Lipase and Protease Double-Deletion Mutant of Pseudomonas fluorescens Suitable for Extracellular Protein Production

Abstract

Pseudomonas fluorescens, a widespread Gram-negative bacterium, is an ideal protein manufacturing factory (PMF) because of its safety, robust growth, and high protein production. P. fluorescens possesses a type I secretion system (T1SS), which mediates secretion of a thermostable lipase (TliA) and a protease (PrtA) through its ATP-binding cassette (ABC) transporter. Recombinant proteins in P. fluorescens are attached to the C-terminal signal region of TliA for transport as fusion proteins to the extracellular medium. However, intrinsic TliA from the P. fluorescens genome interferes with detection of the recombinant protein and the secreted recombinant protein is hydrolyzed, due to intrinsic PrtA, resulting in decreased efficiency of the PMF. In this research, the lipase and protease genes of P. fluorescens SIK W1 were deleted using the targeted gene knockout method. Deletion mutant P. fluorescens ΔtliA ΔprtA secreted fusion proteins without TliA or protein degradation. Using wild-type P. fluorescens as an expression host, degradation of the recombinant protein varied depending on the type of culture media and aeration; however, degradation did not occur with the P. fluorescens ΔtliA ΔprtA double mutant irrespective of growth conditions. By homologous expression of tliA and the ABC transporter in a plasmid, TliA secreted from P. fluorescens ΔprtA and P. fluorescens ΔtliA ΔprtA cells was found to be intact, whereas that secreted from the wild-type P. fluorescens and P. fluorescens ΔtliA cells was found to be hydrolyzed. Our results demonstrate that the P. fluorescens ΔtliA ΔprtA deletion mutant is a promising T1SS-mediated PMF that enhances production and detection of recombinant proteins in extracellular media.

INTRODUCTION

Pseudomonas fluorescens produces heat-stable lipases and proteases (15). These enzymes cause spoilage of milk and are responsible for bitterness, casein breakdown, and ropiness of milk resulting from production of slime and protein coagulation (19, 36). In contrast to these negative effects, P. fluorescens is a potential expression host for a diverse range of recombinant proteins. In particular, because it does not accumulate acetate during fermentation, it is conducive to high-cell-density fermentation (9). Accordingly, this Gram-negative psychrotropic bacterium has been developed as a high-yield protein manufacturing factory (PMF) capable of producing pharmaceutical and industrial proteins (23, 37).

Through its ATP-binding cassette (ABC) transporter, TliDEF, P. fluorescens secretes a thermostable lipase, TliA. The genes tliA and tliDEF are encoded in a gene cluster designated the lipase/protease operon (2). TliDEF includes three components, TliD, TliE, and TliF, which are an ABC protein, a membrane fusion protein (MFP), and an outer membrane protein (OMP), respectively. Several regions of the secretion/chaperone domain of TliA have been isolated and defined as lipase ABC transporter recognition domains (LARDs) (10, 11, 32). For example, LARD3 is a fragment of TliA, composed of its last 103 residues, and, as an attached marker, it enables recognition of model proteins by ABC transporters. In general, LARD-linked proteins are secreted by TliDEF because they contain parts of the TliA secretion/chaperone domain, which is responsible for secretion (32). LARDs mediate export of recombinant proteins through ABC transporters; therefore, extracellular proteins are conveniently produced and acquired from culture broths.

Unlike other Gram-negative secretory pathways, the type 1 secretion system (T1SS) is mechanistically simple and primarily composed of three components of the ABC transporter (12). Thus, utilization of T1SS for PMFs is ideal because proteins are secreted directly into the extracellular medium from the cytoplasm without becoming trapped in the periplasm. Previous research conducted in this laboratory has resulted in successful transport of several proteins through P. fluorescens T1SS by attachment of LARDs as secretion markers. A number of proteins, including green fluorescent protein (GFP), epidermal growth factor (EGF), and alkaline phosphatase, can be transported by P. fluorescens when a LARD is attached to their C-terminal ends (32). However, one shortcoming of this secretory system is that intrinsic TliA from the native chromosomal copy of tilA may interfere with detection and purification of the desired LARD-linked recombinant proteins.

In addition to TliA, P. fluorescens SIK W1 secretes a metalloprotease, PrtA, which contains a zinc-binding motif (HExxH) (35). PrtA, which is classified as a member of the serralysin subfamily (EC 3.4.24.40), shares high homology with metalloproteases of Erwinia chrysanthemi (43), P. aeruginosa (13), Serratia marcescens (24), and P. fluorescens CY091 (26). PrtA contains conserved Zn²⁺- and Ca²⁺-binding domains and is highly resistant to heat inactivation (26, 44). It also possesses typical C-terminal RTX motifs (GGxGxD), which facilitate its export by the ABC transporter. The lipase/protease operon of P. fluorescens SIK W1 is composed of prtA, inh, tliDEF, and tliA and is responsible for synthesis and export of the lipase and the protease (2). Given its ability to hydrolyze environmental proteins, PrtA is presumably involved in nutrient utilization. Due to its low degree of selectivity, a polypeptide of as few as six amino acids can be a substrate (28). Therefore, it is believed that PrtA hydrolyzes most proteins in the extracellular media. For this reason, prtA was targeted for deletion with the expectation that its deletion would result in increased production of recombinant proteins. The inh, which encodes a PrtA inhibitor, was also deleted together with prtA.

The genomes of P. fluorescens strains Pf-5, Pf0-1, and SBW25 have been fully sequenced (33, 41). P. fluorescens SIK W1 and SBW25 contain only a lipase gene and a protease gene, while P. fluorescens Pf-5 and Pf0-1 possess several lipase and protease genes. Therefore, in the present study, the sole lipase (tliA) and protease (prtA) genes in P. fluorescens SIK W1 were targeted for deletion. For development of a strain of P. fluorescens that can serve as an efficient PMF, deletion of tliA and prtA was essential in order to maximize production and detection of recombinant proteins. P. fluorescens SIK W1 was used as the target deletion strain for construction of the P. fluorescens ΔtliA ΔprtA mutant. Strain enhancement as an expression host was verified, and secretion activities of the deletion mutant were evaluated by monitoring production of TliA and GFP-fusion proteins.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

P. fluorescens SIK W1 (KCTC 7689 from the Korea Collection for Type Cultures) was used as the target strain for the deletion. Escherichia coli XL1-Blue (Stratagene) was used as a host strain for plasmid construction, and E. coli S17-1 (29) was used as a donor for delivery of plasmids to P. fluorescens SIK W1 by conjugation. Each strain was cultured in lysogeny broth (LB) medium. The E. coli strains were cultured at 37°C, while P. fluorescens SIK W1 cells were cultured at 25°C. LB agar containing 30 μg/ml kanamycin was used for negative selection of deletion mutants, and LB agar containing 10% sucrose was used for positive selection. During conjugation, because P. fluorescens has an innate resistance to ampicillin, 50 μg/ml ampicillin was added in order to distinguish P. fluorescens SIK W1 cells from E. coli S17-1 cells (31). LB agar with 0.5% tributyrate, on which expression of TliA is marked by the appearance of transparent haloes around the colonies, was used for detection of lipase activity. Skim milk agar containing 0.5% peptone, 0.5 mM CaCl₂, 3% skim milk, and 1.5% agar was prepared for detection of protease activity. The skim milk solution was autoclaved separately to prevent coagulation with CaCl₂.

Plasmid construction for deletion mutant.

The plasmids used in this study are listed along with the bacterial strains and their characteristics (Table 1). Information regarding the primers is provided (Table 2). The plasmid pKtliAXS was constructed by introduction of a central 521-bp-deficient tliA into pK18mobsacB (39) using the following methods. The gene tliA was amplified by PCR using primers lip-s and tliA-HindIII from pTOTAL, a plasmid containing the entire P. fluorescens lipase/protease operon. tliA was then inserted into pK18mobsacB, which had been digested with the restriction enzymes BamHI and HindIII for construction of pKtliA. The tliA gene in pKtliA was then digested with two compatible restriction enzymes, XhoI and SalI, and the plasmid was allowed to self-ligate for deletion of the central 521-bp region, yielding pKtliAXS. The plasmid pKΔprtA was constructed by insertion of the 357-bp ΔprtA and 354-bp Δinh fragments of the protease inhibitor gene of P. fluorescens into pK18mobsacB. The 357-bp ΔprtA fragment was amplified using primers prt-s and Δprt-Xb, and the 354-bp Δinh fragment was amplified using primers Δinh-Xb and inh-HindIII. The final ΔprtA fragment inserted into pK18mobsacB was designed to produce a nonfunctional fusion protein containing partial prtA and inh sequences, thus avoiding a polar mutation effect on the ABC transporter gene behind inh. Standard protocols were followed in performance of transformation, isolation, restriction endonuclease digestion, ligation, PCR, and gel electrophoresis procedures (38). All restriction endonucleases, enzymes, and associated reagents were purchased from Solgent (Daejeon, South Korea), TaKaRa Shuzo (Shiga, Japan), or Sigma-Aldrich (St. Louis, MO).

Table 1.

Bacterial strains and plasmids used in this study

Strain or plasmid	Relevant characteristic(s)a	Source or reference
Strains
E. coli
XL1-Blue	recA1 hsdR17(rK−, mK+) supE44 lac [F′ proAB+ lacIq lacZΔM15::Tn10(Tetr)]	Stratagene
S17-1	thi pro res− mod+> Smr Tpr recA1 RP-4-2[Tc::Mu; Km::Tn7]	29
P. fluorescens SIK W1	Wild type of P. fluorescens identified in milk	5
Plasmids
pTOTAL	tliDEF and tliA	2
pK18mobsacB	Kmr, sacB lacZα mob	39
pKtliA	pK18mobsacB with BamHI-HindIII fragment of tliA	This study
pKtliAXS	tliA central XhoI-SalI fragment deleted from pKtliA	This study
pKΔprtA	Partial prtA and partial inh inserted in pK18mobsacB	This study
pDX	tliDEF, Kmr in pDSK519	This study
pDX-TliA	tliDEF tliA, Kmr in pDSK519	This study
pDX-GFP-LARD3	tliDEF gfp-lard3, Kmr in pDSK519	This study
pDX-GFP-TliA	tliDEF gfp-tliA, Kmr in pDSK519	This study
pAJH10	tliDEF tliA, Kmr in pDSK519, tliA strongly expressed	1

^aKm, kanamycin; Sm, spectinomycin; Tet, tetracycline; Tp, trimethoprim.

Table 2.

Primers used in this study

Name	Sequencea	Feature/usage
lip-s	GGATCCATGGGTGTATTTGACTACAAG	tliA start codon/ΔtliA verification (T-PCR1)
tliA-HindIII	AAGCTTACTGATCAGCACACCCTCG	tliA last codon/ΔtliA verification (T-PCR1 & 2)
start-tliF	ATGAGATCGCTGCTTATTGC	tliF start codon/ΔtliA verification (T-PCR2)
prt-s	GGATCCATGTCAAAAGTAAAAGAGCAGG	prtA start codon/ΔprtA verification (P-PCR1)
Δprt-Xb	TCTAGACTCAGTGAAGGTCACGTTGG	prtA coding region/ΔprtA amplification
Δinh-Xb	TCTAGACAATCGATCGCCTGCGCTG	inh coding region/Δinh amplification
inh-HindIII	AAGCTTCTAAGGCACGCGGTGTAATA	inh stop codon/ΔprtA verification (P-PCR1 & 2)
5′-UTR-prt	GGGGTTCCTATCGATCAAAAC	5′ UTR of prtA/ΔprtA verification(P-PCR2)

^aStart and stop codons are italicized, and restriction enzyme sites are underlined.

Conjugation and deletion mutant selection processes.

The pKtliAXS suicide plasmid contains the Km^r gene, sacB, and the mob factor. Via the mob factor (39), pKtliAXS was transferred from E. coli S17-1 to P. fluorescens SIK W1 by conjugation, according to the procedures previously described by Miller (30). Colonies of P. fluorescens with a single-crossover event were selected based on kanamycin resistance. These colonies, which had integrated pKtliAXS into the genome, exhibited sucrose sensitivity (due to the presence of sacB) along with kanamycin resistance. Another crossover event was then induced in order to replace tliA with the 521-bp-deficient tliA mutant and for removal of the Km^r gene and sacB from the genome. For this, a colony of a single recombinant was grown in a nonselective LB medium at 25°C. After 1 day of growth, cultures were diluted by factors of 10⁻⁴, 10⁻⁵, and 10⁻⁶, spread onto 10% sucrose LB agar, and incubated for 48 h. Colonies that grew on 10% sucrose LB were selected and evaluated for the absence of lipase expression. Deletion mutants were screened for kanamycin-sensitive and sacB-negative colonies. The ΔprtA strains were obtained using plasmid pKΔprtA. Both wild-type P. fluorescens and the P. fluorescens ΔtliA mutant were used for prtA deletion, creating P. fluorescens ΔprtA and P. fluorescens ΔtliA ΔprtA mutants. Single recombinants with sacB conferred basal resistance on 10% sucrose LB agar; therefore, we developed a new method in which single recombinants were cultured in 10% sucrose LB medium for 24 h and then spread on LB agar after dilution. Colonies obtained after selection in 10% sucrose liquid medium were mostly wild type or doubly recombinant.

Verification of the deletion of tliA and prtA.

To verify successful construction of the P. fluorescens ΔtliA deletion mutant, the genomes of wild-type P. fluorescens, single recombinant 1, single recombinant 2, and P. fluorescens ΔtliA mutants were amplified by PCR using T-PCR1 and T-PCR2 (Fig. 1). Two primers, lip-s and tliA-HindIII, which were used for pKtliAXS construction, were used for the T-PCR1 procedure. The primers start-tliF and tliA-HindIII were used for T-PCR2. The lip-s primer anneals to the first part of tliA, and start-tliF anneals to the first part of tliF in the P. fluorescens genome. Another two sets of PCR protocols were similarly designed in order to verify prtA deletion. The genomes of wild-type P. fluorescens, two single recombinants, and P. fluorescens ΔprtA were amplified by PCR using P-PCR1 and P-PCR2 (see Fig. 4). Two primers (prt-s and inh-HindIII), which were used for pKΔprtA construction, were used for P-PCR1, and the primers 5′-UTR-prt and inh-HindIII were used for P-PCR2. The prt-s primer anneals to the first part of prtA, and 5′-UTR-prt anneals to the 5′ region of prtA in the P. fluorescens genome.

Fig 1.

Construction and verification of the P. fluorescens ΔtliA mutant. (A) The deletion process and locations of primer-specific sequences used for PCR verifications. (B) PCR products amplified from four different P. fluorescens chromosomes by T-PCR1 primers. The expected lengths are indicated in panel A. (C) PCR products amplified by T-PCR2 primers. (D) Lipase plate containing the lipase substrate tributyrate and 50 μg/ml ampicillin. (E) LB plate containing 30 μg/ml kanamycin and 50 μg/ml ampicillin. P. fluorescens has innate resistance to ampicillin. Samples: 1, wild type (type 1); 2, single recombinant 1 (type 2); 3, single recombinant 2 (type 3); 4, ΔtliA mutant (type 4).

Fig 4.

Construction and verification of P. fluorescens ΔprtA mutant. (A) The overall deletion process and location of primer-specific sequences used for PCR verifications. (B) PCR products amplified from four different P. fluorescens chromosomes by P-PCR1 primers. The expected lengths are indicated in panel A. (C) PCR products amplified by P-PCR2 primers. (D) Skim milk agar containing 50 μg/ml ampicillin. (E) Skim milk agar containing 30 μg/ml kanamycin and 50 μg/ml ampicillin. P. fluorescens has innate resistance to ampicillin. Samples: 1, wild type (type 1); 2, single recombinant 1 (type 2); 3, single recombinant 2 (type 3); 4, ΔprtA mutant (type 4).

Expression of GFP fusion proteins.

The ABC transporter gene of P. fluorescens, tliDEF, was inserted into pDSK-519 (20) for construction of pDX. In addition, the coding sequences for TliA, GFP-LARD3, and GFP-TliA were inserted into the KpnI-SacI site of pDX downstream of tliDEF for construction of pDX-TliA, pDX-GFP-LARD3, and pDX-GFP-TliA, respectively. LARD3 or TliA was inserted into the C-terminal of GFP, resulting in GFP-LARD3 or GFP-TliA, respectively. The constructed plasmids were delivered into P. fluorescens by conjugal transfer or electroporation. P. fluorescens cultures containing these plasmids were grown in test tubes containing 8 ml LB or 2× LB medium at 25°C until the stationary phase was reached. This less-aerated condition was used for culture of wild-type P. fluorescens and the P. fluorescens ΔtliA mutant. To maintain expression of fusion proteins by the pDSK519 derivatives, 60 μg/ml kanamycin was added to the medium. Isopropyl-β-d-thiogalactopyranoside (IPTG) does not affect protein expression in P. fluorescens (1); therefore, it was not used.

SDS-PAGE and Western blot analysis.

Western blot analysis was performed using anti-LARD antibodies to measure expression and secretion of TliA (11). The cells were grown under the conditions described above in Materials and Methods. The cultures were centrifuged twice at 13,000 rpm for 10 min in order to separate the cell pellet from the supernatant, and expression and secretion of the recombinant proteins were analyzed in the pellet and supernatant, respectively. Proteins in the pellet (cells) or supernatant (extracellular medium) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in 10% polyacrylamide gels according to the method developed by Laemmli (22). The proteins were transferred onto a nitrocellulose membrane (Amersham), incubated with the primary and secondary antibodies, and detected using an enhanced chemiluminescence system (Pierce). Fifteen microliters of the cell pellet or supernatant, equivalent to 15 μl (optical density at 600 nm [OD₆₀₀] of approximately 3.0) of culture broth (0.045 OD₆₀₀ equivalent), was loaded onto 10% (vol/vol) SDS-PAGE, and Western blotting was performed as previously described (11) using anti-LARD or anti-GFP primary antibodies. Proteins were stained with Coomassie brilliant blue for direct observation.

Trypsinization of GFP-fusion proteins.

We treated GFP-fusion proteins with trypsin-EDTA (Gibco) for analysis of the activity of PrtA. GFP-fusion proteins were isolated from P. fluorescens ΔtliA and P. fluorescens ΔtliA ΔprtA cells harboring pDX-GFP-LARD3 and pDX-GFP-TliA, respectively. Cells were cultured in 8 ml LB medium at 25°C with shaking (150 rpm) until the stationary phase was reached. After centrifugation, 500 μl of supernatant was treated with 50 μl 0.5% trypsin–EDTA at 25°C for 3 h. The reaction was terminated by addition of SDS-PAGE sample buffer and heating for 10 min in boiling water. Western blotting was performed using anti-GFP antibodies for analysis of treated proteins.

Lipase activity assay.

Secretion of TliA from the four P. fluorescens strains, the wild type and the ΔtliA, ΔprtA, and ΔtliA ΔprtA mutants, was measured. Strains transformed with pAJH10, which expresses tliDEF and tliA, were cultured in test tubes containing 3 ml of LB medium at 25°C. The supernatant was centrifuged twice, and lipase activity was measured using a pH-STAT system (842 STAT Titrando; Metrohm). In addition, the supernatant was removed and incubated for 15 h at 25°C, and measurement of lipase activity was performed every 5 h to assess the degradation of TliA. For measurement of lipase activity, an olive oil emulsion was titrated with a 10 mM NaOH solution. Because lipase hydrolyzes triglycerides and releases free fatty acid, the 10 mM NaOH solution was added in order to maintain the pH at 8.5. A mixture containing 10 ml olive oil, 90 ml 10% Arabic gum, and 200 ml of a salt solution was emulsified for 10 min using a blender. The salt solution contained 20 mM CaCl₂, 0.6 M NaCl, and 1 mM sodium taurocholate. Lipase solution (1 to 30 μl) was injected into 40 ml of the olive oil emulsion, and the pH-STAT titrated the olive oil emulsion with 10 mM NaOH at pH 8.5 and 45°C for 3 min. The titration results were converted into lipase activity values; 1 unit was defined as the release of 1 μmol of fatty acid per min under the experimental conditions (5).

RESULTS

Construction and verification of the P. fluorescens ΔtliA mutant.

Many cases of milk spoilage have reportedly been attributed to the thermostable lipase produced by P. fluorescens SIK W1 (3, 4). In a previous study, the P. fluorescens SIK W1 thermostable lipase/protease operon containing prtA, inh, tliD, tliE, tliF, and tliA was cloned and sequenced (2). This operon enables secretion of protease (PrtA) and lipase (TliA) by P. fluorescens SIK W1 into the extracellular medium by the action of the ABC transporter TliDEF. In this study, the lipase gene, tliA, in the lipase/protease operon of P. fluorescens SIK W1 was targeted for deletion. A 521-bp central deletion was successfully substituted in place of the genomic tliA, resulting in the ΔtliA mutant (Fig. 1A).

To verify successful construction of the deletion mutant, the genomes of wild-type P. fluorescens, single recombinants 1 and 2 (vector-inserted genomes shown in Fig. 1A), and the P. fluorescens ΔtliA mutant were amplified by PCR using T-PCR1 primers (Fig. 1B). As expected, only 521-bp-deficient tliA (907 bp) was amplified from the P. fluorescens ΔtliA mutant, while only intact tliA (1,428 bp) was amplified from the wild-type strain. Both fragments were found in single recombinants 1 and 2. Additional PCR amplification using T-PCR2 primers resulted in production of a 2,920-bp fragment from the single recombinant 1 strain, suggesting that the truncated tliA was inserted downstream of the genomic tliA (Fig. 1C). On the other hand, use of the identical PCR amplification procedure resulted in a 2,399-bp fragment from single recombinant 2, indicating that the ΔtliA gene was inserted upstream of genomic tliA. When cells were cultured on tributyrate LB agar for phenotypic evaluation, formation of large haloes was observed around the wild-type colonies, while no halo developed around the P. fluorescens ΔtliA colonies (Fig. 1D). In addition, neither wild-type nor P. fluorescens ΔtliA cells grew in the presence of kanamycin, whereas the two single recombinants exhibited robust growth (Fig. 1E). These results indicated the successful construction of the P. fluorescens ΔtliA mutant.

Expression and secretion of TliA by the P. fluorescens ΔtliA mutant.

Western blot analysis was performed using anti-LARD antibodies in order to examine expression and secretion of TliA in wild-type P. fluorescens and the P. fluorescens ΔtliA strain (Fig. 2). When both were grown on tributyrate agar, extracellular lipase activity was detected around the wild-type colonies but not around P. fluorescens ΔtliA colonies (Fig. 1D). However, when these cells were analyzed by Western blotting, the lipase was undetectable in both the cells and the media (Fig. 2, lanes 1 and 2). To increase secretion of TliA, the ABC transporter was supplemented by transforming the cells with pDX, which encodes TliDEF. Transformation with pDX resulted in an increase in the level of TliA in the extracellular medium for the wild-type P. fluorescens cells, whereas extracellular TliA was absent in the medium harboring P. fluorescens ΔtliA cultures (Fig. 2, lanes 3 and 4). Supplemented ABC transporter enabled TliA secretion in wild-type P. fluorescens through substrate binding and protection (25, 32). To determine whether recombinant proteins were secreted without TliA by the P. fluorescens ΔtliA strain, GFP-LARD3 fusion protein was coexpressed with TliDEF. For construction of GFP-LARD3, LARD3 was attached to the C-terminal end of GFP. As expected, secretion of TliA along with GFP-LARD3 was observed in wild-type P. fluorescens, but only GFP-LARD3 was secreted in P. fluorescens ΔtliA cells (Fig. 2, lanes 5 and 6).

Fig 2.

Deletion verification by Western blot analysis. Intracellular expression (from cell pellet) and extracellular secretion (from supernatant) of TliA were detected using anti-LARD antibodies. Lanes: 1, wild-type P. fluorescens; 2, P. fluorescens ΔtliA mutant; 3, wild-type P. fluorescens containing pDX; 4, P. fluorescens ΔtliA mutant containing pDX; 5, wild-type P. fluorescens containing pDX-GFP-LARD3; 6, P. fluorescens ΔtliA mutant containing pDX-GFP-LARD3. P. fluorescens cells harboring pDX-GFP-LARD3 were cultured in 2× LB medium (lanes 5 and 6).

In an additional experiment, expression of GFP-LARD3 and GFP-TliA fusion proteins was observed in wild-type P. fluorescens and P. fluorescens ΔtliA cells together with TliDEF (Fig. 3). For construction of GFP-TliA, TliA was attached to the C-terminal end of GFP. Wild-type P. fluorescens cells transformed with pDX-GFP-LARD3 or pDX-GFP-TliA secreted only TliA into the LB broth (Fig. 3A). Both fusion proteins were detected along with TliA when wild-type P. fluorescens was cultured in 2× LB broth (Fig. 3B). This was consistent with the previously observed increase in the level of recombinant proteins following the switch of culture medium from LB to 2× LB (32). On the other hand, P. fluorescens ΔtliA cells harboring pDX-GFP-LARD3 secreted GFP-LARD3 without TliA into 2× LB medium (Fig. 3C, lane 2). However, P. fluorescens ΔtliA cells transformed with pDX-GFP-TliA still produced both TliA and GFP-TliA in the extracellular medium (Fig. 3C, lane 3). When the same extracellular medium was analyzed with anti-GFP antibodies, monomer-sized GFP (26.8 kDa) was detected. Because the cytoplasm contained only the intact GFP-TliA, it appeared that GFP-TliA was degraded into GFP and TliA during or after secretion (data not shown).

Fig 3.

Export of GFP-TliA and GFP-LARD3 from wild-type P. fluorescens and the P. fluorescens ΔtliA mutant. Fusion proteins in extracellular medium were detected using anti-LARD antibodies. (A) Wild-type P. fluorescens cultured in LB medium. (B) Wild-type P. fluorescens cultured in 2× LB medium. (C) P. fluorescens ΔtliA cells cultured in 2× LB medium. Lanes: 1, pDX-TliA; 2, pDX-GFP-LARD3; 3, pDX-GFP-TliA.

Construction of the P. fluorescens ΔprtA mutant.

To evaluate the effects of the prtA deletion mutant on secretion and degradation of the GFP fusion proteins, the P. fluorescens SIK W1 genome was also substituted using ΔprtA, deleting prtA and inh genes from the lipase/protease operon (Fig. 4A). The prtA gene was targeted in wild-type and P. fluorescens ΔtliA cells for construction of the P. fluorescens ΔprtA and P. fluorescens ΔtliA ΔprtA strains, respectively. PCR techniques performed to verify tliA deletion were also used to assess prtA deletion. Wild-type P. fluorescens, two single recombinants, and the P. fluorescens ΔprtA strain were amplified by PCR. As expected, amplification of only ΔprtA (725 bp) was observed in the P. fluorescens ΔprtA strain, while amplification of only the intact prtA (1,870 bp) was observed in the wild-type cells. Both fragments were found in single recombinants 1 and 2 (Fig. 4B). Additional PCR analysis with P-PCR2 primers amplified a 749-bp fragment from single recombinant 1, implying that the ΔprtA gene was inserted upstream of the intrinsic prtA gene (Fig. 4C). On the other hand, PCR amplification using an identical protocol produced a 1,912-bp fragment from single recombinant 2, indicating that the ΔprtA gene was inserted downstream of the intrinsic prtA. When grown on skim milk agar, formation of haloes was observed around the wild-type colonies whereas no halo was observed among the P. fluorescens ΔprtA colonies (Fig. 4D). Single recombinant 2 colonies also developed small haloes, suggesting that expression of the intact prtA was controlled by the prtA promoter. Neither wild-type nor P. fluorescens ΔprtA cells grew in the presence of kanamycin, whereas the two single recombinants showed vigorous growth (Fig. 4E). These results indicated that the deletion procedure we performed resulted in successful production of P. fluorescens ΔprtA and P. fluorescens ΔtliA ΔprtA strains.

Export of GFP fusion proteins from the P. fluorescens ΔtliA ΔprtA strain.

As previously mentioned, extracellular GFP-LARD3 and GFP-TliA secreted from either wild-type P. fluorescens or P. fluorescens ΔtliA cells were degraded. Consequently, a parallel experiment was performed with P. fluorescens ΔtliA ΔprtA cells to determine whether these recombinant proteins were intact in the absence of PrtA (Fig. 5). Using the P. fluorescens ΔtliA strain as an expression host, GFP-LARD3 and GFP-TliA were hydrolyzed completely in LB medium and to a lesser but significant degree in 2× LB medium (Fig. 5). This explained the comparative increase in the level of recombinant proteins following the switch of culture medium from LB to 2× LB which had been observed in our previous research (32). In contrast, degradation did not occur with the P. fluorescens ΔtliA ΔprtA strain in both LB and 2× LB medium (either aerated or less aerated). In general, wild-type P. fluorescens and P. fluorescens ΔtliA cells showed higher production of recombinant proteins under less-aerated conditions. Based on these results, it was concluded that PrtA produced by P. fluorescens hydrolyzed GFP-recombinant proteins upon secretion and that the decline in the recombinant protein level was caused by PrtA.

Fig 5.

Export of TliA, GFP-LARD3, and GFP-TliA from P. fluorescens ΔtliA and P. fluorescens ΔtliA ΔprtA cells. P. fluorescens ΔtliA cells were cultured in either 8 ml LB or 2× LB. P. fluorescens ΔtliA ΔprtA cells were cultured in 4 ml LB, which was well-aerated. Fusion proteins in extracellular medium were detected using anti-LARD antibodies. Lanes: 1, pDX-TliA; 2, pDX-GFP-LARD3; 3, pDX-GFP-TliA. The corresponding locations for GFP-TliA (77.4 kDa), TliA (49.9 kDa), and GFP-LARD3 (38.2 kDa) are indicated with arrows.

Results of Western blotting with anti-GFP antibodies showed that GFP-TliA was degraded into GFP in P. fluorescens ΔtliA but not in P. fluorescens ΔtliA ΔprtA cells (Fig. 6A, lanes 2 and 4). Extracellular GFP-LARD3 produced by P. fluorescens ΔtliA cells was also partially degraded into GFP, while both GFP-LARD3 and an intermediate form (molecular weight between those of GFP and GFP-LARD3) were observed with P. fluorescens ΔtliA ΔprtA cells (Fig. 6A, lanes 1 and 3). For an unknown reason, the intermediate form shortened at the C terminus was produced, likely by cytosolic proteases released during cell lysis. Monomeric GFP was not detected in P. fluorescens ΔtliA ΔprtA cultures; only GFP-LARD3 and the intermediate form were found in the extracellular medium. These results supported the hypothesis that GFP-fusion proteins produced by P. fluorescens ΔtliA cells were hydrolyzed by PrtA.

Fig 6.

Hydrolysis of GFP-LARD3 and GFP-TliA secreted from wild-type P. fluorescens and P. fluorescens ΔprtA cells. Fusion proteins in extracellular medium were detected using anti-GFP antibodies. (A) GFP-LARD3 and GFP-TliA secreted into extracellular medium from P. fluorescens ΔtliA and P. fluorescens ΔtliA ΔprtA cells. (B) Extracellular GFP-LARD3 and GFP-TliA from P. fluorescens ΔtliA ΔprtA cells treated with trypsin-EDTA. The corresponding locations of GFP-TliA (77.4 kDa), TliA (49.9 kDa), GFP-LARD3 (38.2 kDa), an intermediate-sized protein (∼34 kDa, indicated with an asterisk), and GFP (26.8 kDa) are indicated with arrows.

We treated the supernatant containing GFP-fusion proteins obtained from P. fluorescens ΔtliA ΔprtA cultures with 0.05% trypsin–EDTA (Fig. 6B). While the intact form was observed in the absence of trypsin-EDTA, the GFP-fusion proteins were hydrolyzed into GFP following treatment. GFP released upon hydrolysis by PrtA was not further degraded by treatment with trypsin-EDTA (data not shown). Trypsinization mimicked the hydrolysis of GFP-fusion proteins by PrtA. The link between GFP and the C-terminal signal peptide, which was derived from the secretion/chaperone domain of TliA, was a common target of both PrtA and trypsin.

Lipase production in P. fluorescens ΔtliA ΔprtA cultures.

The lipase in the P. fluorescens ΔprtA culture exhibited increased stability compared to that in the culture harboring the wild type. Extracellular media from the wild-type P. fluorescens and P. fluorescens ΔprtA strains, both harboring tliDEF and tliA in a plasmid, were incubated at 25°C, followed by measurement of lipase activity (Fig. 7A). Lipase activity in the culture harboring wild-type P. fluorescens decreased by 440 U/ml within a 15-h period; however, lipase activity in the P. fluorescens ΔprtA culture decreased only by 196 U/ml during the same period. On average, the lipase activity of P. fluorescens ΔprtA cells showed a rate of decrease of 1.43% per hour. The rate was much higher for wild-type P. fluorescens (4.60% per hour). These results suggest that extracellular PrtA fostered the decline of P. fluorescens lipase activity, presumably by hydrolyzing the lipase.

Fig 7.

Comparison of levels of lipase production by wild-type P. fluorescens and deletion mutants. P. fluorescens harboring pAJH10 was cultured in 3 ml LB at 25°C with shaking (160 rpm). (A) Lipase activity as a function of incubation time of the extracellular medium of wild-type P. fluorescens (●) and P. fluorescens ΔprtA (△) cells. (B) Lipase activity as a function of culture time of wild-type P. fluorescens (●), P. fluorescens ΔtliA (■), P. fluorescens ΔprtA (△), and P. fluorescens ΔtliA ΔprtA (○) cells. (C) SDS-PAGE analysis of TliA at daily intervals over 5 days of cultivation. Analysis of culture supernatants from wild-type P. fluorescens, P. fluorescens ΔtliA, P. fluorescens ΔprtA, and P. fluorescens ΔtliA ΔprtA strains was performed using SDS-PAGE. Culture supernatant (16 μl) was loaded onto SDS-PAGE gels and stained with Coomassie brilliant blue.

Four P. fluorescens strains supplemented with tliDEF and tliA were cultured, and the lipase activity in each culture was monitored for 5 days (Fig. 7B). Maximum lipase activities were observed on the second day and were higher for P. fluorescens ΔprtA cells (913 U/ml) and P. fluorescens ΔtliA ΔprtA cells (1,029 U/ml) than for wild-type P. fluorescens cells (804 U/ml) and P. fluorescens ΔtliA cells (755 U/ml). In addition, the lipase activity in the media of P. fluorescens ΔprtA and P. fluorescens ΔtliA ΔprtA cultures remained at around 300 to 400 U/ml, even after 5 days of incubation, while it showed a decline to below 100 U/ml in media from wild-type P. fluorescens and P. fluorescens ΔtliA cultures.

Although the rate of decrease was less than that of TliA from the wild-type P. fluorescens and P. fluorescens ΔtliA strains, the lipase activity of TliA from P. fluorescens ΔprtA and P. fluorescens ΔtliA ΔprtA cultures did show a decrease over time, especially after 3 days of culture (Fig. 7B). However, results of SDS-PAGE analysis showed that the amount of TliA did not decrease after the third day (Fig. 7C). Therefore, the decrease in lipase activity appeared to be caused mainly by inactivation of TliA rather than by its degradation. The relatively rapid decrease of lipase activity in wild-type P. fluorescens and P. fluorescens ΔtliA cultures may have been caused by the combination of hydrolysis and denaturation. Overall, P. fluorescens ΔprtA and P. fluorescens ΔtliA ΔprtA cells showed higher lipase concentrations than wild-type P. fluorescens and P. fluorescens ΔtliA cells, mainly due to the prtA deletion.

DISCUSSION

In this study, we constructed a double deletion mutant, P. fluorescens ΔtliA ΔprtA, lacking both tliA and prtA genes. The deletion procedure was not detrimental to the mutants, and they retained the characteristics of the parental cells. Lipase and protease activities of the P. fluorescens ΔtliA ΔprtA double deletion mutant were not observed when the cells were cultured on substrate plates or when the extracellular medium was analyzed. The P. fluorescens ΔtliA deletion mutant eliminated the drawback of detection of endogenous TliA along with the recombinant proteins, and this enhanced detection of recombinant proteins produced by this deletion mutant. As expected, the prtA deletion mutant lessened the degradation of recombinant proteins or lipase in the culture medium. PrtA appeared to preferentially hydrolyze exposed peptide bonds, including the one linking GFP and LARD. However, after a long period of time, it also digested TliA and probably GFP or other proteins. Increased stability against protein degradation in P. fluorescens ΔprtA cells could lead to much higher accumulation of target proteins in PMFs, resulting in high concentrations of secreted proteins during long periods of incubation.

P. fluorescens is a saprophytic bacterium commonly isolated from soil, water, and the surfaces and tissues of plants and animals (34). The ubiquitous nature of P. fluorescens on the surface of plants typically grown for human consumption suggests that this bacterium has been widely consumed by humans (7). In addition, extensive pathogenicity and toxicology studies have demonstrated the safety of P. fluorescens. The safety of P. fluorescens for use in industrial applications has also been verified by the ability of these cells to produce generally recognized as safe (GRAS) α-amylase (23) and several EPA-registered bioinsecticides (9). P. fluorescens can be cultivated at high densities in a bioreactor and can tolerate a wide range of fermentation conditions (40, 42). In addition, these bacteria can produce larger quantities of recombinant proteins in a form more soluble than proteins produced by E. coli (9). The benign nature, robust growth, and high-level production of recombinant proteins make P. fluorescens ideal for production of recombinant proteins. However, manufacture of recombinant protein is limited to cytoplasmic and periplasmic production. Therefore, for easy and cost-effective protein recovery, extracellular secretion into the growth medium is needed (9).

There are at least six specialized secretion systems in Gram-negative bacteria, including the ABC transporter (type I secretion system [T1SS]), Sec/Tat (T2SS), flagellum/pathogenesis (T3SS), conjugation/virulence (T4SS), autotransporter (T5SS), and recently identified Hcp/VgrG (T6SS) systems (8, 21). Among these, P. fluorescens has three secretion systems (T1SS, T2SS, and T5SS), which are capable of transporting proteins across both inner and outer membranes of Gram-negative bacteria (27). In contrast to T1SS, other secretion systems are associated with a large number of proteins. For example, 12 to 16 proteins are required for transport through the bacterial outer membrane by T2SS, and more than 10 Sec and other related proteins are involved in transport through the inner membrane by T5SS (17). The ABC secretion system provides efficient transport of proteins through the inner and outer membranes simultaneously and is mechanistically simple, being composed only of three protein components. By attachment of signal sequences recognized by ABC transporters, recombinant proteins can be secreted into the extracellular medium for cost-effective protein recovery. The P. fluorescens ΔtliA ΔprtA cells constructed in this study can be used as a PMF by supplementing the homologous ABC transporter for enhanced production of extracellular protein. These cells maintain recombinant proteins secreted by the ABC transporter, thereby maximizing the merits of P. fluorescens as an expression host.

Of particular interest, secretion of fusion proteins was observed with wild-type P. fluorescens only when the host was cultured in 2× LB broth. For example, when cultured in 2× LB, GFP-LARD3 and GFP-TliA were secreted by wild-type P. fluorescens and P. fluorescens ΔtliA cells, whereas they were undetectable when the cells were cultured in normal LB broth. Through comparison of P. fluorescens ΔprtA cells with the wild-type cells, we concluded that PrtA was secreted into normal LB broth and hydrolyzed the recombinant proteins; however, suppressed production of PrtA was observed in 2× LB medium. GFP with C-terminal tags appeared to contain an exposed labile peptide bond, which was degraded by PrtA. Use of the P. fluorescens ΔtliA ΔprtA strain alleviates the restriction on medium concentrations, allowing the use of LB medium instead of 2× LB medium. However, in hindsight, because the C-terminal secretion signal may interfere with GFP, decreasing its fluorescence, production of free GFP by promoting PrtA-mediated hydrolysis might be beneficial (11).

Previously, it was reported that homologous expression of lipase genes in P. fluorescens decreases with increased aeration (1). The recombinant lipase was likely to be degraded by some proteases that are produced under aerobic conditions. Previous studies have shown that aeration increases production of lipase and protease in P. fluorescens (6, 14, 18). In addition, aeration has a negative effect on recombinant protein production via the Hly secretion system (16). The effect of oxygen on PrtA in secretion systems has not been determined; therefore, further research on the involvement of PrtA in aeration-related protein is anticipated. Both expression and degradation of target protein affect extracellular accumulation of the protein. PrtA, whose production is increased by aeration, appears to be a major factor in the decrease of protein accumulation.

In summary, removal of functional tliA and prtA from the genome of P. fluorescens resulted in production of recombinant proteins without the interference of TliA and with the ensured protection from PrtA hydrolysis. The results showed that PrtA caused fusion proteins to be produced in 2× LB broth but not in normal LB medium. Regulation of PrtA production mediated by aeration and other degenerating factors that decreased TliA activity needs further investigation. The P. fluorescens ΔprtA and P. fluorescens ΔtliA ΔprtA strains can serve as tools for further exploration of these phenomena. Absence of the major degradation factor PrtA allows us to obtain a more general understanding of how secreted proteins are processed in extracellular medium. Use of the P. fluorescens ΔtliA ΔprtA strain simplified purification of recombinant proteins and generated a higher protein production yield. From this research, we expect that the P. fluorescens ΔtliA ΔprtA double deletion mutant will be used as a PMF using ABC transporters.