Skip to main content
NCBI home page
Vector Borne and Zoonotic Diseases logoLink to Vector Borne and Zoonotic Diseases
. 2012 Nov;12(11):938–941. doi: 10.1089/vbz.2012.0996

Rickettsia Species in Ticks Removed from Humans in Istanbul, Turkey

Aysen Gargili 1, Ana M Palomar 2, Kenan Midilli 3, Aránzazu Portillo 2, Sırrı Kar 4, José A Oteo 2,✉
PMCID: PMC3491622  PMID: 22925016

Abstract

A total of 167 ticks collected from humans in Istanbul (Turkey) in 2006 were screened for Rickettsia species, and nested PCRs targeting gltA and ompA rickettsial fragment genes were carried out. Rickettsia monacensis (51), R. aeschlimannii (8), R. conorii subsp. conorii (3), R. helvetica (2), R. raoultii (1), R. africae (1), R. felis (1), and other Rickettsia spp. (2), were detected. To our knowledge, these Rickettsia species (except R. conorii) had never been reported in ticks removed from humans in Turkey. The presence of R. africae also had not been previously described, either in Hyalomma ticks or in any European tick species. In addition, R. aeschlimannii and R. felis had not been found associated with Rhipicephalus bursa specimens. The presence of human pathogenic Rickettsia in ticks removed from humans provides information about the risk of tick-borne rickettsioses in Turkey.

Key Words: Rickettsia species, Turkey, Ticks from humans.

Introduction

Rickettsia species are gram-negative intracellular bacteria that cause severe human disease worldwide. Human rickettsioses include the spotted fever group (SFG) diseases, which are mainly transmitted by hard ticks (Hechemy et al. 2006). In Turkey, ticks that bite humans belong to the genera Ixodes, Hyalomma, Dermacentor, Rhipicephalus, and Haemaphysalis (Vatansever et al. 2008; Bursali et al. 2010, 2011; Karaer et al. 2011). Species of these genera have been recognized as vectors and reservoirs of Rickettsia spp. (Parola et al. 2005; Hechemy et al. 2006;). However, to date, only Mediterranean spotted fever (MSF), caused by Rickettsia conorii, has been reported from humans in Turkey (Kuloglu et al. 2004). Autochthonous SFG rickettsioses have been described in Europe: MSF, lymphangitis-associated rickettsioses (LAR), Dermacentor-borne necrosis erythema lymphadenopathy (DEBONEL)/tick-borne lymphadenopathy (TIBOLA), Rickettsia massiliae infection, Rickettsia helvetica infection, and Rickettsia monacensis infection (Oteo and Portillo 2012). In addition, African tick-bite fever (ATBF) and Rickettsia aeschlimannii infection have been considered imported rickettsioses (from Africa). The location of Turkey, an Eurasian country close to Africa (Fig. 1), as well as its abundance and diversity of ticks (Aydin and Bakirci 2007; Vatansever et al. 2008), makes this country a suitable place for the circulation of tick-borne pathogens. The aim of this study was to investigate the presence of Rickettsia spp. in ticks that bite humans in the area of Istanbul.

FIG. 1.

FIG. 1.

Open in a new tab

Map of Europe showing the location of Istanbul.

Materials and Methods

In 2006, a total of 1054 ticks were removed from humans in more than 25 hospitals in Istanbul (Turkey), as part of a project supported by the Ministry of Health, Istanbul Branch (Vatansever et al. 2008). Among them, 167 were randomly chosen for this study. The ticks were classified by taxonomic keys (Walker et al. 2003; Apanaskevich 2003; Estrada-Peña et al. 2004). In addition, specimens whose phenotypic classification was not conclusive were also classified by genotypic methods (PCR of the 16S rDNA gene; Black and Piesman 1994). DNA was individually extracted with the Qiagen Dneasy blood/tissue kit (Qiagen, Hilden, Germany), according to the manufacturer's tissue protocol instructions. DNA extracts were used as templates for PCR assays targeting the 16S rDNA gene for tick classification as cited above, as well as the rickettsial citrate synthase (gltA), and 190-kDa protein antigen (ompA) genes. PCR primer pairs, size of the amplicons (bp), and annealing temperatures of the assays, are shown in Table 1. Two negative controls, one of them with template DNA but without primers, and the other with primers and containing water instead of template DNA, as well as positive controls (a tick extract and Rickettsia slovaca, respectively) were included in all PCR assays. Rickettsia spp. were screened by gltA PCR. Positive samples were further tested by ompA PCR, and the obtained amplicons were sequenced for the differentiation of the SFG rickettsia species. However, gltA amplicons were only sequenced from samples that yielded negative PCR results for ompA. Nucleotide sequences were compared with those available in GenBank using the National Center for Biotechnology Information (NCBI; Bethesda, MD) Basic Local Alignment Sequence Tool (BLAST) search engine (http://blast.ncbi.nlm.nih.gov/blast.cgi).

Table 1.

PCR Primer Pairs Used in This Study

  Gene target Primer name Primer sequence 5’→3’ Amplified fragment (bp) Annealing temperature (°C) Reference
Tick species 16S rRNA 16S+1 CTGCTCAATGATTTTTTAAATTGCTGTGG 456 48 Black and Piesman 1994
    16S–1 CCGGTCTGAACTCAGATCAAGT   54  
Rickettsia spp. ompA (semi-nested) Rr190.70p ATGGCGAATATTTCTCCAAAA 631 46 Regnery et al. 1991; Roux et al. 1996
    Rr190.701n GTTCCGTTAATGGCAGCATCT      
    Rr190.70p ATGGCGAATATTTCTCCAAAA 532 48  
    Rr190.602n AGTGCAGCATTCGCTCCCCCT      
  gltA central region (nested) RpCS.877p GGGGGCCTGCTCACGGCGG 381 48 Regnery et al. 1991; Choi et al. 2005
    RpCS1258n ATTGCAAAAAGTACAGTGAACA      
    RpCS.896p GGCTAATGAAGCAGTGATAA 337 54  
    RpCS.1233n GCGACGGTATACCCATAGC      
Open in a new tab

Results

Studied ticks belonged to the following species: Ixodes ricinus (n=130), Rhipicephalus sanguineus group (n=19), Hyalomma aegyptium (n=11), Hyalomma spp. (n=4), Hyalomma marginatum (n=2), and Dermacentor marginatus (n=1). Sixty-nine out of 167 samples (41.3%) tested positive for the presence of Rickettsia spp. Table 2 shows details about the Rickettsia species detected and Rickettsia-infected tick species, as well as the highest percentages of identity with a validly-published Rickettsia species. According to ompA nucleotide sequences, R. monacensis, which was detected in 49 I. ricinus (70%) ticks, was the most prevalent genospecies. On the one hand, R. aeschlimannii was found in 8 tick specimens (12%): 5 H. aegyptium, 2 H. marginatum, and 1 Rhipicephalus bursa. On the other hand, R. conorii subsp. conorii was detected in 3 R. bursa (4%) specimens, whereas R. africae, R. felis, and R. raoultii appeared in 1 H. aegyptium, 1 R. bursa, and 1 D. marginatus, specimens, respectively. According to gltA nucleotide sequences (from samples with negative ompA PCR results), R. helvetica (n=2; 3%), and R. monacensis (n=2; 3%), were detected in 4 I. ricinus ticks. In addition, 2 specimens of the Rhipicephalus genus harbored unidentified Rickettsia spp. that showed gltA sequences with the same percentage of identity with more than one validly-published rickettsia. These sequences shared 99.7% identity with R. raoultii (DQ365804), R. aeschlimannii (U59722), Rickettsia japonica (U59724), or Rickettsia heilongjiangensis (AF178034), among other rickettsia species. Unfortunately, analysis of alternative genes to identify rickettsial species could not be performed, since all DNA was used to investigate other tick-borne bacteria (data not shown).

Table 2.

Genospecies of Rickettsia Species Detected in Ticks by Nucleotide Sequence Analysis of ompA or gltA PCR Products (n=69)

Rickettsia species (number) Tick species (number of each stage) Sequenced amplicon % identity GenBank ID
R. monacensis (51) Ixodes ricinus (13N-35F-1M) ompA 99.2–100 AF201329
  I. ricinus (2F) gltA 100 AY048817
R. aeschlimannii (8) Hyalomma aegyptium (4N-1M) ompA 98.3–100 U43800
  Hyalomma marginatum (1N-1F) ompA 99.8 U43800
  Rhipicephalus bursa (1M) ompA 98.3 U43800
R. conorii subsp. conorii (3) R. bursa (2F-1M) ompA 100 U45244
R. africae (1) H. aegyptium (1N) ompA 99.3 U43790
R. felis (1) R. bursa (1M) ompA 100 AF210694
R. raoultii (1) Dermacentor marginatus (1N) ompA 99.4 DQ365801
R. helvetica (2) Ixodes ricinus (2F) gltA 100 U59723
Rickettsia spp. (2) Rhipicephalus sanguineus (1M) gltA 99.7 a
  R. bursa (1N) gltA 99.7 a
Open in a new tab
a

Same identity with more than one validly published Rickettsia species.

The GenBank accession numbers as well as the highest percentages of identity with Rickettsia species are also included.

N, nymph; F, female; M, male.

Discussion

To date, R. conorii was the unique confirmed tick-borne rickettsia species known in Turkey (Kuloglu et al. 2004). Thus cases of MSF have been reported from this country, and R. conorii has been amplified in ticks by PCR (Kuloglu et al. 2004). Our study confirms this fact, as well as the circulation of other rickettsias different from R. conorii in ticks removed from humans in Istanbul. We report here the presence of these pathogenic tick-borne bacteria: R. conorii subsp. conorii, R. monacensis, R. aeschlimannii, R. helvetica, R. raoultii, R. africae, and R. felis.

In this study, we have found R. conorii subsp. conorii in R. bursa specimens attached to humans. This tick species belongs to the same group as R. sanguineus, which is the current vector of MSF. These tick species can be easily confused, since their morphological differentiation at some stages is still unclear. The detection of R. conorii subsp. conorii in R. bursa corroborates data from a previous study with ticks collected on livestock in Turkey (Christova et al. 2003). We think that R. bursa could also be a vector of R. conorii, since we have observed R. bursa attached to patients who subsequently developed MSF (Oteo and Portillo 2012). Furthermore, our data have shown the presence of R. helvetica and R. monacensis in I. ricinus ticks. These rickettsia species, mainly transmitted by I. ricinus, have been associated with MSF-like diseases previously reported in Europe (Nilsson et al. 1999; Fournier et al. 2000; Jado et al. 2007). In addition, I. ricinus is the most prevalent tick species attached to humans in Istanbul analyzed in our study (Vatansever et al. 2008). According to our data, R. raoultii has been amplified in D. marginatus. This rickettsia species had previously been detected in Dermacentor reticulatus and D. marginatus that bit humans who developed R. slovaca-like infection or TIBOLA/DEBONEL symptoms (Mediannikov et al. 2008). Moreover, we have found R. aeschlimannii in H. aegyptium and H. marginatum, as previously reported, as well as in one R. bursa specimen. To our knowledge, this is the first detection of R. aeschlimannii in R. bursa, although this rickettsia had been amplified in Rhipicephalus spp. (Bitam et al. 2009; Mediannikov et al. 2010). Human infection by R. aeschlimannii was first reported in Africa (Raoult et al. 2002), and it has been associated with European ticks, although there are no recognized endemic cases of the disease (Oteo et al. 2005; Oteo and Portillo 2012).

Our data have revealed the presence of R. felis in R. bursa. Molecular evidence of R. felis in ticks has been previously reported (Reif et al. 2009), but not in R. bursa or in ticks collected in Europe. Nevertheless, fleas are the only known vector of this potential tick-borne pathogen.

R. africae is responsible for ATBF, an infection that has been reported in Africa, and as an imported disease in Europe (Jensenius et al. 2003; Oteo et al. 2004). Until now, R. africae had been associated with Amblyomma and Rhipicephalus species (Kelly et al. 1996; Portillo et al. 2007; Mediannikov et al. 2010). In our study, we found R. africae in H. aegyptium. This tick species is not a known vector of R. africae, but our results demonstrate the circulation of this rickettsial pathogen in the studied environment.

All rickettsia species found in this study are associated with human disease. The presence of several tick-borne pathogens, their vectors, and reservoirs, as well as the evidence of human tick bites, suggest that some of these tick-borne infections are circulating in Turkey and may be misdiagnosed. This information should be taken into account for the correct diagnosis and treatment of tick-borne infections in Turkey.

Acknowledgments

Tick collection and identification studies were supported by TUBITAK-SBAG (108S171). Detection of Rickettsia species was supported by a grant from the “Instituto de Salud Carlos III” (EMER 07/033), and Ministerio de Ciencia e Innovación (Spain). Fundación Rioja Salud awarded a grant to A.M. Palomar for her doctoral thesis (FRS/PIF-01/10).

Author Disclosure Statement

No competing financial interests exist.

References

  1. Apanaskevich DA. The diagnostics of Hyalomma (Hyalomma) aegyptium (Acari: Ixodidae) [in Russian] Parazitologiia. 2003;37:47–59. [PubMed] [Google Scholar]
  2. Aydin L. Bakirci S. Geographical distribution of ticks in Turkey. Parasitol Res. 2007;101(Suppl 2):S163–S166. doi: 10.1007/s00436-007-0694-5. [DOI] [PubMed] [Google Scholar]
  3. Bitam I. Kernif T. Harrat Z, et al. First detection of Rickettsia aeschlimannii in Hyalomma aegyptium from Algeria. Clin Microbiol Infect. 2009;15(Suppl 2):253–254. doi: 10.1111/j.1469-0691.2008.02274.x. [DOI] [PubMed] [Google Scholar]
  4. Black WC. Piesman J. Phylogeny of hard and soft tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc Natl Acad Sci USA. 1994;91:10034–10038. doi: 10.1073/pnas.91.21.10034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bursali A. Tekin S. Keskin A, et al. Species diversity of ixodid ticks feeding on humans in Amasya, Turkey: seasonal abundance and presence of Crimean-Congo hemorrhagic fever virus. J Med Entomol. 2011;48:85–93. doi: 10.1603/me10034. [DOI] [PubMed] [Google Scholar]
  6. Bursali A Tekin S Orhan M Keskin A et al. Ixodid ticks (Acari: Ixodidae) infesting humans in Tokat Province of Turkey: species diversity and seasonal activity. J Vector Ecol. 2010;35:180–186. doi: 10.1111/j.1948-7134.2010.00045.x. [DOI] [PubMed] [Google Scholar]
  7. Choi YJ. Jang WJ. Kim JY, et al. Spotted fever group and typhus group rickettsioses in humans, South Korea. Emerg Infect Dis. 2005;11:237–244. doi: 10.3201/eid1102.040603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Christova I. Van De Pol J. Yazar S, et al. Identification of Borrelia burgdorferi sensu lato, Anaplasma and Ehrlichia species, and spotted fever group rickettsiae in ticks from Southeastern Europe. Eur J Clin Microbiol Infect Dis. 2003;22:535–542. doi: 10.1007/s10096-003-0988-1. [DOI] [PubMed] [Google Scholar]
  9. Estrada-Peña A. Bouattour A. Camicas JL, et al. Ticks of Domestic Animals in the Mediterranean Region. A Guide of Identification of Species. 1st. Zaragoza (Spain): University of Zaragoza Press; 2004. [Google Scholar]
  10. Fournier PE. Grunnenberger F. Jaulhac B, et al. Evidence of Rickettsia helvetica infection in humans, eastern France. Emerg Infect Dis. 2000;6:389–392. doi: 10.3201/eid0604.000412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hechemy KE. Oteo JA. Raoult D, et al. A century of rickettsiology: emerging, reemerging rickettsioses, clinical, epidemiologic, and molecular diagnostic aspects and emerging veterinary rickettsioses: an overview. Ann NY Acad Sci. 2006;1078:1–14. doi: 10.1196/annals.1374.001. [DOI] [PubMed] [Google Scholar]
  12. Jado I. Oteo JA. Aldámiz M, et al. Rickettsia monacensis and human disease, Spain. Emerg Infect Dis. 2007;13:1405–1407. doi: 10.3201/eid1309.060186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Jensenius M. Fournier PE. Kelly P, et al. African tick bite fever. Lancet Infect Dis. 2003;3:557–564. doi: 10.1016/s1473-3099(03)00739-4. [DOI] [PubMed] [Google Scholar]
  14. Karaer Z. Guven E. Nalbantoglu S, et al. Ticks on humans in Ankara, Turkey. Exp Appl Acarol. 2011;54:85–91. doi: 10.1007/s10493-010-9417-1. [DOI] [PubMed] [Google Scholar]
  15. Kelly PJ. Beati L. Mason PR, et al. Rickettsia africae sp. nov., the etiological agent of African tick bite fever. Int J Syst Bacteriol. 1996;46:611–614. doi: 10.1099/00207713-46-2-611. [DOI] [PubMed] [Google Scholar]
  16. Kuloglu F. Rolain JM. Fournier PE, et al. First isolation of Rickettsia conorii from humans in the Trakya (European) region of Turkey. Eur J Clin Microbiol Infect Dis. 2004;23:609–614. doi: 10.1007/s10096-004-1179-4. [DOI] [PubMed] [Google Scholar]
  17. Mediannikov O. Diatta G. Fenollar F, et al. Tick-borne rickettsioses, neglected emerging diseases in rural Senegal. PLoS Negl Trop Dis. 2010;4:e821. doi: 10.1371/journal.pntd.0000821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Mediannikov O. Matsumoto K. Samoylenko I, et al. Rickettsia raoultii sp. nov., a spotted fever group rickettsia associated with Dermacentor ticks in Europe and Russia. Int J Syst Evol Microbiol. 2008;58:1635–1639. doi: 10.1099/ijs.0.64952-0. [DOI] [PubMed] [Google Scholar]
  19. Nilsson K. Lindquist O. Påhlson C. Association of Rickettsia helvetica with chronic perimyocarditis in sudden cardiac death. Lancet. 1999;354:1169–1173. doi: 10.1016/S0140-6736(99)04093-3. [DOI] [PubMed] [Google Scholar]
  20. Oteo JA. Portillo A. Tick-borne rickettsioses in Europe. Ticks Tick Borne Dis. 2012 doi: 10.1016/j.ttbdis.2012.10.035. in press. [DOI] [PubMed] [Google Scholar]
  21. Oteo JA. Portillo A. Blanco JR, et al. Low risk of developing human Rickettsia aeschlimannii infection in the North of Spain. Ann NY Acad Sci. 2005;1063:349–351. doi: 10.1196/annals.1355.057. [DOI] [PubMed] [Google Scholar]
  22. Oteo JA. Portillo A. Blanco JR, et al. Rickettsia africae infection. Three cases confirmed by PCR [in Spanish] Med Clin (Barc) 2004;122:786–788. doi: 10.1016/s0025-7753(04)74386-9. [DOI] [PubMed] [Google Scholar]
  23. Parola P. Paddock CD. Raoult D. Tick-borne rickettsioses around the world: emerging diseases challenging old concepts. Clin Microbiol Rev. 2005;18:719–756. doi: 10.1128/CMR.18.4.719-756.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Portillo A. Pérez-Martínez L. Santibáñez S, et al. Detection of Rickettsia africae in Rhipicephalus (Boophilus) decoloratus ticks from the Republic of Botswana, South Africa. Am J Trop Med Hyg. 2007;77:376–377. [PubMed] [Google Scholar]
  25. Raoult D. Fournier PE. Abboud P, et al. First documented human Rickettsia aeschlimannii infection. Emerg Infect Dis. 2002;8:748–749. doi: 10.3201/eid0807.010480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Regnery RL. Spruill CL. Plikaytis BD. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol. 1991;173:1576–1589. doi: 10.1128/jb.173.5.1576-1589.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Reif KE. Macaluso KR. Ecology of Rickettsia felis: a review. J Med Entomol. 2009;46:723–736. doi: 10.1603/033.046.0402. [DOI] [PubMed] [Google Scholar]
  28. Roux V. Fournier PE. Raoult D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol. 1996;34:2058–2065. doi: 10.1128/jcm.34.9.2058-2065.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Vatansever Z. Gargili A. Aysul NS, et al. Ticks biting humans in the urban area of Istanbul. Parasitol Res. 2008;102:551–553. doi: 10.1007/s00436-007-0809-z. [DOI] [PubMed] [Google Scholar]
  30. Walker AR. Bouattour A. Camicas JL, et al. A guide to identification of species. Scotland (UK): Bioscience Reports; 2003. Ticks of domestic animals in Africa. [Google Scholar]

Articles from Vector Borne and Zoonotic Diseases are provided here courtesy of Mary Ann Liebert, Inc.

RESOURCES