The utility of pathogen inactivation technology: a real-life example of Leishmania infantum inactivation in platelets from a donor with an asymptomatic infection

Introduction

Visceral leishmaniasis is typically caused by Leishmania infantum (L. infantum) in the Mediterranean littoral. The majority of infections with L. infantum are asymptomatic and resolve spontaneously in individuals with normal immune systems. A minority progress to classic, full-blown visceral leishmaniasis, known in many areas as kalaazar^1,2. Leishmania infection is most often transmitted to humans via the bite of the phlebotomine female sand fly, however transmission of Leishmania by transfusion has also been reported^3–13. Populations at risk of clinically apparent disease caused by L. infantum after insect bites or transfusion include infants and immunosuppressed patients.

Most cases of transfusion-transmitted leishmaniasis have been reported in endemic areas and, because the infection is often asymptomatic in healthy individuals, it is difficult to calculate the transmission risk precisely. The existence of cryptic Leishmania infections, associated with intermittent low density circulation of the parasite ^1,14, has been the main cause of transmission by blood.

In the Balearic Islands, our region, the prevalence of asymptomatic L. infantum infection in blood donors is high (11% of blood donors tested had a positive reaction to the delayed-type hypersensitivity test, 3.1% had specific antibodies and L. infantum DNA was detected in the blood of 5.9% of donors studied)¹⁵ which is in agreement with other findings regarding asymptomatic individuals from the Mediterranean region^1,16,17.

Although some research studies have investigated Leishmania infection in blood donors^1,14–17, currently there is no suitable Leishmania donor screening test that meets Blood Bank requirements with respect to aspects such as speed, automation and standardisation.

At present, the only measure applied to prevent transmission-transfusion leishmaniasis is based on donor selection criteria. According to the “Guide to Preparation, Use and Quality Assurance of Blood Components” from the European Committee on Blood Transfusion, as well as the Spanish Regulation on Blood Donation, the strategy adopted in Europe is based on permanent deferral for donors who have had or currently have visceral leishmaniasis. In other countries, such as the USA, donors are deferred for a period of 1 year from the date of their last departure from an endemic country.

Since there is currently no adequate donor screening test for Leishmania, several methods have been used to inactivate Leishmania in blood products^18–20 and to eliminate the parasites through filtration using whole blood, fresh plasma and red blood cell (RBC) leucodepletion systems^15,21–23.

As an approach to reducing the risk of transfusion-related transmission in our area, we investigated the ability of pathogen inactivation technology using riboflavin and ultraviolet light to eliminate L. infantum in apheresis platelet units obtained from an asymptomatic infected blood donor.

This is the first report on the utility of pathogen inactivation technology in the elimination of a parasite from a blood component collected from an asymptomatic infected blood donor.

Case presentation

This study was conducted under a protocol approved by the Balearic Island Ethic Committee after written informed consent had been obtained from the participating donor. The donor met the eligibility criteria defined by the Spanish Blood Donation Regulations and the Guide to the Preparation, Use and Quality Assurance of Blood Components by the European Committee on Blood Transfusion.

The 52-year old male blood donor, previously discovered to be asymptomatically infected by L. infantum, after L. infantum DNA had been detected in his peripheral blood, was enrolled in order to study the efficacy of pathogen reduction technology in eliminating the parasite from platelet concentrates collected by apheresis.

On separate occasions, the selected donor gave two apheresis platelet donations using the MCS Plus version LDL for single-dose platelets (Haemonetics Corp., Braintree, MA, USA) which uses a filtration technique for leucoreduction (Purecell LRF High Efficiency Leukocyte Reduction Filtration System for Platelets; PALL Corporation, NY, USA). The machine was programmed to obtain a platelet unit suspended in 100% plasma at a concentration of approximately 1,400×10⁹ cells/L and a planned yield of 3.5×10¹¹ cells/unit. The platelet volume obtained was 350 mL with a platelet yield of 3.5×10¹¹ cells/unit the first time, and 3.6×10¹¹ cells/unit the second time.

After rest period of at least 2 hours after collection, the units were inactivated using riboflavin and ultraviolet light (MIRASOL Pathogen Reduction Technology System for Platelets and Plasma; CaridianBCT Biotechnologies, Lakewood, CO, USA) according to the manufacturer’s instructions. The bag containing platelets was connected to the pathogen-reduction illumination/storage bag using a Terumo sterile tubing welder, and the contents of the original collection bag were drained into the illumination/storage bag. Following the transfer of the platelets, the collection bag was removed and discarded. The sterile riboflavin bag, containing 35 mL of riboflavin solution (500 μM), was connected to the illumination/storage bag containing the platelet product. After transferring the riboflavin and eliminating the air the riboflavin bag was disconnected. Each platelet product to be treated contained 210 mL of 83% platelet product in a 1-l citrate-plasticized, polyvinyl chloride (PVC) ELP bag with a surface area of 347 cm² per side. Each bag was labelled on one side, which resulted in a total surface area of 590 cm² through which light could pass to reach the contents of the bag. The Mirasol Pathogen Reduction Technology System illuminator delivers 6.2 J/cm² ultraviolet (UV) light (265–370 nm) in approximately 5–10 minutes. The total process results in irreversible photo-oxidative damage to nucleic acid, including nucleated blood cells and infectious contaminating agents.

The donor underwent a 2-year follow-up during which tests were carried out to determine whether parasite DNA was present in the peripheral blood before donating platelets by apheresis. In addition, western blotting of the donor’s serum and real-time polymerase chain reaction (RT-PCR) analyses were performed on peripheral blood samples (after obtaining the peripheral blood mononuclear cell fraction as previously described¹⁵) on the day of the apheresis donation. RT-PCR was also performed on platelet units both before and after inactivation with the MIRASOL Pathogen Reduction Technology System. All PCR-positive samples were cultured.

Anti-Leishmania antibodies were tested by western blotting using a whole L. infantum antigen (MHOM/FR/78/LEM 75). We considered serum to be positive when immunoreactivity against the 14 and/or 16 kDa L. infantum antigen fraction was observed.

The presence of Leishmania DNA was analysed through the amplification of kinetoplast DNA sequences by RT-PCR as previously described by Mary et al. with some modifications^24,25. Each amplification was performed in triplicate, in a 20 μL reaction mixture containing 1xiTaq supermix with Rox (Bio-Rad, Hercules, CA, USA), 15 pmol of direct primer (CTTTTCTGGTCCTCCGGGTAGG), 15 pmol of reverse primer (CCACCCGGCCCTATTTTACACCAA), 50 pmol of the labelled TaqMan probe (FAM-TTTTCGCAGAACGCCCCTACCCGC-TAMRA) and 5 μL of sample DNA. Amplifications and detection were performed in an ABI Prism 7700 system (Applied Biosystems, Foster City, CA, USA) in two-step temperature (94 °C and 55 °C) cycling over 45 cycles. Positive controls (DNA from L. infantum MHOM/ES/04/BCN-61) and negative controls were included in each PCR analysis. RT-PCR was considered positive for Leishmania spp. when the threshold cycle (C_T) was <45. The C_T for a given sample is the first cycle of the PCR reaction in which fluorescence is detected above the baseline.

In vitro culture was performed using NNN medium and Schneider’s insect culture medium (Sigma) supplemented with 20% heat-inactivated foetal calf serum, 1% sterile human urine, and 25 μg/mL gentamicin solution. Two tubes of NNN and one flask with 20 mL of Schneider’s medium were inoculated with 250 μL and 500 μL of the peripheral blood mononuclear cells, respectively. Cultures were maintained between 24 °C and 26 °C, examined twice a week, and subcultured every 2 weeks for 6 months before being considered negative.

Results

The Leishmania-specific antibodies were revealed by western blotting of the sera of this donor and showed the characteristic 16 kDa band. The presence of the parasite was evident in the blood of this donor by RT-PCR analyses. In fact, both western blotting and RT-PCR analyses on peripheral blood samples taken the day of apheresis donation were positive on two different occasions. The pre-inactivation platelet units were positive by RT-PCR at the level of 0.01 parasites/mL. After MIRASOL inactivation of platelet units, RT-PCR analyses were negative. All in vitro cultures of RT-PCR-positive samples were negative after 6 months of follow-up.

Discussion

The risk of transfusion-associated parasite infection is mainly determined by five factors: the prevalence of infection, the incidence of peripheral parasitaemia in donors, the survivability of parasites stored in blood, the minimal infectious dose and the immunocompetence of the recipient.

In our region, the epidemiology criteria were met fully: L. infantum DNA was detected in the blood 5.9% of blood donors studied¹⁵. An in vitro study has also demonstrated the survivability of Leishmania under blood bank storage conditions. In fact, the parasites can survive as intracellular forms in monocytes for 25 days in RBC fractions kept at 4 °C, for 5 days in platelet fractions kept at 24 °C, for 35 days in RBC fractions frozen with glycerol, and for 30 days in unprocessed whole blood left at 4 °C²⁶. In addition, the infectivity of blood contaminated by Leishmania and stored under blood bank conditions has been proven in animal studies^27,28.

To date, there have been 11 reports of transfusion-acquired leishmaniasis^3–13. Of these, 10 were individual or two-case reports and, in the remaining report, 32 cases of kala-azar were described in 82 patients undergoing haemodialysis.

The donors were identified in only four out of the 11 reports on transfusion-transmitted leishmaniasis. However, it was not possible to demonstrate the presence of the parasite circulating either in the bloodstream of any of the donors or in transfused blood components^3,4,11,12. All four donors were asymptomatic at the time of blood donation.

Certainly, asymptomatic L. infantum infected blood donors, with intermittent and low level parasitaemia, are an important source of transfusion-related transmission in endemic areas. L. infantum infected blood recipients include immunosuppressed and critically ill patients who are at risk of serious illness from even a small inoculum²⁶. Currently there is no adequate donor screen for Leishmania. However, several methods have been used to prevent transfusion-acquired leishmaniasis based on either inactivating or eliminating Leishmania in blood products. Riboflavin and ultraviolet light technology achieved a 5 to 6 log reduction of Leishmania in platelet units deliberately contaminated with amastigote-laden macrophages¹⁸, photochemical treatments with amotosalen plus ultraviolet light produced a 5.4 log reduction of Leishmania in platelet concentrates contaminated with L. mexicana metacyclic promastigotes¹⁹, and no Leishmania growth was observed at any dilution (from 0 to 8 log) in RBC suspensions intentionally contaminated with L. donovani infantum promastigotes treated with thiazole orange in the presence or absence of light²⁰. Eliminating the parasite by filtration using a leucodepletion system has also been reported as a method for decreasing the transfusion-transmission risk in endemic areas: PCR-positive RBC samples from donors with L. infantum infection became PCR-negative after leucodepletion¹⁵. All studies on pathogen inactivation technologies applied to the reduction of Leishmania risks are based on in vitro studies. Basically, Leishmania-infected monocytes and/or promastigotes were deliberately added to blood components collected from healthy, non-infected blood donors, i.e. either amastigote-laden macrophages produced by incubating normal donor whole blood with a dose of 1.0×10⁸ of Leishmania promastigotes or by directly inoculating 2×10¹⁰ promastigotes. The presence of the viable parasite post-inactivation was studied by culture methods^18–20.

Parasitological techniques, such as microscopic examination and/or culture of bone marrow and spleen aspirates, are the reference methods for confirming an active infection by Leishmania in patients. However, epidemiological studies on healthy individuals have shown that these methods seem to be unsuitable for detecting asymptomatic carriers. Other less aggressive diagnostic methods have been evaluated in the last few years. Several studies have shown that PCR analysis is a good alternative to traditional methods. An important advantage of PCR is that it can be performed on peripheral blood and it has high sensitivity; the only minor inconvenience being that a blood sample has to be taken from the subject being studied. In fact, PCR has been used to detect L. infantum DNA in the peripheral blood of patients^29,30 and asymptomatic carriers^1,14,15. Additionally PCR testing can be considered as a true direct method for detecting the presence of the parasite, as previous studies showed that Leishmania nucleic acids were rapidly degraded following parasite death^31,32. Another essential point is the low sensitivity of cultures compared to the high sensitivity of PCR when these methods are used for the detection of asymptomatic carriers^14,15. This may be due to the low level of circulating parasites in asymptomatic individuals, which is sufficient to give a positive PCR result but not a positive culture. The size of the inoculum clearly influences the growth of Leishmania, whatever the culture medium used. Indeed, L. infantum do not grow from diluted “inocula” (about 10⁴ parasites/mL)³³. The low levels of parasitaemia in asymptomatic subjects, ranging from 0.001 parasites/mL to 1 parasite/mL³⁴, which give rise to a very small inoculum, are definitely insufficient to produce cell growth in culture media. Culture techniques do not, therefore, seem to be the best method for detecting asymptomatic carriers given the low level of circulating parasites found in these subjects.

As a result, we defined an asymptomatic carrier of L. infantum as an otherwise healthy individual but with parasite DNA detectable in peripheral blood, i.e. without any evidence of clinical visceral leishmaniasis.

From our pool of asymptomatic infected donors we chose a blood donor with Leishmania DNA detectable in peripheral blood on two occasions in 2 consecutive years. Follow-up at 24 months did not show any evidence of clinical visceral leishmaniasis in this donor.

Western blotting and RT-PCR analyses on the peripheral blood samples taken the day of the donation were positive on two different occasions. The preinactivation platelet units from the two donations were positive although the in vitro culture results were negative. This is not surprising given the small size of the “inoculum” (0.01 parasites/mL), far below the dose that is considered necessary to produce cell growth (over 10⁴ parasites/mL)³³, as already mentioned above, and also much inferior to the dose used by other authors who investigated the elimination of the parasite applying pathogen inactivation technologies in in vitro studies^18,19. However, RT-PCR analyses were negative on both occasions after MIRASOL inactivation of the platelet units.

The levels of parasite in the peripheral blood, and also in the pre-inactivation platelet fraction, were very low, 0.01 parasites/mL, on two separate occasions. This level of parasitaemia is in accordance with the reference values for L. infantum parasitaemia reported for asymptomatic subjects, which ranged from 0.001 parasites/mL to 1 parasite/mL, in contrast to those for visceral leishmaniasis patients at diagnosis, which ranged from 8 to 1,400,000 parasites/mL³⁴. Low and episodic parasitaemia in asymptomatic Leishmania-infected individuals has been previously reported by other authors^1,14–17. The parasitaemia in our donor seems to be low but persistent, since it has been present for at least 2 years.

Conclusion

In vitro studies on Leishmania inactivation have demonstrated good inactivation of high levels of parasite in blood components^18–20. It is not, therefore, surprising that parasites present at a low concentration in platelet fractions were effectively inactivated using MIRASOL technology. In fact, it is probable that in real life the levels of parasites in blood and blood components collected from asymptomatic carriers, and which need to be inactivated, could be much lower than those used in in vitro spiking studies. The methods used to detect asymptomatic carriers should be more sensitive than culture, for example PCR. MIRASOL pathogen reduction technology may be a useful approach to preventing transfusion-transmitted leishmaniasis, particularly in an “at risk” context. However, this needs to be confirmed by more numerous case series.