Skip to main content
PLOS One logoLink to PLOS One
. 2012 Nov 15;7(11):e49811. doi: 10.1371/journal.pone.0049811

Identification of MicroRNAs from Eugenia uniflora by High-Throughput Sequencing and Bioinformatics Analysis

Frank Guzman 1,2, Mauricio P Almerão 2, Ana P Körbes 1, Guilherme Loss-Morais 2, Rogerio Margis 1,2,3,*
Editor: Abidur Rahman4
PMCID: PMC3499529  PMID: 23166775

Abstract

Background

microRNAs or miRNAs are small non-coding regulatory RNAs that play important functions in the regulation of gene expression at the post-transcriptional level by targeting mRNAs for degradation or inhibiting protein translation. Eugenia uniflora is a plant native to tropical America with pharmacological and ecological importance, and there have been no previous studies concerning its gene expression and regulation. To date, no miRNAs have been reported in Myrtaceae species.

Results

Small RNA and RNA-seq libraries were constructed to identify miRNAs and pre-miRNAs in Eugenia uniflora. Solexa technology was used to perform high throughput sequencing of the library, and the data obtained were analyzed using bioinformatics tools. From 14,489,131 small RNA clean reads, we obtained 1,852,722 mature miRNA sequences representing 45 conserved families that have been identified in other plant species. Further analysis using contigs assembled from RNA-seq allowed the prediction of secondary structures of 25 known and 17 novel pre-miRNAs. The expression of twenty-seven identified miRNAs was also validated using RT-PCR assays. Potential targets were predicted for the most abundant mature miRNAs in the identified pre-miRNAs based on sequence homology.

Conclusions

This study is the first large scale identification of miRNAs and their potential targets from a species of the Myrtaceae family without genomic sequence resources. Our study provides more information about the evolutionary conservation of the regulatory network of miRNAs in plants and highlights species-specific miRNAs.

Introduction

Eugenia uniflora is a tropical fruit tree native to South America. The shrubby tree produces edible cherry-like fruits, which are locally known as pitanga or the Brazilian cherry. This species belongs to the Myrtaceae family, which is characterized by the presence of tannins, flavonoids, monoterpenes and sesquiterpenes whose presence and concentration varies between specimens from different geographical locations [1]–[3]. Extracts from pitanga leaves contain interesting biological properties that have been reported in several studies, and pitanga juice is used in folk medicine as a diuretic, antirheumatic, antipyretic, antidiarrhetic and antidiabetic [4]–[9]. E. uniflora is also an important ecological model to study because it grows in areas of medium and large levels of rainfall and can also be found in different vegetation types and ecosystems [10]. The variation in the metabolite concentration and the adaptability to different environments observed in E. uniflora indicating that these are the result of the transcriptional regulation of many genes involved in metabolic and signaling pathways.

MicroRNAs (miRNAs) are small non-coding regulatory RNAs widely found in unicellular and multicellular organisms that act as regulators of gene expression at the post-transcriptional level on genes containing miRNA target sites [11]. Mature miRNAs are single-stranded RNA molecules of approximately 21 nucleotides (nt) in length processed from a precursor molecule (pre-miRNA) [12]. To regulate protein-coding genes, the mature miRNA binds with perfect or imperfect complementarity to sites in the 5′ or 3′ untranslated regions (UTR) or coding sequences (CDS) of genes, which leads to mRNA degradation or translation inhibition [13]–[14]. In plants, miRNAs have diverse biological functions and are involved in the regulation of optimal growth and development as well as other physiological processes, including abiotic and biotic stress responses [15]. Several studies showed that many miRNAs are conserved across different plant families [16]–[17]. However, family- and species-specific miRNAs that are expressed in lower levels and probably have evolved more recently have been reported [18].

In the present study, in order to evaluate the importance of miRNAs in the regulation of gene expression and metabolic pathways in E. uniflora, we constructed small RNA (sRNA) and polyA RNA-seq libraries from leaves and sequenced the libraries with high throughput Solexa technology. The sequencing data were analyzed to identify conserved and novel miRNAs and their respective targets. This work represents the first report of miRNAs identified in Myrtaceae.

Methods

Plant Material and RNA Isolation

Total RNA was isolated from E. uniflora leaves using the CTAB method [19]. RNA quality was evaluated by electrophoresis on a 1% agarose gel, and quantification was determined using a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA).

Deep Sequencing

Total RNA (>10 µg) was sent to Fasteris SA (Plan-les-Ouates, Switzerland) for processing. One sRNA library was constructed and sequenced using the Illumina HiSeq2000 platform. Briefly, the construction of the sRNA library consisted of the following successive steps: acrylamide gel purification of the RNA bands corresponding to a size range of 20–30 nt; ligation of the 3p and 5p adapters to the RNA in two separate subsequent steps, each followed by acrylamide gel purification; cDNA synthesis followed by acrylamide gel purification; and a final step of PCR amplification to generate a cDNA colony template library for Illumina sequencing.

The polyadenylated transcript sequencing (RNA-seq) was performed using the following successive steps: poly-A purification; cDNA synthesis using a poly-T primer shotgun method to generate inserts of 500 nt, 3p and 5p adapter ligations; pre-amplification; colony generation; and sequencing. The Illumina output data included sequence tags of 100 bases.

Accession Numbers

Sequencing data are available at the NCBI Gene Expression Omnibus (GEO) ([http://www.ncbi.nlm.nih.gov/geo]). The accession number GSE38212 contains the sequence data from the RNA-seq and sRNA libraries derived from E. uniflora leaves.

Data Analysis

The overall procedure for analyzing Illumina small libraries is shown in Figure S1. All low quality reads with FASTq values below 13 were removed, and 5′ and 3′ adapter sequences were trimmed using the Genome Analyzer Pipeline (Illumina) at Fasteris SA. The remaining low quality reads with ‘n’ were removed with PrinSeq script [20]. Sequences shorter than 18 nt and larger than 25 nt were excluded from further analysis. Small RNAs derived from Viridiplantae rRNAs, tRNAs, snRNAs and snoRNAs deposited at the tRNAdb [21], SILVA rRNA [22], and NONCODE v3.0 [23] databases and from Rosales mtDNA and cpDNA sequences deposited at the NCBI GenBank database [(http://ftp.ncbi.nlm.nih.gov)] were identified by mapping with Bowtie [24].

After cleaning the data (low quality reads, adapter sequences), the RNA-seq data were assembled into contigs using the CLC Genome Workbench version 4.0.2 (CLCbio, Aarhus, Denmark) algorithm for de novo sequence assembly using the default parameters (similarity = 0.8, length fraction = 0.5, insertion/deletion cost = 3, mismatch cost = 3). In total, 170,568 contigs were assembled and used as a reference for the discovery of pre-miRNA and target sequences.

Identification of Conserved and Novel miRNAs

In order to determine conserved plant miRNAs, small RNA sequences were aligned with known non-redundant Magnoliophyta miRNAs deposited at miRBase (Release 18, November 2011) using Bowtie. Complete alignment of the sequences was required, and no mismatches were allowed. To search for novel miRNAs, small RNA sequences were matched against contigs obtained through de novo assembly of transcripts from mRNA sequences of E. uniflora leaves using SOAP2 [25]. The SOAP2 output was filtered with an in-house filter tool (FilterPrecursor) to identify candidate sequences as miRNA precursors using an anchoring pattern of one or two blocks of aligned small RNAs with perfect matches. The selected candidate precursors were manually inspected using the software Tablet [26] to visualize the presence of the anchoring pattern. As miRNA precursors have a characteristic hairpin structure, the next step to select candidate sequences included secondary structure analysis by RNAfold with the annotation algorithm from the UEA sRNA toolkit [27]. In addition, perfect stem-loop structures should have the miRNA sequence at one arm of the stem and a respective anti-sense sequence at the opposite arm. In the present study miRNAs were named in two different ways: (i) miR000, when corresponding to a family with two or more miRNA loci and (ii) MIR000, to design a single locus. Finally, precursor candidate sequences were checked using the BLAST algorithm from miRBase (www.mirbase.org).

Validation of miRNA by RT-PCR

In order to validate predicted miRNAs, a series of RT-PCR were performed in RNA isolated from leaves of three individuals of E. uniflora occurring in the Grumari native protected area in Rio de Janeiro, Brazil. Among the analyzed miRNAs seventeen corresponded to conserved miRNAs (eun-MIR156, eun-MIR159, eun-MIR160, eun-MIR166, eun-MIR167-1, eun-MIR167-2, eun-MIR167-3, eun-MIR167-4, eun-MIR395, eun-MIR396-1, eun-MIR396-2, eun-MIR397-1, eun-MIR397-2, eun-MIR482-1, eun-MIR482-2, eun-MIR530, eun-MIR827) and ten were novel miRNAs (eun-MIR001-1, eun-MIR001-2, eun-MIR004-2, eun-MIR005, eun-MIR006, eun-MIR008, eun-MIR009, eun-MIR012, eun-MIR013, eun-MIR014). The stem-loop primer, used for miRNA cDNA synthesis, was designed according to Cheng et al. [28]. The forward miRNAs primers were designed based on the full mature miRNA sequences and the reverse primer was the universal reverse primer for miRNA. The RT-PCR was performed according the conditions used by Kulcheski et al. [29]. Briefly, reactions were completed in a volume of 20 µL containing 10 µL of diluted cDNA (1∶100), 0.025 mM dNTP, 1X PCR Buffer, 3 mM MgCl2, 0.25 U Hot Start Taq DNA Polymerase (Promega) and 200 nM of each reverse and forward primer. Samples were analyzed in biological triplicate in a 96-well plate, and a no-template control was included. The PCR conditions were performed in an ABI 7500 Real-Time PCR System (Applied Biosystems). The PCR products were resolved on a 2% agarose gel and analyzed using Quantity One software (Bio-Rad).

Prediction of miRNA Targets

Previously assembled mRNA contigs were clustered using the Gene Indices Clustering Tools (http://compbio.dfci.harvard.edu/tgi/software/) [30] to reduce any sequence redundancy. The clustering output was passed to the CAP3 assembler [31] for multiple alignment and consensus building. Contigs that did not reach the set threshold and fell into any assembly remained as a list of singletons.

The prediction of target genes for the most abundant mature miRNAs from the conserved and novel pre-miRNAs was performed by psRNAtarget [32]. The program uses a 0–5 scale to indicate the complementarity between miRNA and their target, with the smaller numbers representing higher complementary and zero corresponding to a perfect complementation. Default parameters with an expectation value of 4 and E. uniflora assembled unigenes longer than 600 bp were used. Candidate RNA sequences were then annotated by assignment of putative gene descriptions based on sequence similarity with previously identified genes annotated with details deposited in the protein database of NR and the Swiss-Prot/Uniprot protein database using BLASTx implemented in blast2GO v2.3.5 software [33]. The annotation was improved by the analysis of conserved domains/families using the InterProScan tool and Gene Ontology terms as determined by the GOslim tool from blast2GO software. At the same time, the orientations of the transcripts were obtained from BLAST annotations.

Finally, to verify if the genes targeted by the identified miRNAs regulate any metabolic pathways involved in the secondary metabolites synthesis, we obtained the enzyme EC numbers for each target gene from the blast2GO annotation. These codes were uploaded to iPATH2 server [34] to generate metabolic pathway maps.

Results

E. uniflora RNA Library Sequencing

To identify conserved and novel miRNAs in E. uniflora, sRNA library was constructed from leaves and sequenced using Solexa high-throughput technology. After removing low quality sequences, those without inserts, or those with adapter contaminants or lengths outside of the 18–25 nt range, a total of 14,849,131 reads were obtained (Table 1). The number of reads with different lengths in the redundant and non-redundant sRNA datasets is shown in Figure 1 and Table S1. The most abundant sRNA species contained 21 nt, whereas the highest sequence diversity was observed in the 24-nt fraction. Approximately 6.55% of the reads matched other types of non-coding sRNAs, such as rRNAs, tRNAs, snRNAs or snoRNAs, and 9.45% matched organellar DNA (Table 2).

Table 1. Summary of data from sequencing of E. uniflora small RNA library.

Type Number of reads Percentage (%)
Total reads* 14,849,131 100
18–25 nt 12,759,506 86
<18 nt 1,554,975 10
>25 nt 534,650 4
*

Reads with high quality with lenghts of 1 to 44 nt.

Figure 1. Length distribution and diversity of small RNA reads in the E. uniflora leaf library.

Figure 1

Table 2. Categorization of E. uniflora noncoding and organellar small RNAs*.

Small RNA type Number of reads Percentage (%)
miRNA 1,852,722 14.52%
rRNA 765,989 6.00%
tRNA 67,491 0.53%
snRNA 1,555 0.01%
snoRNA 859 0.01%
mtRNA 159,106 1.25%
cpRNA 1,046,305 8.20%
Other sRNA 8,865,479 69.48%
*

18–25 nt reads considered.

As there is no genome sequence available for E. uniflora, we sequenced the mRNA transcriptome of the E. uniflora leaf for use as a reference sequence in further analyses. The pooled mRNA-seq yielded 16,759,528 reads, which were imported into the CLC Genomics Workbench and de novo assembled into 170,568 contigs with an average length of 306 bp. Contigs and non-assembled reads with minimum lengths of 100 bp were further considered. The contigs ranged in size between the minimum set threshold of 100 bp and 7,808 bp (N50 = 447 bp), with 22,308 contigs more than 500 bp in length.

Identification of Conserved miRNAs in E. uniflora

There are 4,677 miRNAs from 47 Magnoliophyta species deposited in miRBase. To identify conserved miRNAs in E. uniflora, the small RNA library was matched against a set of 2,585 unique, mature plant miRNA sequences from the database. In total, 1,852,722 reads perfectly matched 204 known miRNAs (Figure 2 and Table S2). All identified sequences are distributed in 45 miRNA families, with an average of approximately 4 miRNA members per family. The largest family was miR166 with 21 members, which include isoforms found in several plant species. The miR156 (19 members), miR396 (15 members) and miR395 (14 members) families were the second, third and fourth largest miRNA families, respectively. Of the remaining miRNA families, 23 contained 2 to 10 members, and 18 were represented by a single member (Figure 2).

Figure 2. Number of identified miRNAs in each conserved miRNA family in plants.

Figure 2

The values above the bars indicate the number of members identified in each conserved miRNA family.

With respect to the abundance of each miRNA family, the frequencies varied from 1 read (7 families) to 656,093 reads (miR167), indicating that expression varies significantly among different miRNA families. This relative abundance is also observed in certain members from the same family. For example, the abundance of miR167 varied from 98 to 616,862 reads, as was the case for some other families, such as miR166 (1 to 381,733 reads), miR159 (2 to 235,279 reads) and miR396 (2 to 217,485 reads). These results indicate that different members have variable expression levels within one miRNA family.

Since the genome of E. uniflora is not publically available, the small RNA library was matched against a set of de novo assembled contigs from the E. uniflora leaf RNA-seq to identify putative miRNA precursor sequences. Candidate sequences with hairpin-like structures and mature miRNAs anchored in either or both of the 5p or 3p arms were further considered (Figure S2). Initial analysis allowed for the identification of 25 precursor sequences grouped into 15 conserved families (Table 3). The average value of MFE was -66.51 in these precursors and included two precursors (MIR167-2 and MIR169) with extreme values due to their long sizes. With respect to the % GC and MFEI, the average values were 47.63 and −0.94, respectively.

Table 3. Pre-miRNAs identified in E. uniflora with sequence similarities to plant conserved miRNA families.

miRNA Precursor miRNA Mature miRNA
Contig code Length GC % MFE AMFE MFEI 5p sequence more abundant Read count 3p more abundant sequence Read count Total reads
eun-MIR156 Contig92889 97 54.64 −55.20 −56.91 −1.04 TTGACAGAAGATAGAGAGCAC 83933 GCTCTCCCTCTCCTGTCAACA 1 85396
eun-MIR159 Contig93245 163 45.40 −55.86 −34.27 −0.75 AGCTGCTGGTCTATGGATCCC 376 CTTGCATATGCCAGGAGCTTC 493 1302
eun-MIR160 Contig81816 116 53.45 −54.30 −46.81 −0.88 TGCCTGGCTCCCTGTATGCCA 293 GCGTATGAGGAGCCAAGCATA 22 323
eun-MIR162 Contig165400 108 48.15 −35.80 −33.15 −0.69 GGAGGCAGCGGTTCATCGATC 24 TCGATAAACCTCTGCATCCAG 10713 10884
eun-MIR166 Contig94223 228 43.42 −72.40 −31.75 −0.73 GGAATGTTGTCTGGCTCGAGG 11016 TCGGACCAGGCTTCATTCCCC 381733 409546
eun-MIR167-1 Contig126350 90 45.56 −50.00 −55.56 −1.22 TGAAGCTGCCAGCATGATCTGA 616862 AGATCATCTGGCAGTTTCAAC 262 620306
eun-MIR167-2 Contig163487 615 37.40 −163.60 −26.60 −0.71 TGAAGCTGCCAGCATGATCTGG 32188 TCAGGTCATCTTGCAGCTTCA 939 34461
eun-MIR167-3 Contig784s 81 48.15 −38.60 −47.65 −0.99 TGAAGCTGCCAGCGTGATCTCA 16305 ATCAGATCATGTGGCAGCTTCACC 73 22056
eun-MIR1674 Contig784a 81 48.15 −38.70 −47.78 −0.99 TGAAGCTGCCACATGATCTGA 71 ND − 72
eun-MIR169 Contig142088 730 39.18 −160.80 −22.03 −0.56 TTATAGGCGATTGGAGGTATG 876 TTAGCTAAAGTCGTCTTGCCCA 6818 8961
eun-MIR172-1 Contig83802 122 47.54 −55.10 −45.16 −0.95 CAGGTGTAGCATCATCAAGAT 36 AGAATCTTGATGATGCTGCAT 495 1076
eun-MIR172-2 Contig113567 92 42.39 −39.70 −43.15 −1.02 GCAGCATCATCAAGATTCACA 12 AGAATCTTGATGATGCTGCAT 495 523
eun-MIR172-3 Contig85928 165 43.64 −71.20 −43.15 −0.99 GTAGCATCATCAAGATTCACA 33 AGAATCTTGATGATGCTGCAT 495 1048
eun-MIR395 Contig114717 88 51.14 −47.50 −53.98 −1.06 TCCCCTAGAGTTCTCCTGAACA 107 ATGAAGTGTTTGGGGGAACTC 1356 1659
eun-MIR396-1 Contig94388 160 42.50 −68.60 −42.88 −1.01 TTCCACGGCTTTCTTGAACTG 217485 GTTCAATAAAGCTGTGGGAAG 2028 223828
eun-MIR396-2 Contig153308 128 42.19 −49.10 −38.36 −0.91 TTCCACAGCTTTCTTGAACTG 23061 GTTCAAGCTAGCTGTGGGAAG 12981 64439
eun-MIR397-1 Contig87345s 126 51.59 −68.80 −54.60 −1.06 TCATTGAGTGCAGCGTTGAT 626 CGGTTTCGACAGCGCTGCACT 59 1052
eun-MIR397-2 Contig87345a 126 51.59 −63.20 −50.16 −0.97 TGCAGCGCTGTCGAAACCGAT 20 TCAACGCTGCACTCAATGATG 273 322
eun-MIR482-1 Contig88445 153 53.90 −94.60 −61.43 −1.14 CATGGGTTGTTTGGTGAGAGG 24202 TCTTGCCAATACCACCCATGCC 70833 100235
eun-MIR482-2 Contig88445 139 53.96 −71.00 −51.08 −0.95 GAAATGGGAGGGTGGGAAAGA 982 TTTCCTATTCCTCCCATTCCAT 3371 5574
eun-MIR482-3 Contig85065 169 50.89 −92.40 −54.67 −1.07 GAGATTCGAGCTACCGGAAGTTGTG 329 TTCCCAAGGCCGCCCATTCCGA 14915 17039
eun-MIR530 Contig18750 183 51.37 −82.30 −44.97 −0.88 TCTGCATTTGCACCTGCACCT 185 AGGTGCGGGTGCAGGTGCAGA 12 280
eun-MIR535-1 Contig68094 102 50.00 −42.60 −41.76 −0.84 TGACAACGAGAGAGAGCACGC 62562 GTGCTCTCTATCGCTGTCATA 4199 76334
eun-MIR535-2 Contig71803 100 49.00 −47.00 −47.00 −0.96 TGACAACGAGAGAGAGCACGC 62562 TGCTCTCTACCGTTGTCATG 116 72263
eun-MIR827 Contig93928 81 45.68 −44.30 −54.69 −1.20 CTTTGTTGATGGCCATCTAATC 27 TTAGATGACCATCAGCGAACA 266 304

MFE: minimal folding free energy (kcal/mol); AMFE: Adjusted MFE; MFEI: minimal folding free energy index; ND: no detected.

Within the identified families, MIR167 was the most abundant, with 676,895 reads, and contained 4 members (MIR167-1, MIR167-2, MIR167-3 and MIR167-4). In addition, several miRNA isoforms were detected in the libraries, and several of these were more abundant than the known miRNAs reported in miRBase for other plants (Figure 3). Furthermore, in the family MIR397, one precursor was identified with a typical structure and mature reads in the sense and antisense orientations. Both orientations were considered two independent precursors from the same family for the following analysis.

Figure 3. Predicted secondary structures of conserved and novel miRNAs of E. uniflora.

Figure 3

Secondary structures of the precursors eun-MIR535-1 and eun-nMIR012, their locations and the expression of small RNAs mapped onto these precursors. Sequences of the most abundant mature miRNAs in the 5p and 3p arms are labeled in purple and red, respectively. Values on the left side of the miRNA sequence represent read counts in the leaf library.

Identification of Novel miRNAs in E. uniflora

Using the previously described criteria in the identification of conserved pre-miRNAs, we obtained another 17 potential miRNA candidates grouped into 15 families (Table 4). In addition to the hairpin structure, the detection of miRNA* in 14 precursors is a strong indication to consider these miRNAs as true candidates. Comparisons among the mature sequences of candidate miRNAs and those miRNAs deposited in miRBase suggest that these candidates are novel miRNAs that have not been identified in others species and are possibly specific to the Myrtaceae family. These novel miRNAs displayed an average negative folding value of −137.89, which included 4 miRNAs with long sizes similarly observed in some previously identified conserved pre-miRNAs. With respect to the % GC and MFEI, the average values were 42.86 and −1.05, respectively. In addition, one novel pre-miRNA was found with mature sequences in the sense and antisense orientations and was considered to represent 2 members of the same family (nMIR001-1 and −2).

Table 4. New putative miRNA precursors identified in E. uniflora.

miRNA Precursor miRNA Mature miRNA
Contig name Length GC % MFE AMFE MFEI 5p more abundant sequence Read count 3p more abundant sequence Read count Total reads
eun-nMIR001-1 Contig164780s 820 54.39 −451.70 −55.09 −1.01 TCGGCTGTCAATTTCTGGATT 185919 ATCCAGAAATTGGCAGCCGTT 110 192103
eun-nMIR001-2 Contig164780a 820 54.39 −446.00 −54.39 −1.00 CAATTTCTGGATTTCAGTTCG 20 TCGAACTGAAATCCAGAAATT 2 63
eun-nMIR002 Contig29785 173 30.06 −56.70 −32.77 −1.09 CGAAAAATGATTGGTTGTATCGCT 18 CGATCTAATCAATCATTTTTCGGG 2 21
eun-nMIR003 Contig121100 110 48.18 −63.20 −57.45 −1.19 TACTCGTTCCGTTGATCCATC 88 TGGATCAATAGAACGAGCAGGTGA 157 561
eun-nMIR004-1 Contig37387s 104 29.81 −47.10 −45.29 −1.52 TCGTAAATCCACTATATCTCT 3 TAGATATAGTGGATTTTCGAT 9 13
eun-nMIR004-2 Contig37387a 104 29.81 −46.40 −44.62 −1.50 ND − CAGAGATATAGTGGATTTACG 314 385
eun-nMIR005 Contig143563 106 34.91 −21.40 −20.19 −0.58 ND − GAGAATGATGAGTTAAATGGA 12 30
eun-nMIR006 Contig113617 113 33.63 −42.70 −37.79 −1.12 TCTCTGTTGATCTGATAAATA 19 TTTGTCGGATGAACAGGGAAT 18 55
eun-nMIR007 Contig116664r 96 46.88 −55.80 −58.13 −1.24 TAGGGTCAGATCGCTACTTAG 211 TAAGTGGTGATCTGACTCTAA 4446 5750
eun-nMIR008 Contig79716 426 43.66 −228.00 −53.52 −1.23 TCGAGCCCCTCCCACAGATTG 313 ATCTGTGGAAGAGACTCGACT 8403 13617
eun-nMIR009 Contig81320 1545 37.41 −397.90 −25.75 −0.69 TTCAAGTCTAACAACCTCAGCT 5774 TGGAGGTTGTTTGGCTTGAGCT 1968 11577
eun-nMIR010 Contig84248 350 48.86 −143.30 −40.94 −0.84 TGCTGTTCTTCCGTTCACGAAT 309 TCGTGAAGGAAGAATGTGCAAT 6340 10307
eun-nMIR011 Contig164559 207 51.21 −98.70 −47.68 −0.93 GCTCGAGGTCAGTTTGTCGCC 1553 CGGCAAACTGGACCTCGAGATC 110 2884
eun-nMIR012 Contig167957 164 35.98 −91.80 −55.98 −1.56 CATGTAACAAGTTGGCTGTCA 126 TTCATGGACAGCCAGCTTATT 3 243
eun-nMIR013 Contig87665 179 56.42 −84.90 −47.43 −0.84 TGAAGCAGATCAAGAACCCAG 155 TCTCGTTCCGCTTCATCTGAA 2 172
eun-nMIR014 Contig200629r 87 55.17 −23.40 −26.90 −0.49 ND − GCATCACTAGCTTACGCTCTG 30 159
eun-nMIR015 Contig165886 124 37.90 −45.10 −36.37 −0.96 ND − CAATGAACGCATTTGCAGGTG 21 22

MFE: minimal folding free energy (kcal/mol); AMFE: Adjusted MFE; MFEI: minimal folding free energy index; ND: no detected.

Biological Confirmation of Identified miRNAs in E. uniflora

The stem-loop RT-PCR method was used to validate the expression of seventeen conserved miRNAs (eun-MIR156, eun-MIR159, eun-MIR160, eun-MIR166, eun-MIR167-1, eun-MIR167-2, eun-MIR167-3, eun-MIR167-4, eun-MIR395, eun-MIR396-1, eun-MIR396-2, eun-MIR397-1, eun-MIR397-2, eun-MIR482-1, eun-MIR482-2, eun-MIR530, eun-MIR827) and ten novel miRNAs (eun-MIR001-1, eun-MIR001-2, eun-MIR004-2, eun-MIR005, eun-MIR006, eun-MIR008, eun-MIR009, eun-MIR012, eun-MIR013, eun-MIR014). We confirmed that these miRNAs were expressed in three different individuals collected in situ (Figure S3).

Identification and Classification of miRNA Targets

To understand the biological function of miRNAs in E. uniflora, the putative mRNA target sites of miRNA candidates were identified by aligning the most abundant mature miRNAs of each conserved and novel precursor to a set of E. uniflora assembled unigenes using psRNA target with default parameters and a maximum expectation value of 4. We found 87 potential targets in total, where 52 were targets of conserved miRNAs and 35 were targets of novel miRNAs, with an approximate average of 3 targets per miRNA. Detailed annotation results are given in Table 5 and S3.

Table 5. Predicted targets of novel miRNAs in E. uniflora.

miRNA Inhibition Score* Putative Function
eun-nMIR001 Cleavage 1.5 Atp-dependent helicase rhp16-like
Cleavage 3 Cytochrome p450
Cleavage 3.5 Long chain acyl- synthetase 9
Cleavage 3.5 Kinesin-related protein
Translation 3 Transcription initiation factor iib
Translation 3 Brassinazole-resistant 1
Translation 3.5 Myosin family protein with dil domain
eun-nMIR002 Cleavage 3 Serine threonine-protein phosphatase 2a regulatory subunit b subunit alpha-like
Cleavage 3.5 Probable receptor-like protein kinase at1g67000-like
eun-nMIR003 Cleavage 4 Udp-glycosyltransferase 74b1
eun-nMIR004 Cleavage 2.5 Auxin efflux carrier protein
Cleavage 3.5 Sucrose nonfermenting 4-like
Translation 3.5 Type i inositol- -trisphosphate 5-phosphatase 2-like
eun-nMIR005 Translation 3 Pentatricopeptide repeat-containing protein
Cleavage 3.5 Protein reticulata-related 1
Cleavage 3.5 Agenet domain-containing protein
eun-nMIR006 Translation 3.5 Outward rectifying potassium channel
eun-nMIR007 Cleavage 3.5 Aspartate semialdehyde
Cleavage 3 Primary-amine oxidase
eun-nMIR008 Translation 3.5 Adenosine deaminase
eun-nMIR009 Cleavage 3 Cc-nbs-lrr resistance protein
eun-nMIR010 Translation 4 P8mtcp1
Cleavage 4 Nbs-lrr resistance protein
Translation 4 Cullin-1-like isoform 1
eun-nMIR011 Translation 3 E3 ubiquitin-protein ligase upl7
Cleavage 3.5 Eukaryotic peptide chain release factor subunit 1-1
eun-nMIR012 Translation 3.5 Tho complex subunit 2
eun-nMIR013 Translation 3.5 Beta-amylase
Translation 3.5 Integral membrane single c2 domain protein
eun-nMIR014 Cleavage 0 Ycf68 protein
eun-nMIR015 Cleavage 3.5 Rna-binding motif x-linked 2
Cleavage 3.5 Transducin wd-40 repeat-containing protein
Cleavage 3.5 Clip-associating protein
Cleavage 3.5 Probable exocyst complex component 4-like
Cleavage 3.5 Photosystem i p700 apoprotein a1
*

psRNATarget value.

Among the most important miRNA targets, also previously identified in other plants, we found the squamosa promoter binding protein (SBP)-like (SPL) genes, which are targets of the miR156 family and have functions that are conserved across plant species [17], affecting diverse developmental processes, such as leaf development, shoot maturation, phase change and flowering in plants [35]-[40]. We also identified the auxin response factor (ARF), a plant-specific family of DNA binding proteins involved in hormone signal transduction that are targets for the miRNA families miR167 and miR160 [15], [41], [42]. Another important gene identified and targeted by miR162, with a significant role in the regulation of gene expression, is the pentatricopeptide repeat gene (PPR). This gene belongs to a large family implicated in post-transcriptional processes, such as splicing, editing, processing and translation specifically in organelles like mitochondria and chloroplasts [43]. These results substantiate the in silico identification of conserved and novel targets from E. uniflora.

All targets regulated by the conserved and novel miRNAs identified in this study were subjected to GO analysis to evaluate their potential functions. The categorization of these genes, according to biological processes, cellular components and molecular functions, is summarized in Figure 4. Based on biological processes, these targets were classified into 13 categories, and the three most overrepresented GO terms, either for conserved or novel miRNAs, were cellular processes, metabolic processes and responses to stimulus, suggesting that Eugenia miRNAs are involved in a broad range of physiological functions. Categories based on molecular function revealed that the target genes were related to 7 functions, and the four most frequent terms were protein binding, nucleotide binding, hydrolase activity and nucleic acid binding. In the category of cellular components, the analysis revealed that the protein products from the genes targeted by conserved and novel miRNAs are expressed mainly in the plastid and nucleus.

Figure 4. Gene categories and the distribution of target genes of the most abundant mature miRNAs in the conserved and novel pre-miRNA identified in E. uniflora.

Figure 4

The iPATH2 server was used to produce an overview of the metabolic pathways involved in the secondary metabolites synthesis and potentially regulated by miRNAs in E. uniflora. Our results showed that three enzymes involved in several types of metabolism and secondary metabolites are regulated by identified miRNAs (Figure S4). The phosphoglycerate mutase is a potential target of eun-MIR396-2 and is involved in the pathway of gluconeogenesis while the hydroxyphenylpyruvate reductase is targeted by eun-MIR162 and is involved in terpenoid-quinone, tropane, pireridine and pyridine biosynthesis. In a similar way, eun-nMIR007 regulates primary-amine oxidase, an enzyme involved in the tropane, pireridine, pyridine and isoquinoline alkaloid biosynthesis.

Discussion

Though several miRNAs have been identified via computational or experimental approaches in different plant families, there is no sequence or functional information available about miRNAs in any Myrtaceae species, which are economically important in the spice, fruit, timber and pharmacology industries [44].

We used Solexa technology for deep sequencing of a small RNA library to identify miRNAs in E. uniflora. The length distribution pattern obtained indicates that the majority of the redundant small RNAs from the library were 21 nt in length, which is atypical because 24 nt is the most abundant size produced by DCL3 in other plants [45]. This distribution pattern is similar to those observed in previous reports of plant small RNA sequencing using Solexa technology, such as wheat [46], grapevine [47], melon [48] and trifoliate orange [49], suggesting that the composition of the small RNA population varies among species. Additionally, other important causes for this variation include the developmental stage and environmental conditions in which the sample was collected. Contrary to the results observed with the redundant sequences, the analysis of the unique sequences showed that 24 nt was the dominant read length in comparison to all other sequence lengths, and similar results have been observed in other studies [50]-[53]. Small RNAs of 24 nt in length are known to be involved in heterochromatin transcriptional silencing in genomes with a high content of repetitive sequences [54], indicating the possible genome complexity of E. uniflora.

In this study, we compared our small RNA library from E. uniflora against known plant miRNAs from the miRBase database and identified 204 conserved miRNAs from different species grouped into 45 families. High throughput sequencing, which has the ability to generate millions of small RNA sequences, is a powerful tool to estimate expression profiles of miRNA. This technology provides the resources to determine the abundance of various miRNA families and even distinguish among different members of a given family. In our case, we found significant differences among the number and abundance of the members identified in each family, which is in agreement with previous studies [48], [55], [56] and suggests that this wide variation is due to a functional divergence in the conserved miRNA families.

Although conserved miRNAs have been identified by sequencing and comparison against miRNAs from other species, most plant species-specific miRNAs remain unidentified due to their lower levels of expression, which result in a small number of sequenced reads in comparison to the conserved miRNAs [57]. For this reason, we used a new approach to identify novel miRNAs in species where genomic data and resources were not available. We made use of simultaneous sequence comparison of small RNA and RNAseq libraries. Using this methodology, we identified 17 potential miRNA candidates specific for E. uniflora. From these, 14 contained complementary antisense miRNA, which provided more evidence for their existence as novel miRNAs, as observed in cucumber [51] and grapevine [53]. The other miRNAs that do not satisfy this last criterion require further investigation for their confirmation as miRNAs.

To understand the function of the identified miRNAs, their putative targets were predicted using a bioinformatics approach. Several identified targets of conserved miRNAs of E. uniflora are transcriptional factors, similar to the results reported in other studies [47], [48], [58], [59]. In the case of the novel miRNA targets, we found that the transcription initiation factor iib and the pentatricopeptide repeat-containing proteins are targeted by eun-nMIR001 and eun-nMIR005, respectively.

It has been reported in Arabidopsis that regulation of ARF17 by miR160 is important for growth and development [60], regulation of ARF6 and 8 by miR167 is important for development of anthers and ovules [61] and regulation of ARF10 and 16 by miR160 plays a role in root cap formation [62]. In the present study, we found that ARF17 is regulated by eun-MIR160 while other members of ARF family were not targeted by eun-MIR167. This discrepancy agrees with the previously reported in Arabidopsis because we used a leaf transcriptome as reference for the target identification. We confirm this observation not found homologs for AtARF6, 8, 10 and 16 by BLASTx in E. uniflora transcriptome.

In addition, with the analysis of GO terms, we identified 3 candidate targets likely involved in the response to abiotic stress: ATP-dependent helicase rhp16-like (eun-nMIR002), sucrose nonfermenting 4-like (eun-nMIR004) and serine threonine-protein phosphatase 2a regulatory subunit b'' subunit alpha-like (eun-nMIR002). The sucrose nonfermenting 4-like (SNF4) protein is a subunit of the probable trimeric SNF1-related protein kinase (SnRK) complex, which may play a role in a signal transduction cascade regulating gene expression and carbohydrate metabolism in higher plants [63]. Otherwise, the serine threonine-protein phosphatase 2A regulatory subunit b ''subunit alpha-like PP2Ab′′ is a structural subunit of the Ser/Thr phosphatases holoenzyme (PP2A) and recent studies suggesting the possible physiological role of PP2A in the drought stress response [64]. These results indicated that the targets from novel miRNAs identified here are possibly related to the adaptation of E. uniflora to different types of stress and environmental conditions observed in natura. Future experimental validation will determine how many of these predicted targets are genuinely targeted by miRNAs in specific environmental and physiological conditions.

Interestingly, we found three miRNAs involved in the regulation of enzymes that play critical roles in secondary metabolites synthesis. These findings suggest that variation in the levels of expression of these miRNAs could alter the levels of production of certain types of secondary metabolites. It is consistent with the previous reports that the concentration of these metabolites varies between specimens of E. uniflora from different geographical locations [2], [3]. More studies are necessary to confirm these preliminary findings and evaluate the correlation between the miRNA expression and secondary metabolite production.

Conclusions

In summary, this study provides the first view of the diversity of miRNAs and their abundance in Myrtaceae and strongly supports the idea that miRNAs play an important conserved role in several physiological processes, as previously proposed for other plants. Our bioinformatics analysis indicates that miRNAs might contribute to different processes by affecting multiple target genes and different signaling pathways. Although the exact function of these miRNA target genes remains to be confirmed, we believe the present study provides novel insights into the molecular processes involved in conserved miRNA function.

Supporting Information

Figure S1

Flow chart of procedures for miRNA identification.

(TIF)

Figure S2

Represetation of the predicted secondary structures of the conserved and novel miRNA precursors of E. uniflora and the locations of the more abundant mature miRNAs.

(PDF)

Figure S3

Detection of miRNA expression in different E. uniflora individuals by RT-PCR. Products generated by stem-loop RT-PCR were resolved on a 2% agarose. Leaf samples from three independent Eugenia uniflora trees were used to evaluate the presence of each miRNA.

(TIFF)

Figure S4

iPath secondary metabolite map showing the different pathways where are involved each evaluated enzyme. Each grey dot represents a metabolite and each colored line represents the different route affected by the enzyme targeted. In red: phosphoglycerate mutase (regulated by eun-MIR396-2). In blue: primary-amine oxidase (regulated by eun-nMIR007).

(TIFF)

Table S1

Length distribution and read sequence abundance in the E. uniflora small RNA library.

(XLS)

Table S2

Abundance of predicted plant conserved miRNAs in the small RNA library of E. uniflora .

(XLS)

Table S3

Predicted transcript targets of plant conserved miRNAs in E. uniflora .

(XLS)

Acknowledgments

The authors would like to thank Maria Elena Gonzalez for reviewing of the manuscript.

Funding Statement

This research was supported by grants from FAPERGS (Fundação de Amparo à Pesquisa do Estado do Rio Grande do Sul) and CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico). FG received a PhD fellowship from CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nivel Superior). APK, MPA and RM have PNPD/CAPES, PDJ/CNPq Research/CNPq fellowships, respectively. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Burt S (2004) Essential oils: their antibacterial properties and potential applications in foods–a review. International journal of food microbiology 94: 223–253. [DOI] [PubMed] [Google Scholar]
  • 2. Lago JHG, Souza ED, Mariane B, Pascon R, Vallim M a, et al. (2011) Chemical and biological evaluation of essential oils from two species of Myrtaceae - Eugenia uniflora L. and Plinia trunciflora (O. Berg) Kausel. Molecules 16: 9827–9837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Victoria FN, Lenardão EJ, Savegnago L, Perin G, Jacob RG, et al. (2012) Essential oil of the leaves of Eugenia uniflora L.: antioxidant and antimicrobial properties. Food and chemical toxicology 50: 2668–2674. [DOI] [PubMed] [Google Scholar]
  • 4. Arai I, Amagaya S, Komatsu Y, Okada M, Hayashi T, et al. (1999) Improving effects of the extracts from Eugenia uniflora on hyperglycemia and hypertriglyceridemia in mice. Journal of Ethnopharmacology 68: 307–314. [DOI] [PubMed] [Google Scholar]
  • 5. Consolini a E, Baldini O a, Amat a G (1999) Pharmacological basis for the empirical use of Eugenia uniflora L. (Myrtaceae) as antihypertensive. Journal of Ethnopharmacology 66: 33–39. [DOI] [PubMed] [Google Scholar]
  • 6. Matsumura T, Kasai M, Hayashi T, Arisawa M, Momose Y, et al. (2000) α-glucosidase inhibitors from Paraguayan natural medicine, ñangapiry, the leaves of Eugenia uniflora . Pharmaceutical Biology 38: 302–307. [DOI] [PubMed] [Google Scholar]
  • 7. Ogunwande I, Olawore N, Ekundayo O, Walker T, Schmidt J, et al. (2005) Studies on the essential oils composition, antibacterial and cytotoxicity of Eugenia uniflora L. International Journal of Aromatherapy. 15: 147–152. [Google Scholar]
  • 8. Luzia DM, Bertanha BJ, Jorge N (2010) Pitanga (Eugenia uniflora L.) seeds?: antioxidant potential and fatty acids profile. Revista do Instituto Adolfo Luz 69: 175–180. [Google Scholar]
  • 9.Santos KK a, Matias EFF, Tintino SR, Souza CES, Braga MFBM, et al. (2012) Anti-Trypanosoma cruzi and cytotoxic activities of Eugenia uniflora L. Experimental Parasitology. [DOI] [PubMed]
  • 10. Almeida DJ, Faria MV, Da Silva PR (2012) Biologia experimental em Pitangueira: uma revisão de cinco décadas de publicações científicas. Ambiência Guarapuava (PR) 8: 159–175. [Google Scholar]
  • 11. Mallory AC, Vaucheret H (2006) Functions of microRNAs and related small RNAs in plants. Nature Genetics 38 Suppl: S31–6 [DOI] [PubMed] [Google Scholar]
  • 12. Denli AM, Tops BBJ, Plasterk RH a, Ketting RF, Hannon GJ (2004) Processing of primary microRNAs by the Microprocessor complex. Nature 432: 231–235. [DOI] [PubMed] [Google Scholar]
  • 13. Bushati N, Cohen SM (2007) MicroRNA functions. Annual Review of Cell and Developmental Biology 23: 175–205. [DOI] [PubMed] [Google Scholar]
  • 14.Axtell MJ, Westholm JO, Lai EC (2011) Vive la différence: biogenesis and evolution of microRNAs in plants and animals: 1–13. [DOI] [PMC free article] [PubMed]
  • 15. Sunkar R, Li Y-F, Jagadeeswaran G (2012) Functions of microRNAs in plant stress responses. Trends in Plant Science 17: 196–203. [DOI] [PubMed] [Google Scholar]
  • 16. Dezulian T, Palatnik JF, Huson D, Weigel D (2005) Conservation and divergence of microRNA families in plants. Bioinformatics 6: P13. [Google Scholar]
  • 17. Jones-Rhoades MW, Bartel DP, Bartel B (2006) MicroRNAS and their regulatory roles in plants. Annual Review of Plant Biology 57: 19–53. [DOI] [PubMed] [Google Scholar]
  • 18. Allen E, Xie Z, Gustafson AM, Sung G-H, Spatafora JW, et al. (2004) Evolution of microRNA genes by inverted duplication of target gene sequences in Arabidopsis thaliana . Nature Genetics 36: 1282–1290. [DOI] [PubMed] [Google Scholar]
  • 19. Gambino G, Perrone I, Gribaudo I (2008) A Rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochemical Analysis 19: 520–525. [DOI] [PubMed] [Google Scholar]
  • 20. Schmieder R, Edwards R (2011) Quality control and preprocessing of metagenomic datasets. Bioinformatics 27: 863–864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Jühling F, Mörl M, Hartmann RK, Sprinzl M, Stadler PF, et al. (2009) tRNAdb 2009: compilation of tRNA sequences and tRNA genes. Nucleic Acids Research 37: D159–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig W, et al. (2007) SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Research 35: 7188–7196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. He S, Liu C, Skogerbø G, Zhao H, Wang J, et al. (2008) NONCODE v2.0: decoding the non-coding. Nucleic Acids Research 36: D170–2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Langmead B, Trapnell C, Pop M, Salzberg SL (2009) Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10: R25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Li R, Yu C, Li Y, Lam T-W, Yiu S-M, et al. (2009) SOAP2: an improved ultrafast tool for short read alignment. Bioinformatics 25: 1966–1967. [DOI] [PubMed] [Google Scholar]
  • 26. Milne I, Bayer M, Cardle L, Shaw P, Stephen G, et al. (2010) Tablet–next generation sequence assembly visualization. Bioinformatics 26: 401–402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Moxon S, Schwach F, Dalmay T, Maclean D, Studholme DJ, et al. (2008) A toolkit for analysing large-scale plant small RNA datasets. Bioinformatics 24: 2252–2253. [DOI] [PubMed] [Google Scholar]
  • 28. Chen C, Ridzon D a, Broomer AJ, Zhou Z, Lee DH, et al. (2005) Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic acids research 33: e179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues F, et al. (2011) Identification of novel soybean microRNAs involved in abiotic and biotic stresses. BMC genomics 12: 307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Pertea G, Huang X, Liang F, Antonescu V, Sultana R, et al. (2003) TIGR Gene Indices clustering tools (TGICL): a software system for fast clustering of large EST datasets. Bioinformatics 19: 651–652. [DOI] [PubMed] [Google Scholar]
  • 31. Huang X, Madan A (1999) CAP3: A DNA sequence assembly program. Genome research 9: 868–877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Dai X, Zhao PX (2011) psRNATarget: a plant small RNA target analysis server. Nucleic Acids Research 39: W155–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Conesa A, Götz S (2008) Blast2GO: A comprehensive suite for functional analysis in plant genomics. International Journal of Plant Genomics 2008: 619832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Yamada T, Letunic I, Okuda S, Kanehisa M, Bork P (2011) iPath2.0: interactive pathway explorer. Nucleic acids research 39: W412–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Poethig RS (2009) Small RNAs and developmental timing in plants. Current Opinion in Genetics & Development 19: 374–378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Wu G, Park MY, Conway SR, Wang J-W, Weigel D, et al. (2009) The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis . Cell 138: 750–759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Schwarz S, Grande AV, Bujdoso N, Saedler H, Huijser P (2008) The microRNA regulated SBP-box genes SPL9 and SPL15 control shoot maturation in Arabidopsis . Plant Molecular Biology 67: 183–195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Shikata M, Koyama T, Mitsuda N, Ohme-Takagi M (2009) Arabidopsis SBP-box genes SPL10, SPL11 and SPL2 control morphological change in association with shoot maturation in the reproductive phase. Plant & Cell Physiology 50: 2133–2145. [DOI] [PubMed] [Google Scholar]
  • 39. Xie K, Wu C, Xiong L (2006) Genomic organization, differential expression, and interaction of SQUAMOSA promoter-binding-like transcription factors and microRNA156 in rice. Plant Physiology 142: 280–293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Chuck G, Cigan a M, Saeteurn K, Hake S (2007) The heterochronic maize mutant Corngrass1 results from overexpression of a tandem microRNA. Nature Genetics 39: 544–549. [DOI] [PubMed] [Google Scholar]
  • 41. Wu M-F, Tian Q, Reed JW (2006) Arabidopsis microRNA167 controls patterns of ARF6 and ARF8 expression, and regulates both female and male reproduction. Development 133: 4211–4218. [DOI] [PubMed] [Google Scholar]
  • 42. Yang JH, Han SJ, Yoon EK, Lee WS (2006) “Evidence of an auxin signal pathway, microRNA167-ARF8-GH3, and its response to exogenous auxin in cultured rice cells.”. Nucleic Acids Research 34: 1892–1899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Fujii S, Small I (2011) The evolution of RNA editing and pentatricopeptide repeat genes. The New phytologist 191: 37–47. [DOI] [PubMed] [Google Scholar]
  • 44. Okoh-Esene Rosemary, Husseini Suleiman AT (2011) Proximate and phytochemical analysis of leaf, stem and root of Eugenia uniflora (Surinam or Pitanga cherry). Journal of Natural Product and Plant Resources 1: 1–4. [Google Scholar]
  • 45. Xie Z, Johansen LK, Gustafson AM, Kasschau KD, Lellis AD, et al. (2004) Genetic and functional diversification of small RNA pathways in plants. PLoS Biology 2: E104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Yao Y, Guo G, Ni Z, Sunkar R, Du J, et al. (2007) Cloning and characterization of microRNAs from wheat (Triticum aestivum L.). Genome Biology 8: R96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, et al. (2010) Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis. The Plant Journal 62: 960–976. [DOI] [PubMed] [Google Scholar]
  • 48. Gonzalez-Ibeas D, Blanca J, Donaire L, Saladié M, Mascarell-Creus A, et al. (2011) Analysis of the melon (Cucumis melo) small RNAome by high-throughput pyrosequencing. BMC Genomics 12: 393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Zhang J-Z, Ai X-Y, Guo W-W, Peng S-A, Deng X-X, et al. (2011) Identification of miRNAs and Their Target Genes Using Deep Sequencing and Degradome Analysis in Trifoliate Orange [Poncirus trifoliate (L.) Raf]. Molecular Biotechnology: 44–57. [DOI] [PubMed]
  • 50. Song C, Wang C, Zhang C, Korir NK, Yu H, et al. (2010) Deep sequencing discovery of novel and conserved microRNAs in trifoliate orange (Citrus trifoliata). BMC Genomics 11: 431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Martínez G, Forment J, Llave C, Pallás V, Gómez G (2011) High-throughput sequencing, characterization and detection of new and conserved cucumber miRNAs. PloS One 6: e19523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Schreiber AW, Shi B-J, Huang C-Y, Langridge P, Baumann U (2011) Discovery of barley miRNAs through deep sequencing of short reads. BMC Genomics 12: 129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Wang C, Wang X, Kibet NK, Song C, Zhang C, et al. (2011) Deep sequencing of grapevine flower and berry short RNA library for discovery of novel microRNAs and validation of precise sequences of grapevine microRNAs deposited in miRBase. Physiologia Plantarum 143: 64–81. [DOI] [PubMed] [Google Scholar]
  • 54. Simon S a, Meyers BC (2011) Small RNA-mediated epigenetic modifications in plants. Current Opinion in Plant Biology 14: 148–155. [DOI] [PubMed] [Google Scholar]
  • 55. Zhao C-Z, Xia H, Frazier TP, Yao Y-Y, Bi Y-P, et al. (2010) Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.). BMC Plant Biology 10: 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Puzey JR, Karger A, Axtell M, Kramer EM (2012) Deep Annotation of Populus trichocarpa microRNAs from Diverse Tissue Sets. PloS One 7: e33034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, et al. (2007) High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes. PloS One 2: e219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Colaiacovo M, Subacchi A, Bagnaresi P, Lamontanara A, Cattivelli L, et al. (2010) A computational-based update on microRNAs and their targets in barley (Hordeum vulgare L.). BMC Genomics 11: 595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Lv S, Nie X, Wang L, Du X, Biradar SS, et al. (2012) Identification and Characterization of MicroRNAs from Barley (Hordeum vulgare L.) by High-Throughput Sequencing. International Journal of Molecular Sciences 13: 2973–2984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, et al. (2002) Prediction of plant microRNA targets. Cell 110: 513–520. [DOI] [PubMed] [Google Scholar]
  • 61. Wu M-F, Tian Q, Reed JW (2006) Arabidopsis microRNA167 controls patterns of ARF6 and ARF8 expression, and regulates both female and male reproduction. Development 133: 4211–4218. [DOI] [PubMed] [Google Scholar]
  • 62. Wang J, Wang L, Mao Y, Cai W, Xue H, et al. (2005) Control of Root Cap Formation by MicroRNA-Targeted Auxin Response Factors in Arabidopsis . The Plant Cell 17: 2204–2216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Kleinow T, Bhalerao R, Breuer F, Umeda M, Salchert K, et al. (2000) Functional identification of an Arabidopsis snf4 ortholog by screening for heterologous multicopy suppressors of snf4 deficiency in yeast. 23: 115–122. [DOI] [PubMed] [Google Scholar]
  • 64. Xu C, Jing R, Mao X, Jia X, Chang × (2007) A wheat (Triticum aestivum) protein phosphatase 2A catalytic subunit gene provides enhanced drought tolerance in tobacco. Annals of botany 99: 439–450. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Flow chart of procedures for miRNA identification.

(TIF)

Figure S2

Represetation of the predicted secondary structures of the conserved and novel miRNA precursors of E. uniflora and the locations of the more abundant mature miRNAs.

(PDF)

Figure S3

Detection of miRNA expression in different E. uniflora individuals by RT-PCR. Products generated by stem-loop RT-PCR were resolved on a 2% agarose. Leaf samples from three independent Eugenia uniflora trees were used to evaluate the presence of each miRNA.

(TIFF)

Figure S4

iPath secondary metabolite map showing the different pathways where are involved each evaluated enzyme. Each grey dot represents a metabolite and each colored line represents the different route affected by the enzyme targeted. In red: phosphoglycerate mutase (regulated by eun-MIR396-2). In blue: primary-amine oxidase (regulated by eun-nMIR007).

(TIFF)

Table S1

Length distribution and read sequence abundance in the E. uniflora small RNA library.

(XLS)

Table S2

Abundance of predicted plant conserved miRNAs in the small RNA library of E. uniflora .

(XLS)

Table S3

Predicted transcript targets of plant conserved miRNAs in E. uniflora .

(XLS)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES