in agreement with the worldwide genetic context named “the international blaCTX-M-15 genetic environment” (GenBank accession no. NC013121.1); in 5 isolates, blaCTX-M-15 was associated with a truncated ISEcp1 (still conserving a complete promoter), as recently described in the United Kingdom (GenBank accession no. HQ157353) (11) (Table 4).
Table 4.
Genotypic characterization of CTX-M-15-producing E. coli and K. pneumoniae isolates
| Species and isolate | City | Hospitala | Phylogenetic group | Clone | Genetic context of blaCTX-M-15b |
|---|---|---|---|---|---|
| E. coli | |||||
| CM2 | Buenos Aires | H6 | B2 | Ec1 | II |
| L4 | Buenos Aires | H3 | B2 | Ec2 | I |
| M1 | Buenos Aires | H7 | A | Ec3 | II |
| SM4 | Buenos Aires | H8 | A | Ec4 | II |
| SM5 | Buenos Aires | H8 | A | Ec5 | I |
| T1 | Chubut | H13 | B2 | Ec2 | I |
| T3 | Chubut | H13 | B2 | Ec6 | I |
| K. pneumoniae | |||||
| B4 | Buenos Aires | H4 | NDc | Kp2 | I |
| CL1 | Buenos Aires | H1 | ND | Kp3 | I |
| CL4 | Buenos Aires | H1 | ND | Kp1 | I |
| CL6 | Buenos Aires | H1 | ND | Kp7 | II |
| CL9 | Buenos Aires | H1 | ND | Kp4 | I |
| CM4 | Buenos Aires | H6 | ND | Kp1 | I |
| CV1 | Buenos Aires | H7 | ND | Kp5 | II |
| I3 | Santa Fe | H5 | ND | Kp1 | I |
| I4 | Santa Fe | H5 | ND | Kp1 | I |
| L5 | Buenos Aires | H3 | ND | Kp6 | I |
| T8 | Chubut | H13 | ND | Kp8 | I |
H1, Hospital de Clínicas, Universidad de Buenos Aires; H3, Hospital Alemán, Ciudad Autónoma de Buenos Aires (CABA); H4, Hospital Británico, CABA; H5, Hospital Iturraspe, Santa Fe; H6, CEMIC, CABA; H7, Sanatorio Mater Dei, CABA; H8, Hospital Eva Perón, Buenos Aires; H13, Hospital de Trelew, Chubut.
I, international blaCTX-M-15 genetic environment (GenBank accession no. NC013121.1; II, truncated ISEcp1-blaCTX-M-15 genetic environment (GenBank accession no. HQ157353) (11).
ND, not determined.
To investigate the dissemination of CTX-M-15, we performed a genotype analysis of the isolates producing this CTX-M variant (7 E. coli and 11 K. pneumoniae isolates). Genotyping was performed by determination of the four main E. coli phylogenetic groups (7) and by PCR-based fingerprinting using random amplification of polymorphic DNA (RAPD) with the 1290 decamer (19) and repetitive extragenic palindromic PCR (REP-PCR) (16). (Isolates were assigned to a same clone when identical band profiles were obtained with the two PCR-based fingerprinting methods.) Clonal heterogeneity was observed among both E. coli and K. pneumoniae isolates (Table 4). All of the CTX-M-15-producing E. coli isolates belonging to phylogenetic group B2 (n = 4) were identified as ST131 by the PCR-based method proposed by Clermont et al. (8) and confirmed by multilocus sequence typing (MLST) [http://mlst.ucc.ie/mlst/dbs/Ecoli/documents/primersColi_html] with two E. coli isolates (L4 and CM2). Moreover, MLST analysis of the CTX-M-15-producing K. pneumoniae isolates (12) assigned the most prevalent clone (Kp1, including 4 isolates circulating in both Buenos Aires and Santa Fe) to sequence type 11 (ST11) (Table 4).
Nowadays, it is worth noting that although some of the CTX-M enzymes have been associated with specific countries, such as CTX-M-9 and CTX-M-14 in Spain (14, 18), CTX-M-1 in Italy (4), and CTX-M-2 in Israel, Japan, and most South American countries (6, 21), others, such as CTX-M-15, have been detected worldwide (2, 4, 15, 20). The present data indicate that the cosmopolitan CTX-M-15 ESBL is becoming widespread also in Argentina and is often associated with clones distributed worldwide, such as E. coli ST131 and K. pneumoniae ST11 (24), further underscoring the dissemination potential of this enzyme. The new epidemiological scenario may have followed an allodemic rather than an epidemic pattern, reflecting the dissemination of both multiple clones and/or several mobile genetic elements.
ACKNOWLEDGMENTS
This work was financed, in part, by grants from UBACYT to M.R. and G.G. and from ANPCYT to G.G.
We thank the members of the working group (all in Argentina) for their assistance: A. Famiglietti (Hospital de Clínicas, Universidad de Buenos Aires), M. Nastro (Hospital de Clínicas, Universidad de Buenos Aires), C. Vay (Hospital de Clínicas, Universidad de Buenos Aires, and Sanatorio Mater Dei, CABA), G. Pagniez (Corporación Medica de San Martín, Buenos Aires), L. F. Canigia (Hospital Alemán, CABA), M. Giovanakis (Hospital Británico, CABA), F. Argaraña (Hospital Iturraspe, Santa Fe), J. Smayevsky (CEMIC, CABA), F. Nicola (Hospital Eva Perón, Buenos Aires), R. Cittadini (Sanatorio Mater Dei, CABA), M. Almuzara (Hospital Eva Perón, Buenos Aires), E. Mendes (Hospital Cullen, Santa Fe), S. Virgolini (Hospital de Niños C. Alassia, Santa Fe), D. Mutti (Hospital SAMCO, Villa Constitución, Santa Fe), V. Cusin (Hospital de Rawson, Chubut), D. Berry (Hospital de Trelew), and F. Aguirre (Sanatorio Trelew and Clínica San Miguel, Trelew, Chubut).
Footnotes
Published ahead of print 20 August 2012
REFERENCES
- 1. Arduino SM, et al. 2002. blaCTX-M-2 is located in an unusual class 1 integron (In35) which includes Orf513. Antimicrob. Agents Chemother. 46:2303–2306 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Bado I, et al. 2010. Detection of class 1 and 2 integrons, extended-spectrum β-lactamases and qnr alleles in enterobacterial isolates from the digestive tract of intensive care unit inpatients. Int. J. Antimicrob. Agents 36:453–458 [DOI] [PubMed] [Google Scholar]
- 3. Bartoloni A, et al. 9 February 2012. Relentless increase of resistance to fluoroquinolones and expanded-spectrum cephalosporins in Escherichia coli: 20 years of surveillance in resource-limited settings from Latin America. Clin. Microbiol. Infect. [Epub ahead of print.] doi:10.1111/j.1469-0691.2012.03807.x [DOI] [PubMed] [Google Scholar]
- 4. Brigante G, et al. 2005. Evolution of CTX-M-type β-lactamases in isolates of Escherichia coli infecting hospital and community patients. Int. J. Antimicrob. Agents 25:157–162 [DOI] [PubMed] [Google Scholar]
- 5. Bush K. 2010. Alarming β-lactamase-mediated resistance in multidrug-resistant Enterobacteriaceae. Curr. Opin. Microbiol. 13:558–564 [DOI] [PubMed] [Google Scholar]
- 6. Canton R, Coque TM. 2006. The CTX-M β-lactamase pandemic. Curr. Opin. Microbiol. 9:466–475 [DOI] [PubMed] [Google Scholar]
- 7. Clermont O, Bonacorsi S, Bingen E. 2000. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 66:4555–4558 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Clermont O, et al. 2009. Rapid detection of the O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15-producing strains. J. Antimicrob. Chemother. 64:274–277 [DOI] [PubMed] [Google Scholar]
- 9. Clinical and Laboratory Standards Institute 2011. Performance standards for antimicrobial disk susceptibility tests. Supplement M02-A10. CLSI, Wayne, PA [Google Scholar]
- 10. Clinical and Laboratory Standards Institute 2011. Performance standards for antimicrobial susceptibility testing; twenty-first informational supplement M100-S21. Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
- 11. Dhanji H, et al. 2011. Variation in the genetic environments of blaCTX-M-15 in Escherichia coli from the faeces of travellers returning to the United Kingdom. J. Antimicrob. Chemother. 66:1005–1012 [DOI] [PubMed] [Google Scholar]
- 12. Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S. 2005. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J. Clin. Microbiol. 43:4178–4182 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Di Conza J, Ayala JA, Power P, Mollerach M, Gutkind G. 2002. Novel class 1 integron (InS21) carrying blaCTX-M-2 in Salmonella enterica serovar Infantis. Antimicrob. Agents Chemother. 46:2257–2261 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Hernandez JR, Martinez-Martinez L, Canton R, Coque TM, Pascual A. 2005. Nationwide study of Escherichia coli and Klebsiella pneumoniae producing extended-spectrum β-lactamases in Spain. Antimicrob. Agents Chemother. 49:2122–2125 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Lavollay M, et al. 2006. Clonal dissemination of a CTX-M-15 β-lactamase-producing Escherichia coli strain in the Paris area, Tunis, and Bangui. Antimicrob. Agents Chemother. 50:2433–2438 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Lim KT, Yasin R, Yeo CC, Puthucheary S, Thong KL. 2009. Characterization of multidrug resistant ESBL-producing Escherichia coli isolates from hospitals in Malaysia. J. Biomed. Biotechnol. 2009:165637 doi:10.1155/2009/165637 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Mugnaioli C, et al. 2005. Dissemination of CTX-M-type extended-spectrum β-lactamase genes to unusual hosts. J. Clin. Microbiol. 43:4183–4185 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Novais A, et al. 2006. Dissemination and persistence of blaCTX-M-9 are linked to class 1 integrons containing CR1 associated with defective transposon derivatives from Tn402 located in early antibiotic resistance plasmids of IncHI2, IncP1-α, and IncFI groups. Antimicrob. Agents Chemother. 50:2741–2750 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Pacheco AB, et al. 1997. Random amplification of polymorphic DNA reveals serotype-specific clonal clusters among enterotoxigenic Escherichia coli strains isolated from humans. J. Clin. Microbiol. 35:1521–1525 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Pallecchi L, et al. 2007. Rapid dissemination and diversity of CTX-M extended-spectrum β-lactamase genes in commensal Escherichia coli isolates from healthy children from low-resource settings in Latin America. Antimicrob. Agents Chemother. 51:2720–2725 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Quinteros M, et al. 2003. Extended-spectrum β-lactamases in Enterobacteriaceae in Buenos Aires, Argentina, public hospitals. Antimicrob. Agents Chemother. 47:2864–2869 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Radice M, Power P, Di Conza J, Gutkind G. 2002. Early dissemination of CTX-M-derived enzymes in South America. Antimicrob. Agents Chemother. 46:602–604 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Rossolini GM, D'Andrea MM, Mugnaioli C. 2008. The spread of CTX-M-type extended-spectrum β-lactamases. Clin. Microbiol. Infect. 1:33–41 [DOI] [PubMed] [Google Scholar]
- 24. Woodford N, Turton JF, Livermore DM. 2011. Multiresistant Gram-negative bacteria: the role of high-risk clones in the dissemination of antibiotic resistance. FEMS Microbiol. Rev. 35:736–755 [DOI] [PubMed] [Google Scholar]
- 25. Yagi T, et al. 2005. Practical methods using boronic acid compounds for identification of class C β-lactamase-producing Klebsiella pneumoniae and Escherichia coli. J. Clin. Microbiol. 43:2551–2558 [DOI] [PMC free article] [PubMed] [Google Scholar]