Skip to main content
PMC home page
Plant Physiology logoLink to Plant Physiology
. 1998 Aug;117(4):1165–1170. doi: 10.1104/pp.117.4.1165

RNA Polymerase Subunits Encoded by the Plastid rpo Genes Are Not Shared with the Nucleus-Encoded Plastid Enzyme1

Germán Serino 1, Pal Maliga 1,*
PMCID: PMC34880  PMID: 9701572

Abstract

Plastid genes in photosynthetic higher plants are transcribed by at least two RNA polymerases. The plastid rpoA, rpoB, rpoC1, and rpoC2 genes encode subunits of the plastid-encoded plastid RNA polymerase (PEP), an Escherichia coli-like core enzyme. The second enzyme is referred to as the nucleus-encoded plastid RNA polymerase (NEP), since its subunits are assumed to be encoded in the nucleus. Promoters for NEP have been previously characterized in tobacco plants lacking PEP due to targeted deletion of rpoB (encoding the β-subunit) from the plastid genome. To determine if NEP and PEP share any essential subunits, the rpoA, rpoC1, and rpoC2 genes encoding the PEP α-, β′-, and β"-subunits were removed by targeted gene deletion from the plastid genome. We report here that deletion of each of these genes yielded photosynthetically defective plants that lack PEP activity while maintaining transcription specificity from NEP promoters. Therefore, rpoA, rpoB, rpoC1, and rpoC2 encode PEP subunits that are not essential components of the NEP transcription machinery. Furthermore, our data indicate that no functional copy of rpoA, rpoB, rpoC1, or rpoC2 that could complement the deleted plastid rpo genes exists outside the plastids.

At least two distinct RNA polymerases are involved in the transcription of plastid genes in photosynthetic higher plants. One of these contains homologs of the Escherichia coli enzyme, including the α-, β-, β′-, and β"-subunits encoded in the plastid rpoA, rpoB, rpoC1, and rpoC2 genes, and is referred to as PEP. The promoters for PEP are reminiscent of the E. coli ς70-type promoters, and have two conserved hexameric blocks of sequences (TTGACA or “-35” element; TATAAT or “−10” element) 17 to 19 nucleotides apart. Transcription from PEP promoters initiates 5 to 7 nucleotides downstream of the “−10” promoter element (Igloi and Kössel, 1992; Gruissem and Tonkyn, 1993; Link, 1996). Promoter specificity to PEP is conferred by nuclear-encoded ς-like factors (Isono et al., 1997; Tanaka et al., 1997).

Several reports indicate the existence of a second, NEP activity (Morden et al., 1991; Hess et al., 1993; Allison et al., 1996). A candidate for NEP is an approximately 110-kD protein that has properties similar to the mitochondrial and phage T3/T7 RNA polymerases that may be part of a larger complex (Lerbs-Mache, 1993; Hedtke et al., 1997). NEP promoters share a loose, 10-nucleotide consensus, ATAGAATA/GAA, overlapping the transcription-initiation site, which is reminiscent of promoters recognized by the mitochondrial and phage T3/T7 RNA polymerases (Hajdukiewicz et al., 1997; Hübschmann and Börner, 1998; for review, see Maliga, 1998).

Plastid RNA polymerase activities with distinct sensitivities to inhibitors are present in higher plants in multisubunit complexes (Pfannschmidt and Link, 1994). Sharing of essential subunits of RNA polymerases has been reported in yeast (Sentenac et al., 1992). Therefore, plastid NEP and PEP could be part of the same complex. To test if NEP and PEP share any essential subunits, the rpo genes encoding PEP subunits were removed by targeted gene deletion from the plastid genome. Study of promoter activity in plastids lacking the rpoB gene has shown that the PEP β-subunit is essential for PEP transcription activity, but it is not required for transcription by NEP (Allison et al., 1996; Hajdukiewicz et al., 1997).

This study addresses the contribution of the rpoA, rpoC1, and rpoC2 genes to transcription from PEP and NEP promoters. We report here that deletion of each of these genes yields photosynthetically defective plants that lack PEP activity while maintaining transcription from NEP promoters. Therefore, rpoA, rpoB, rpoC1, and rpoC2 encode essential PEP subunits that are not components of the NEP transcription machinery. Furthermore, no functional copy of the rpo genes that could complement the deleted plastid rpo genes exists outside the plastid.

MATERIALS AND METHODS

Plasmid Construction

Plasmid pGS95 carries the tobacco (Nicotiana tabacum) ptDNA HincII fragment (sites are at nucleotides 78990–82117 in the ptDNA) (Shinozaki et al., 1986), cloned into the EcoRV site of a pBSKS+ (Stratagene) plasmid derivative with the ScaI site removed. The BglII/ScaI fragment (sites are at positions 80549 and 81466) containing the rpoA-coding region was replaced by a chimeric spectinomycin-resistance gene (aadA) from plasmid pOVZ34 as a BamHI/SmaI fragment (note that the BamHI and BglII ends are compatible). Plasmid pOVZ34 is a pUC119 plasmid derivative and carries the aadA gene in a psbA cassette as in plastid vector pOVZ15 (Zoubenko et al., 1994).

Plasmid pGS97 carries the PstI/Psp1406I ptDNA fragment (sites are at nucleotides 20283 and 25662) cloned into PstI/AccI-digested pBSIIKS+ plasmid (Stratagene). Note that AccI and Psp1406I ends are compatible. In the cloned ptDNA fragment most of the rpoC1-coding region is contained between AccI sites at positions 21797 and 23840. The rpoC1-coding region between the indicated AccI sites was replaced with a chimeric aadA gene as a BspHI/Acc65I fragment (ends were rendered blunt with T4 DNA polymerase) from plasmid pOVZ11, a pUC118 plasmid derivative. The pOVZ11 plasmid carries the Prrn::aadA::TpsbA chimeric gene in plastid vector pPRV112 (Zoubenko et al., 1994).

Plasmid pGS99 carries the tobacco ptDNA SacI fragment (sites are at nucleotides 15662 and 22658) cloned into SacI-digested pBSIIKS+ plasmid (Stratagene). The rpoC2-coding region was excised as a StuI/BsrGI fragment (sites are at nucleotides 17397 and 21048) and replaced with the chimeric aadA gene (BspHI/Acc65I fragment) from plasmid pOVZ11, as described for pGS97.

Plastid Transformation

Tungsten particles were coated with pGS95, pGS97, or pGS99 plasmid DNA and introduced into plastids of tobacco leaves with a particle-delivery system (PDS1000He, Bio-Rad) (Svab and Maliga, 1993). Transgenic shoots were regenerated on spectinomycin-containing (500 μg/mL) RMOP medium containing Murashige and Skoog salts (Murashige and Skoog, 1962), 3% Suc, 1.0 mg/L 6-benzylaminopurine, and 0.1 mg/L naphthaleneacetic acid (Svab et al., 1990). White sectors lacking rpo genes were identified in variegated leaves during propagation on antibiotic-free plant maintenance (RM) medium (Murashige and Skoog salts and 3% Suc; Murashige and Skoog, 1962). Uniformly transformed white shoots were regenerated from white sectors in spectinomycin-free RMOP medium. The ΔrpoB plants were described previously (Allison et al., 1996).

DNA and RNA Gel Blots

Total leaf DNA (Mettler, 1987) was digested with restriction endonucleases and electrophoresed in 0.7% agarose gels (3 μg per lane). For the RNA gel blots, total leaf RNA was extracted using the TRIzol reagent (GIBCO-BRL) and electrophoresed in 1% agarose/formaldehyde gels (5 μg of RNA per lane). RNA and DNA gels were transferred to N-Hybond membranes (Amersham) with the PosiBlot Transfer apparatus (Stratagene). Nucleic acid hybridization was carried out for 3 or more h at 65°C in Rapid Hybridization buffer (Amersham) with [32P]dCTP-labeled double-stranded DNA probes synthesized by random priming (Boehringer-Mannheim). The following gene probes were used: 16SrDNA, EcoRI/EcoRV fragment, sites are at nucleotides 138447 and 140855 in the tobacco ptDNA; atpB, PCR amplified with primers GCAGGAGCAGGGTCGGTCAAATC and GAGAGGAATGGAAGTGATTGACA (fragment ends are at nucleotides 55751–56512 of the tobacco ptDNA); clpP, fragment PCR amplified with primers GAGGGAATGCTAGACG and GACTTTATCGAGAAAG (ends are at nucleotides 73340–73621 of the tobacco ptDNA); rbcL, BamHI fragment (restriction sites are at nucleotides 58047–59285 of the tobacco ptDNA); accD, fragment PCR amplified with primers GGATTTAGGGGCGAA and GTGATTTTCTCTCCG (ends are at nucleotides 60211–60875 of the tobacco ptDNA); cytoplasmic 25S rRNA gene, fragment PCR amplified with primers TCACCTGCCGAATCAACTAGC and GACTTCCCTTGCCTACATTG.

Primer-Extension Reactions

Reactions were carried out with 10 μg of total leaf RNA (Allison and Maliga, 1995) using the following primers: 16SrDNA, TTCATAGTTGCATTACTTATAGCTTC (5′ nucleotide complementary to 102757); clpP, GGGACTTTTGGAACACCAATAGGCAT (5′ at nucleotide 74479); rbcL, ACTTGCTTTAGTCTCTGTTTGTGGTGACAT (5′ nucleotide complementary to 57616); accD, ccgagcTCTTATTTCCTATCAGACTAAGC (5′ nucleotide complementary to 59758); and atpB, CCCCAGAACCAGAAGTAGTAGGATTGA (5′ nucleotide at 56736).

The primers listed above were previously used to map transcription-initiation sites of these genes (Allison et al., 1996; Hajdukiewicz et al., 1997). Lowercase nucleotides are nonplastidic sequences. The position of RNA 5′ ends was determined using these same primers and homologous DNA templates as the reference. Sequence ladders were generated with the Sequenase II kit (Amersham).

RESULTS

Targeted Deletion of rpoA, rpoC1, and rpoC2 from the Plastid Genome Yields Pigment-Deficient Plants

To construct vectors for targeted deletion of the rpo genes, ptDNA fragments were cloned in Bluescript plasmids. Subsequently, the rpo-coding region in the cloned ptDNA fragment was replaced by a selectable spectinomycin-resistance gene (aadA) (Fig. 1, A–C). The size of the deletion in the targeting plasmids was: rpoA, 90% of the coding region; rpoC1, 63% of the coding region (80% of the 3′ exon); and rpoC2, 73% of the coding region. The transforming DNA was introduced into tobacco chloroplasts in leaf cells by the biolistic process. Targeted deletion of the rpo genes was achieved by replacement of the coding region with aadA as the result of two homologous recombination events via the flanking ptDNA sequences (Fig. 1, A–C). Culture of the bombarded leaf segments on spectinomycin-containing RMOP medium facilitated shoot regeneration with transformed plastid genomes. Since the chimeric aadA gene is transcribed by PEP, cells carrying only knockout plastid genomes are sensitive to spectinomycin. Therefore, the developing green shoots and calli contained plastids with a mixed population of knockout plastid genomes expressing aadA, and wild-type plastid genomes expressing the targeted rpo subunit gene (Fig. 2A). To facilitate formation of homoplasmic sectors, the shoots regenerating on the leaf segments were excised and transferred onto antibiotic-free plant maintenance medium. Plastid genome sorting in developing shoots facilitated formation of chimeric leaves, with white sectors containing a uniform population of knockout plastid genomes and green sectors with wild-type ptDNA (Fig. 2B). A second cycle of shoot regeneration from the white sectors yielded white plants (Fig. 2C). These plants carry a uniform population of transformed ptDNA lacking rpoA (Fig. 1, A and D), rpoC1 (Fig. 1, B and D), or rpoC2 (Fig. 1, C and D).

Figure 1.

Figure 1

Open in a new tab

Targeted deletion of rpo genes from the plastid genome. A, Deletion of the rpoA gene. Homologous recombination events (hatched lines) between ptDNA sequences in vector pGS95 and the tobacco plastid genome yields a genome lacking rpoA. Probes for Southern blots in D are marked with thick horizontal lines. Map position of the probed restriction fragments with size in kilobases is shown below the maps. aadA, Chimeric spectinomycin resistance gene (Svab and Maliga, 1993); rpoA, rpoB, rpoC1, and rpoC2, the plastid genes encoding the α-, β-, β′-, and β"-subunits of PEP, respectively; atpI, petD, rps2, and rps11, plastid genes (Shinozaki et al., 1986). Restriction endonuclease cleavage sites: H, HincII; X, XbaI; Bg, BglII; Sc, ScaI; P, PstI; B, BamHI; Pp, Psp1406I; A, AccI; SI, SacI; SII, SacII; StI, StuI; E, EcoRV; Bs, BsrGI. Brackets indicate restriction sites eliminated during cloning. B, Deletion of the rpoC1 gene. Homologous recombination events (crossed lines) between ptDNA sequences in vector pGS97 and the tobacco plastid genome yields a genome lacking rpoC1. C, Deletion of the rpoC2 gene. Homologous recombination events (crossed lines) between ptDNA sequences in vector pGS99 and the tobacco plastid genome yields a genome lacking rpoC2. D, Southern probing demonstrates a uniform population of transformed plastid genomes. Total cellular DNA was isolated from the leaves of plants transformed with plasmids pGS95 (targeting rpoA), pGS97 (targeting rpoC1), and pGS99 (targeting rpoC2), and from wild-type green leaves (WT). Data are shown for two independently transformed lines (pGS95-2, pGS95-3), or two plants derived from the same transformation event (pGS97-2.2, pGS97-2.3 and pGS99-4.1, pGS99-4.4).

Figure 2.

Figure 2

Open in a new tab

Isolation of homoplasmic ΔrpoA plants. A, Callus and shoots carrying a mixed population of wild-type and ΔrpoA plastid genomes are green. B, Chimeric leaves with white (transgenic) and green (wild-type) sectors. C, White, homoplasmic ΔrpoA plant with transgenomes only.

Plastid Transcript Accumulation Pattern Is Similar in All Plastid rpo-Deleted Mutants

Deletion of genes for essential PEP subunits prevents assembly of functional PEP enzyme. In the absence of PEP activity, mRNAs will accumulate at significant levels only from NEP promoters. The mRNAs initiating from PEP promoters will be absent. However, transcripts for genes with PEP promoters only may be present at low levels due to read-through transcription from upstream NEP promoters and processing (Allison et al., 1996; Hajdukiewicz et al., 1997). We expect that if NEP and PEP share a subunit, deletion of the relevant rpo gene should prevent mRNA accumulation from both PEP and NEP promoters. Therefore, steady-state mRNA level in the Δrpo plants was determined for a number of plastid genes (Fig. 3). The rbcL gene in tobacco plastids is transcribed from a PEP promoter. Accumulation of rbcL mRNA in each of the rpo deletion derivatives at significantly reduced (25-fold lower) levels is consistent with the lack of transcription from the PEP promoter, and with the accumulation of processed read-through transcripts (Allison et al., 1996). The atpB, 16SrDNA, and clpP genes have both PEP and NEP promoters (Allison et al., 1996; Hajdukiewicz et al., 1997). High steady-state levels of mRNAs for each of these genes in the Δrpo plants is consistent with sustained NEP promoter activity. The accD gene in tobacco is transcribed from a NEP promoter from which mRNA accumulation in wild-type chloroplasts is low, while it is highly elevated in ΔrpoB plants (Hajdukiewicz et al., 1997). Accumulation of accD mRNA in the rpoA, rpoC1, and rpoC2 deletion derivatives is elevated as in the ΔrpoB plants (Fig. 3). Sustained NEP activity in the rpo-deleted plants indicates the lack of contribution of the PEP α-, β′-, and β"-subunit to NEP function.

Figure 3.

Figure 3

Open in a new tab

Accumulation of plastid mRNAs in wild-type and plastid rpo gene deletion derivatives. Data are shown for genes carrying only PEP promoters (rbcL), only NEP promoters (accD), or PEP and NEP promoters (clpP, 16S rDNA, atpB) in wild-type, ΔrpoA, ΔrpoB, ΔrpoC1, and ΔrpoC2 leaves. The excess of wild-type over Δrpo intensities (average of the four Δrpo lines) for each probe is given in parentheses. Gel blots were prepared with total leaf RNA (5 μg per lane) from wild-type plants, and in plants transformed with plasmids pGS95 (ΔrpoA), pGS97 (ΔrpoC1), and pGS99 (ΔrpoC2). Upper panels show blots probed for plastid genes. Lower panels show loading controls, obtained by probing the same filters for the cytoplasmic 25S rRNA. The blots were scanned with a phosphor imager (Molecular Dynamics, Sunnyvale, CA). Hybridization signals were quantified with Imagequant software (Molecular Dynamics) and normalized to the 25S rRNA signal.

Promoter Utilization Is Identical in All rpo Deletion Lines

Many of the plastid genes have multiple promoters. Therefore, it was important to show which of the promoters are active in the Δrpo plants. Transcription activity from previously characterized NEP and PEP promoters was determined by mapping transcript 5′ ends with primer-extension analysis.

The photosynthetic rbcL gene is transcribed from a single PEP promoter (PrbcL-182 in wild-type tobacco chloroplasts [Shinozaki and Sugiura, 1982]). This promoter is not active in the rpo-deletion derivatives (Fig. 4). The 5′ end at position −59 (indicated by ✂ in Fig. 4) derives from longer transcripts by processing in both wild-type and Δrpo mutants (Mullet et al., 1985; Allison et al., 1996). The atpB gene in wild-type tobacco is transcribed from four promoters (Fig. 4; Hajdukiewicz et al., 1997). The PatpB-255, PatpB-488/-502, and PatpB-611 PEP promoters are active in the wild-type, but not in the Δrpo plants (Fig. 4). In contrast, the PatpB-289 NEP promoter is active in the leaves of wild-type and Δrpo plants. The tobacco rRNA operon (rrn) has one promoter for each of the two RNA polymerases (Vera and Sugiura, 1995; Allison et al., 1996). The PEP promoter initiates transcription 113 and 114 bp upstream of the mature 16SrRNA in wild-type leaves, whereas it is inactive in the rpo-deleted plants. In contrast, the Prrn-62 NEP promoter is inactive in wild-type leaves, but active in the rpo deletion derivatives (Fig. 4). The clpP gene is transcribed from four promoters (Hajdukiewicz et al., 1997; fig. 5B). Although the PEP transcript (PclpP-95) is absent in all rpo-deleted lines, the activity of the three NEP promoters (PclpP-53, PclpP-173, PclpP-511) is evident in the Δrpo mutants (Fig. 4; Hajdukiewicz et al., 1997). Finally, accD has one NEP promoter. This promoter, located 129 bp upstream of the accD- coding region (Hajdukiewicz et al., 1997), is active in the lines deficient in the PEP α-, β-, β′-, and β"-E. coli-like subunits (Fig. 4). In summary, the PEP promoters (six tested) were inactive, whereas transcription initiated at the same position from each of the six NEP promoters tested in the rpoA-, rpoB-, rpoC1-, and rpoC2-deletion derivatives.

Figure 4.

Figure 4

Open in a new tab

Mapping of transcription-initiation sites in plastids of wild-type and rpo-deletion derivatives. Primer-extension data are shown for the rbcL, atpB, 16SrDNA, clpP, and accD genes. Mapped NEP (•) and PEP (○) promoters are identified by the distance between the transcription-initiation site and the translation-initiation codon (ATG) in nucleotides (Allison et al., 1996; Hajdukiewicz et al., 1997). Processing sites are also marked (✂). Schematic maps with transcription-initiation sites for NEP and PEP promoters are shown at the bottom of the figure.

DISCUSSION

The first successful targeted deletion of a plastid RNA polymerase subunit gene was that of rpoB from the tobacco plastid genome (Allison et al., 1996). We report here deletion of the genes for the remaining core subunits of the plastid-encoded RNA polymerase (rpoA, rpoC1, and rpoC2). We propose that deletion of the rpo genes from the plastid genome is possible because NEP, an alternative, nucleus-encoded enzyme transcribes all essential housekeeping and metabolic genes. Attempts at targeted deletion of the plastid rpoB1, rpoB2, or rpoC2a genes in the unicellular alga Chlamydomonas reinhardtii failed to yield homoplasmic cells lacking PEP (Rochaix, 1997). Therefore, C. reinhardti may not have NEP, or it may have NEP but transcription of at least some of the essential genes is dependent on PEP. NEP promoters are active in the liverwort Marchantia polymorpha and the conifer Pinus contorta, indicating duplication of the plastid-transcription machinery early during the evolution of the land plants (D. Silhavy and P. Maliga, unpublished data).

Deletion of the plastid rpo genes in this study led to the loss of transcription from ς70-type PEP promoters and to a mutant phenotype. These findings indicate that subunits of the E. coli-like plastid RNA polymerase are the products of plastid genes and that no functional copy of the rpo genes exists outside the plastids, which could complement the deleted-plastid rpo genes. Our experiments extend the earlier work of Bogorad and coworkers, who provided evidence for the contribution of the plastid rpo genes to the plastid RNA polymerase activity by sequencing the N-terminal amino acids of a purified maize RNA polymerase (Hu and Bogorad, 1990; Hu et al., 1991). Contribution of plastid rpo genes to plastid RNA polymerase activity was also shown by the sensitivity of in vitro transcription to antibodies obtained in rabbits immunized with fusion peptides expressed from genes containing rpo gene segments (Little and Hallick, 1988).

We report here that deletion of the plastid-encoded PEP subunit genes does not affect NEP transcription specificity, so PEP subunits are not shared with NEP. The α-subunit gene could be deleted without interfering with the expression of other plastid genes since rpoA is the last open reading frame of the rpl23 operon. Interpretation of data in plants lacking the β"-subunit gene was also unambiguous, since rpoC2 is the last gene of the rpoB operon. rpoC1 is the second gene of the rpoB operon, which, after deletion of rpoC1, consists of three genes: rpoB, aadA (replacing rpoC1), and rpoC2. Since polycistronic mRNAs are efficiently translated on the plastid ribosomes (Staub and Maliga, 1995), it is likely that deletion of rpoC1 does not interfere with the expression of the downstream rpoC2 gene. Furthermore, deletion of rpoC1 could only affect the expression of rpoC2 already shown to be nonessential for NEP activity. Transcription of the rpoB operon initiates 345 nucleotides upstream of rpoB (nucleotide position 27846 in the plastid genome; G. Serino and P. Maliga, unpublished data). In the previously described ΔrpoB plant (Allison et al., 1996), expression of the entire rpoB operon should be affected since the deletion included the operon promoter. Therefore, the ΔrpoC2, ΔrpoC1, and ΔrpoB plants form a series lacking the β" (ΔrpoC2), β′ and possibly β" (ΔrpoC1), and β, β′, and β" (ΔrpoB) PEP subunits. Collectively, these data indicate that none of the PEP subunits is part of the NEP complex. Identification of NEP subunits will depend on purification of the NEP enzyme and development of an in vitro transcription assay. Important steps in this direction were the cloning of the gene for a 113-kD protein, the likely catalytic subunit of NEP (Hedtke et al., 1997), and identification of promoters recognized by the NEP-transcription machinery (Allison et al., 1996; Hajdukiewicz et al., 1997; Hübschmann and Börner, 1998).

Abbreviations:

NEP

nuclear-encoded plastid RNA polymerase

PEP

plastid-encoded plastid RNA polymerase

ptDNA

plastid DNA

Footnotes

1

This research was supported by the National Science Foundation (grant no. MCB96-30763). G.S. was the recipient of a Johanna and Charles Busch Predoctoral Fellowship award.

LITERATURE  CITED

  1. Allison A, Simon D, Maliga P. Deletion of rpoB reveals a second distinct transcription system in plastids of higher plants. EMBO J. 1996;15:2802–2809. [PMC free article] [PubMed] [Google Scholar]
  2. Allison LA, Maliga P. Light-responsive and transcription-enhancing elements regulate the plastid psbD core promoter. EMBO J. 1995;14:3721–3730. doi: 10.1002/j.1460-2075.1995.tb00042.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Gruissem W, Tonkyn JC. Control mechanisms of plastid gene expression. Crit Rev Plant Sci. 1993;12:19–55. [Google Scholar]
  4. Hajdukiewicz PTJ, Allison LA, Maliga P. The two RNA polymerases encoded by the nuclear and the plastid compartments transcribe distinct groups of genes in tobacco plastids. EMBO J. 1997;16:4041–4048. doi: 10.1093/emboj/16.13.4041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Hedtke B, Börner T, Weihe A. Mitochondrial and chloroplast phage-type RNA polymerases in Arabidopsis. Science. 1997;277:809–811. doi: 10.1126/science.277.5327.809. [DOI] [PubMed] [Google Scholar]
  6. Hess WR, Prombona A, Fieder B, Subramanian AR, Börner T. Chloroplast rps15 and the rpoB/C1/C2 gene cluster are strongly transcribed in ribosome-deficient plastids: evidence for a functioning non-chloroplast-encoded RNA polymerase. EMBO J. 1993;12:563–571. doi: 10.1002/j.1460-2075.1993.tb05688.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Hu J, Bogorad L. Maize chloroplast RNA polymerase: the 180-, 120-, and 38-kilodalton polypeptides are encoded in chloroplast genes. Proc Natl Acad Sci USA. 1990;87:1531–1535. doi: 10.1073/pnas.87.4.1531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Hu J, Troxler RF, Bogorad L. Maize chloroplast RNA polymerase: the 78-kilodalton polypeptide is encoded by the plastid rpoC1 gene. Nucleic Acids Res. 1991;19:3431–3434. doi: 10.1093/nar/19.12.3431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hübschmann T, Börner T. Characterization of transcription initiation sites in ribosome-deficient barley plastids. Plant Mol Biol. 1998;36:493–496. doi: 10.1023/a:1005924502336. [DOI] [PubMed] [Google Scholar]
  10. Igloi GL, Kössel H. The transcriptional apparatus of chloroplasts. Crit Rev Plant Sci. 1992;10:525–558. [Google Scholar]
  11. Isono K, Shimizu M, Yoshimoto K, Niwa Y, Satoh K, Yokota A, Kobayashi H. Leaf-specifically expressed genes for polypeptides destined for chloroplasts with domains for ς70 factors of bacterial RNA polymerases in Arabidopsis thaliana. Proc Natl Acad Sci USA. 1997;94:14948–14953. doi: 10.1073/pnas.94.26.14948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lerbs-Mache S. The 110-kDa polypeptide of spinach plastid DNA-dependent RNA polymerase: single-subunit enzyme or catalytic core of multimeric enzyme complexes? Proc Natl Acad Sci USA. 1993;90:5509–5513. doi: 10.1073/pnas.90.12.5509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Link G. Green life: control of chloroplast gene transcription. Bioessays. 1996;18:465–471. [Google Scholar]
  14. Little MC, Hallick RB. Chloroplast rpoA, rpoB, and rpoC genes specify at least three components of a chloroplast DNA-dependent RNA polymerase active in tRNA and mRNA transcription. J Biol Chem. 1988;263:14302–14307. [PubMed] [Google Scholar]
  15. Maliga P. Two plastid RNA polymerases of higher plants: an evolving story. Trends Plant Sci. 1998;3:4–6. [Google Scholar]
  16. Mettler IJ. A simple and rapid method for minipreparation of DNA from tissue cultured plant cells. Plant Mol Biol Rep. 1987;5:346–349. [Google Scholar]
  17. Morden CW, Wolfe KH, dePamphilis CW, Palmer JD. Plastid translation and transcription in a non-photosynthetic plant: intact, missing and pseudo genes. EMBO J. 1991;10:3281–3288. doi: 10.1002/j.1460-2075.1991.tb04892.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Mullet JE, Orozco EM, Chua NH. Multiple transcripts for higher plant rbcL and atpB genes and localization of the transcription initiation site of the rbcL gene. Plant Mol Biol. 1985;4:39–54. doi: 10.1007/BF02498714. [DOI] [PubMed] [Google Scholar]
  19. Murashige T, Skoog F. A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant. 1962;15:493–497. [Google Scholar]
  20. Pfannschmidt T, Link G. Separation of two classes of plastid DNA-dependent RNA polymerases that are differentially expressed in mustard (Sinapis alba L.) seedlings. Plant Mol Biol. 1994;25:69–81. doi: 10.1007/BF00024199. [DOI] [PubMed] [Google Scholar]
  21. Rochaix JD. Chloroplast reverse genetics: new insights into the function of plastid genes. Trends Plant Sci. 1997;2:419–425. [Google Scholar]
  22. Sentenac A, Riva M, Thuriaux P, Buhler JM, Treich I, Carles C, Werner M, Ruet A, Huet J, Mann C . and others. Yeast RNA polymerase subunits and genes. In: Yamamoto KR, McKnight SL, editors. Transcriptional Regulation. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1992. pp. 27–54. [Google Scholar]
  23. Shinozaki K, Ohme M, Tanaka M, Wakasugi T, Hayashida N, Matsubayashi T, Zaita N, Chunwongse J, Obokata J, Yamaguchi-Shinozaki K and others. The complete nucleotide sequence of the tobacco chloroplast genome: its gene organization and expression. EMBO J. 1986;5:2043–2049. doi: 10.1002/j.1460-2075.1986.tb04464.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Shinozaki K, Sugiura M. The nucleotide sequence of the tobacco chloroplast gene for the largest subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase. Gene. 1982;20:91–102. doi: 10.1016/0378-1119(82)90090-7. [DOI] [PubMed] [Google Scholar]
  25. Staub JM, Maliga P. Expression of a chimeric uidA gene indicates that polycistronic mRNAs are efficiently translated in tobacco plastids. Plant J. 1995;7:845–848. doi: 10.1046/j.1365-313x.1995.07050845.x. [DOI] [PubMed] [Google Scholar]
  26. Svab Z, Hajdukiewicz PTJ, Maliga P. Stable transformation of plastids in higher plants. Proc Natl Acad Sci USA. 1990;87:8526–8530. doi: 10.1073/pnas.87.21.8526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Svab Z, Maliga P. High-frequency plastid transformation in tobacco by selection for a chimeric aadA gene. Proc Natl Acad Sci USA. 1993;90:913–917. doi: 10.1073/pnas.90.3.913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Tanaka K, Tozawa Y, Mochizuki N, Shinozaki K, Nagatani A, Wakasa K, Takahashi H. Characterization of three cDNA species encoding plastid RNA polymerase sigma factors in Arabidopsis thaliana: evidence for the sigma factor heterogeneity in higher plant plastids. FEBS Lett. 1997;413:309–313. doi: 10.1016/s0014-5793(97)00906-x. [DOI] [PubMed] [Google Scholar]
  29. Vera A, Sugiura M. Chloroplast rRNA transcription from structurally different tandem promoters: an additional novel-type promoter. Curr Genet. 1995;27:280–284. doi: 10.1007/BF00326161. [DOI] [PubMed] [Google Scholar]
  30. Zoubenko OV, Allison LA, Svab Z, Maliga P. Efficient targeting of foreign genes into the tobacco plastid genome. Nucleic Acids Res. 1994;22:3819–3824. doi: 10.1093/nar/22.19.3819. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Plant Physiology are provided here courtesy of Oxford University Press

RESOURCES