Abstract
Traumatic brain injury (TBI) results in complex pathological reactions, the initial lesion worsened by secondary inflammation and edema. Angiotensin II (Ang II) is produced in the brain and Ang II receptor type 1 (AT1R) overstimulation produces vasoconstriction and inflammation. Ang II receptor blockers (ARBs) are neuroprotective in models of stroke but little is known of their effect when administered in TBI models. We therefore performed controlled cortical impact (CCI) injury on mice to investigate whether the ARB candesartan would mitigate any effects of TBI. We administered candesartan or vehicle to mice 5 h before CCI injury. Candesartan treatment reduced the lesion volume after CCI injury by approximately 50%, decreased the number of dying neurons, lessened the number of activated microglial cells, protected cerebral blood flow (CBF), and reduced the expression of the cytokine TGFβ1 while increasing expression of TGFβ3. Candesartan-treated mice also showed better motor skills on the rotarod 3 days after injury, and improved performance in the Morris water maze 4 weeks after injury. These results indicate that candesartan is neuroprotective, reducing neuronal injury, decreasing lesion volume and microglial activation, protecting CBF and improving functional behavior in a mouse model of TBI. Co-treatment with a peroxisome proliferator-activated receptor-gamma (PPARγ) antagonist significantly reduced some of the beneficial effects of candesartan after CCI, suggesting that PPARγ activation may contribute to part or to all of the neuroprotective effect of candesartan. Overall, our data suggest that ARBs with dual AT1R-blocking and PPARγ activation properties may have therapeutic value in treating TBI.
Keywords: traumatic brain injury, candesartan, TGFβ, inflammation, neuroprotection, PPARγ
INTRODUCTION
Traumatic brain injury (TBI) results in complex pathophysiological reactions. The initial direct injury is considerably worsened by secondary cascades that activate many different signaling pathways. These cascades result in blood–brain barrier dysfunction, edema formation, an enhanced inflammatory response, increased cell death, gliosis, and cerebral cavity formation (O'Connor et al, 2011). TBI also often results in motor and learning impairment leading to long-term disability (Hamm, 2001; O'Connor et al, 2011; Santos et al, 2005). These secondary cascades, which occur minutes to days following injury, provide a therapeutic window to intervene, to prevent, or reduce the extent of the secondary damage. As a result of the multiple mechanisms initiated by brain injury that lead to neuronal dysfunction, it would seem that a drug that had multimodal action to combat the harmful secondary cascades would be advantageous to treat recovery from TBI. Drugs that block the angiotensin II (Ang II) receptors (Ang II receptor blockers, ARBs) are neuroprotective, anti-inflammatory, and vasodilatory attacking three potentially devastating sequelae of TBI (Benigni et al, 2010). In addition, ARBs are already widely used FDA-approved drugs with limited side effects that have significant benefit in animal models of stroke (Thone-Reineke et al, 2006). However, little is known of the involvement of Ang II in the response to TBI, or the ability of ARBs to have a beneficial therapeutic effect. The probable beneficial properties of ARBs together with their known efficacy in treating stroke made a strong case for investigating their potential for treating TBI.
Ang II is a multifunctional effector hormone that contributes to the regulation of blood pressure, vascular tone, and fluid volume (Davisson et al, 2000). Ang II is synthesized from the precursor angiotensinogen, in most tissues including the brain (Paul et al, 2006; Saavedra, 1992). In the brain, Ang II is involved in the regulation of cerebral blood flow (CBF), the autonomic and hormone systems, and stress response (Benicky et al, 2011; Saavedra et al, 2011). Ang II type 1 receptors (AT1R) are responsible for most of the well-characterized peripheral and central actions of Ang II (Benicky et al, 2011). However, excessive AT1R stimulation leads to inflammation, increasing oxidative stress, and endothelial dysfunction both in the periphery (Savoia and Schiffrin, 2007) and in the brain (Ozacmak et al, 2007). In the brain, excessive AT1R stimulation has been linked to cerebrovascular remodeling and inflammation leading to neuronal injury and vulnerability (Ando et al, 2004a; Nishimura et al, 2000; Yamakawa et al, 2003; Zhou et al, 2005). In addition, reduced Ang II formation offers protection from stroke, because the core lesion area after middle cerebral artery occlusion is significantly reduced in angiotensinogen-knockout mice (Maeda et al, 2009).
The neuroprotective effect of ARBs has been demonstrated in animal models and clinical studies. Peripherally administered ARBs cross the blood−brain barrier and have direct CNS effects (Nishimura et al, 2000), reducing both cerebrovascular remodeling and inflammation (Ando et al, 2004b; Yamakawa et al, 2003; Zhou et al, 2005). ARBs ameliorate stroke by protecting the cerebrovascular flow (Engelhorn et al, 2004; Ito et al, 2001; Nishimura et al, 2000); lessen the cognitive impairment seen after whole brain irradiation in rats (Robbins et al, 2010) and reduce brain inflammation protecting the rats from behavior associated with sickness and depression (Benicky et al, 2011).
Several large clinical studies have demonstrated that ARBs prevent the cognitive dysfunction produced by stroke in patients with and without hypertension (Fogari and Zoppi, 2004; Hansson et al, 1999; Igase et al, 2012; Meredith et al, 2004; Poon, 2008; Van Mieghem et al, 2010; Zanchetti and Elmfeldt, 2006). Furthermore, ARBs reduce the incidence and progression of Alzheimer's disease and dementia in hypertensive patients more effectively than other antihypertensive medications (Davies et al, 2011).
We hypothesized that treatment with candesartan may improve the behavioral and neurological outcome after TBI, in a manner similar to that observed in rodent models and in humans affected by stroke (Awad, 2011; Guan et al, 2011; Ito et al, 2001; Liu et al, 2008; Stenman and Edvinsson, 2004). We therefore investigated the effect of administering candesartan to mice just before they received a controlled cortical impact (CCI) injury to determine whether short- or long-term inhibition of central AT1Rs would reduce the cortical and hippocampal damage and hence protect against cognitive impairment. While we were completing these data, a report was published demonstrating that administration of low doses of candesartan to mice within 4 h of TBI prevented secondary brain damage and reduced cerebral inflammation at 24 h post-injury (Timaru-Kast et al, 2012). Our studies confirm and extend these observations. We show that administration of candesartan can reduce cell death, inflammation and lesion volume, reduce TGFβ1 expression post-injury, and improve functional outcome up to 4 weeks after injury.
Some ARBs, including candesartan, are peroxisome proliferator-activated receptor-gamma (PPARγ) agonists (An et al, 2010; Benson et al, 2004; Erbe et al, 2006). PPARγ is a nuclear hormone receptor whose activation leads to beneficial effects in the regulation of multiple pathways. PPARγ activation mitigates some of the major factors influencing TBI outcome, such as excessive inflammation, reduction of oxidative stress, and inhibition of apoptosis in various tissues, including the brain (Gillespie et al, 2011; Ricote et al, 1998; Rotman and Wahli, 2010). PPARγ agonists have been investigated as potential therapeutics for treating TBI (Gillespie et al, 2011). We asked whether the beneficial effects of candesartan was a consequence of both AT1R blockade and PPARγ agonist activity. We show that candesartan's actions may indeed be mediated by the dual activities of AT1R blockade and PPARγ activation. Therefore, our studies show that candesartan exerts broad and long-term beneficial effects, and thus may be a potentially valuable therapeutic for treating TBI.
MATERIALS AND METHODS
Animals and CCI Injury
All animal studies were approved by the USUHS Institutional Animal Care and Use Committee and were conducted in accordance with the NRC guide to the Care and Use of Laboratory Animals. Nine-week-old male C57BL/6 mice (NCI, MD), weighing 22–28 g, were kept under 12 : 12 light and dark cycle with access to food and water ad libitum. Typically, surgery was done after 1 week of recovery from transportation-related stress. Mice were anaesthetized with isoflurane (3% induction : 1.5% maintained) and placed in a stereotaxic frame. Body temperature was kept constant using an isothermal heating pad (Stoelting, IL) throughout surgery. The skull was fixed in a stereotactic frame and a craniotomy was performed above the left parietal cortex. We performed moderate CCI injury (coordinates; 2 mm lateral, −2 mm posterior to Bregma) at an impact depth of 2 mm, with a 2 mm diameter round impact tip (speed 3.6 m/s, dwell time 100 ms) and 12° angle of dura mater, using an electromagnetically driven CCI injury device (Impact One stereotaxic impactor CCI, Leica Microsystems Gmbh, Wetzlar, Germany). The bone flap was replaced but not sealed, the skin was sutured, and the mice were allowed to recover fully from anesthesia before transfer to their cages. Sham-injured animals received the same craniotomy without the impact injury.
Drug Treatment
Osmotic minipumps were employed to dispense candesartan (1 mg/kg/day) continuously until killing at 3 or 28 days post-injury (dpi). Minipumps (ALZET, Cupertino, CA: model 1007; delivering 0.5 μl/h for 7 days; or model 1004; delivering 0.11 μl/h for 28 days) were filled with candesartan (CV-11974, Astra-Zeneca, Sweden) dissolved in 0.1 N Na2CO3, pH=7.4 (2 mg/ml for model 1007; 9.2 mg/ml for model 1004), or vehicle (0.1% saline and 0.1 N Na2CO3 at pH=7.4) the day before implantation and primed at 37 °C overnight. At 5 h before CCI injury, animals were anesthetized with isoflurane and the loaded minipumps were implanted at the back of the neck of each mouse so that the drug was delivered subcutaneously. For some experiments (presented in Figures 3 and 6) mice were administered drug or vehicle by i.p. injections with either candesartan (1 mg/kg/day), vehicle, and/or the PPARγ antagonist, (T0070907, 1.5 mg/kg, Sigma-Aldrich). At the time of killing (either 1, 3 or 28 dpi), mice were anesthetized with ketamine/xylazine and killed by decapitation.
Determination of CBF and Blood Pressure
Regional CBF (rCBF) was measured around the cortical impact area using a laser-Doppler flowmeter (PeriFlux System 5000 LDPM, Perimed). Changes in rCBF were measured in the impact area using a flexible fiber optic extension to the LDPM probe tip 404 as described previously (Villapol et al, 2011). Changes in rCBF were expressed as the percentage of the baseline value recorded before CCI injury. Animals were anesthetized with isoflurane for 1–2 min while rCBF was measured. The rCBF values were taken at basal levels before, 2 min, 2 h, and 18 h after cortical impact. Tail blood pressure was obtained using the CODA mouse tail-cuff system, an indirect blood pressure method that utilizes volume pressure recording sensor, coupled to a PC-based data acquisition system (Kent Scientific, CT). A minimum of 10 measurements were taken from each mouse.
Behavioral Testing
To examine the effects of the candesartan on neurological outcome after CCI injury, two investigators who were blinded to the treatment status of the mice performed behavioral tests. A rotarod test was used to evaluate motor coordination. Mice were trained on the rotarod (Ugo Basile, Collegeville, PA, USA) for 2 days before injury, and tested at specific time points after injury. Each day, mice performed at least two trials, separated by a 15-min rest period. Mice were allowed to stand for 15 s on the rod before the rotarod started to rotate with speed linearly increasing from 4 to 40 r.p.m. in 2 min. The average latency before animals fell off the rod was recorded.
Morris Water Maze Test Used to Evaluate Spatial Learning and Memory Talks
The Morris water maze (MWM) was performed as previously described (Hamm, 2001) from 24 to 28 dpi. The 4 ft diameter tank (Stoelting Morris) was filled with tap water (23–25 °C) to a depth of 25 cm and a clear plastic platform (4 × 12 inch) was placed in the northwest quadrant of the tank 1 cm beneath the surface of the water. Highly visible black cues were placed on the walls of the room. Initial trial: on day 1 (24 dpi), each mouse was placed on the platform in the tank and kept there for 15 s. Follow-up trials: on days 2–5, each mouse underwent four trials, each separated by 2 min. Mice were randomly placed into one of the four quadrants and allowed 60 s to swim to the platform. If a mouse did not reach the platform in 60 s, they were gently guided to the platform by the investigator and allowed to remain there for 15 s. A video tracking system recorded all parameters including swim speed and the latency to find the platform. Final probe trial: on day 5 (28 dpi), 1 h after the last training trial, a probe trial was performed with mice placed in the tank without the platform. The time spent in the quadrant where the platform had been located was recorded and compared with time spent in the other three quadrants. All data were analyzed with ANY-maze 4.50 software (Stoelting, Wood Dale, IL).
Tissue Preparation and Histology
Animals were randomized into two groups; one group was used for histology and binding analyses and the second group for qPCR. For histology and binding analyses, mice were killed at 3 dpi, brains were dissected, fresh frozen in cold isopentane on dry ice, and stored at −80 °C. Fresh frozen brains were cut to 16 μm thick coronal sections on a cryostat, mounted on gelatin-coated glass slides and stored at − 80 °C until use. To quantify AT1R mRNA expression with qPCR, mice were killed at 1 dpi, brains dissected, and sliced into 300 μm thick sections with a cryostat. Punches were taken from the pericontusional cortex (5 punches per section) using a 1 mm microdissection punch (Harris Uni-core needles, Electron Microscopy Sciences, Hatfield, PA). To measure mRNA levels of PPARγ brains were dissected at 3 dpi and a single punch was taken from the cortical lesion region using a 5 mm punch cannula (Zivic Instruments, Pittsburgh, PA).
Cell Death Assay
Sections were processed for DNA strand breaks (TUNEL assay, labeling of fragmented DNA) using the fluorescence In Situ Cell Death Detection Kit (Roche, IL), according to the manufacturer's instructions. TUNEL-positive nuclei were counted in cortical and hippocampal regions in 3 to 5 coronal sections for each animal, with five animals per group.
RNA Isolation and qPCR of AT1R and PPARγ
The extracted punches were immediately placed in TRIzol reagent (Invitrogen, CA) and homogenized by trituration with a pipette, then stored at −80 °C until use. RNA was isolated by adding 0.2 volumes of chloroform, centrifuging at 16 000 g for 15 min, and extracting the aqueous layer. RNA was further purified using the RNeasy Lipid Tissue Mini kit (Qiagen, MD) and treated with RNase-Free DNase according to the manufacturer's instructions. RNA was quantified and RNA integrity checked by agarose gel electrophoresis. qPCR was performed using SYBR Green qPCR MasterMix (Qiagen) with primers specific for murine AT1A type receptor (forward (5′–3′): AGCCTGCGTCTTGTTTTGAG, reverse (5′–3′): GCTGCCCTGGCTTCTGTC), AT1 total receptor (forward (5′–3′): TGTTCCTGCTGCTCACGTGTCTC, reverse (5′–3′): CATCAGCCAGATGATGATGC), and PPARγ (forward (5′–3′): CACAATGCCATCAGGTTTGG, reverse (5′–3′): GTGATTTGTCCGTTGTCTTTCC). The amplification conditions consisted of denaturation and enzyme activation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s (CFX96, Bio-Rad). mRNA expression levels were normalized to the housekeeping gene cyclophilin A (reverse (5′–3′): GCACTGGAGAGAAAGGATTTGG, forward (5′–3′): CCAGTGCCATTATGGCGTGT). Quantification of relative changes in mRNA levels between samples taken from animals after surgery with those from naive mice were calculated using the delta delta threshold cycle (ΔΔCt) method (Susarla et al, 2011).
Immunohistochemistry
Fresh frozen 16 μm thick sections were post-fixed in 4% paraformaldehyde for 1 h. Sections were blocked with 10% normal goat serum in PBS and 0.1% Triton X-100 (TX) for 1 h. The following primary antibodies were incubated at 4 °C overnight anti-GFAP, mouse monoclonal (1 : 200, Millipore, CA); anti-NeuN, mouse monoclonal (1 : 200, Chemicon, Temecula, CA) for mature neurons; and anti-Iba-1, rabbit polyclonal (1 : 100, Wako,VA) for microglia; anti-TGFβ1 rabbit polyclonal (IDFR-B, 1 : 1000, kind gift of Dr Flanders, NIH) and anti-TGFβ3 (1 : 1000, sc-83, Santa Cruz Biotechnology, CA). This novel TGFβ1 antiserum does not stain sections taken from TGFβ1 knockout mice (manuscript in preparation). Sections were washed in PBS and 0.1% Triton X-100 (PBS-T) three times and incubated with the corresponding Alexa Fluor 568-conjugated IgG secondary antibodies (all 1 : 1000; Jackson Immunoresearch, West Grove, PA) for 2 h at room temperature. Sections were rinsed with PBS and distilled water and coverslipped with ProLong Gold antifade reagent with DAPI (Invitrogen, Chicago, IL). Images were acquired on an Olympus BX61 with attached qImaging Retiga EXi Aqua CCD camera, and iVision software (BioVision Technologies, Exton, PA).
Ang II Receptor Autoradiography
For receptor autoradiography, brains were removed from mice that were either treated or not treated with candesartan for 3 days, snap frozen, and 16 μm thick sections were cut in a cryostat at −15 °C. Sections were incubated with [125I]-sarcosine1Sar1-ANG II ([125I]-Sar1-ANG II; ARC, St Louis, MO) as described previously (Tsutsumi and Saavedra, 1991). Optical densities of autoradiograms were analyzed by computerized densitometry using Scion Image 4.0.2 (Scion, Frederick, MD) based on the NIH Image program.
Quantification and Image Analysis
The lesion area was determined in every 16th section throughout the entire lesion (a total of 9 sections at 256 μm intervals). The area of each of the corresponding ipsilateral hemispheres was similarly determined. Lesion volume was obtained by multiplication of the sum of the lesion areas by the distance between sections. Percent lesion volume was calculated by dividing the lesion volume by the total ipsilateral hemisphere volume (similarly obtained by multiplying the sum of the areas of the ipsilateral hemispheres by the distance between sections). To obtain cell counts of specific labeled cells, each labeled cell was counted with the × 40 objective in five fields per section, at least three sections per animal, n=5–12. Quantitative image analysis of the immunoreactive areas for TGFβ1, TGFβ3, and Iba-1 were performed on 15 cortical and hippocampal sections through the level of impact site (AP −2.0 mm) taken with the × 20 objective and using the same densitometric analysis method as described previously (Villapol et al, 2011). Immunofluorescence intensity was calculated using the threshold method and defined as the number of pixels, divided by the total area (mm2) in the imaged field with the average background subtracted. All images were captured and analyzed using iVision.
Statistical Analysis
All data in this study are expressed as mean ±SEM, except for lesion volume presented as mean ±SD. *p<0.05 or less was considered statistically significant. Intergroup differences were evaluated by one-way ANOVA followed by the Newman–Keuls Multiple Comparison test. CBF and blood pressure data were analyzed by two-way ANOVA with Bonferroni post-tests. All statistics were performed with Prism 5.03 software (GraphPad Software, San Diego, CA).
RESULTS
Candesartan Treatment Reduces Lesion Volume and Cell Death after CCI
We implanted an osmotic minipump dispensing candesartan (1 mg/kg/day) starting 5 h before the injury and continuously until the time of killing (Figure 1a). Examination of cresyl-violet stained sections of brains taken from either candesartan- or vehicle-treated mice showed that candesartan reduced the mean lesion volume at 3 and 28 dpi. At 3 dpi, mice treated with candesartan had a 43% decrease in lesion volume compared with vehicle-treated mice (***p<0.005, n=7–8) (Figure 1b). This difference was maintained at 28 dpi, where treatment with candesartan reduced the lesion cavity by approximately 31% (*p<0.05, n=11–12) (Figure 1b). To determine whether the beneficial effect of candesartan was due in part to a reduction in cell death, we performed a TUNEL assay on sections taken from candesartan- or vehicle-treated mice at 3 dpi. Candesartan-treated injured mice (CCI-CD) had a significantly lower number of TUNEL-positive cells compared with vehicle-treated injured (CCI-VH) in the cortex (*p<0.05), (Figures 2a–c). Double staining with TUNEL and NeuN showed that approximately 80% of TUNEL-positive cells corresponded with neurons (data not shown), indicating that candesartan prevented significant neuronal cell death in the perilesional area. Furthermore, there were significantly fewer TUNEL-positive cells in the CA1, CA3, and dentate gyrus regions of the ipsilateral hippocampus in candesartan-treated mice after CCI (Figures 2d-f). Thus, candesartan reduced the amount of cell death and specifically neuronal cell death after CCI. To ensure that candesartan was acting as an antagonist at AT1R in the brain, we analyzed radiolabeled ligand binding to the AT1R. There was an approximately 45% reduction in binding to the AT1R in both the paraventricular nucleus (PVN) and the subfornical organ (SFO), studied in sections taken from mice treated with candesartan for 3 days, in comparison with binding to sections taken from mice treated with vehicle only (Supplementary Figure 2). To determine whether expression or function of the AT1R was altered after injury, we examined the expression of AT1R mRNA together with ligand-specific binding in different brain regions after TBI. In rodents, there are two isoforms of AT1Rs; AT1a and AT1b receptors (Burson et al, 1994; Johren and Saavedra, 1996). qPCR analysis indicated no change in expression in either total AT1R (AT1a+AT1b) mRNA or AT1aR-specific mRNA at 1 dpi, in comparison with expression in sham mice (Supplementary Figure 3). Autoradiography also showed no alteration in ligand-specific binding to the PVN or SFO after injury. AT1R density in the cortex was not sufficient to detect by autoradiography. Taken together, our data show no gross difference in expression of the AT1R after CCI injury.
Candesartan Treatment Reduces Microglial Activation
To determine whether candesartan altered the activation or survival of glial cells, we examined staining for glial-specific markers in sections taken from candesartan- or vehicle-treated mice at 3 dpi. Candesartan treatment significantly decreased the number of Iba-1-positive cells and the amount of Iba-1 immunoreactivity in the perilesional area at 3 dpi (Figures 2g-j) (*P<0.05). Candesartan treatment also led to a change in morphology of microglia, with reduced numbers of microglia showing hypertrophy or ameboid morphology (Figures 2g and h with inset g′ and h, respectively). Candesartan treatment did not alter the number of GFAP-positive astrocytes, or mature oligodendrocytes (APC-positive cells) in the perilesional area at 3 dpi (data not shown). Thus, the glial-specific effects of candesartan are restricted to reducing microglial activation.
Blockade of AT1 Receptors Increases CBF but Does not Significantly Affect Blood Pressure after CCI Injury
Laser-Doppler analysis showed that CBF decreased immediately after CCI to approximately 50% of the pre-injury level in both candesartan-treated and -untreated mice (Figure 3a). At 2 and 18 h after CCI, CBF recovered more quickly in candesartan-treated mice than in mice treated with vehicle. Indeed at 18 h after injury in mice treated with candesartan, CBF had rebounded to just above pre-injury levels (Figure 3a). To determine whether the dose of candesartan used in these experiments altered blood pressure, we recorded blood pressure using the indirect tail-cuff system to obtain baseline levels before injury and at 2 and 18 h post-injury. In vehicle- and candesartan-treated mice groups, mean baseline blood pressure (before drug administration) was between 114 and 117 mm Hg. No significant differences in blood pressure were detected between groups after CCI (Figure 3b). We also weighed the mice at 3 and 28 dpi to show that there were no differences between candesartan- or vehicle-treated animals after injury (Supplementary Figure 1).
Effect of Candesartan Treatment Reduces Expression of TGFβ1, but Increases TGFβ3 Expression
As ARBs can reduce the amount of TGFβ expressed in certain tissues (Sun et al, 1998), we sought to determine whether candesartan treatment reduced TGFβ expression. TGFβ1 and TGFβ3 expression was upregulated at 3 dpi, with both cytokines colocalized mainly in reactive astrocytes in the ipsilateral hemisphere (data not shown). Candesartan treatment significantly reduced (by 50%) astroglial TGFβ1 expression in the ipsilateral cortex (Figure 4e) and hippocampus, relative to TGFβ1 expression in vehicle-treated mice (Figures 4a-f). Surprisingly, candesartan treatment led to an upregulation of astroglial TGFβ3 expression (approximately 150–200%) in the ipsilateral cortex (Figure 4k) and hippocampus compared with TGFβ3 expression in vehicle-treated mice (Figures 4g-l).
Candesartan Treatment Improves Motor Function, Spatial Learning and Memory Outcome after TBI
To determine whether candesartan treatment benefited the recovery from injury, we subjected mice to behavioral tests to determine the extent of their functional recovery. Mice were pre-trained on the rotarod for 2 days before CCI injury. All groups of mice behaved similarly during training. Candesartan or vehicle was administered by minipump, implanted 5 h before injury, as with the rest of the experiments. After CCI injury, mice showed a reduced ability to perform this test, as judged by their shorter latency to fall. At 1 and 3 dpi, candesartan-treated mice were able to stay on the rotarod for significantly longer time periods relative to vehicle-treated mice suggesting that candesartan treatment enhances motor performance after TBI, and had a similar effect on the ‘sham' operated mice, enhancing their ability to stay longer on the rotarod (Figure 5a). We found no effect of candesartan treatment on the performance of naive mice in this test (Figure 5a). To determine the effect of candesartan treatment on cognitive ability at a later time point, we evaluated spatial learning and memory by the MWM test (Figure 5b). Mice were trained for 4 trials per day from days 24 through 28 dpi. On day 28, with the platform removed, candesartan-treated mice after CCI spent significantly more time in the correct quadrant, than vehicle-treated mice after CCI, showing that candesartan treatment led to a greater ability to learn and remember (n=7–12, *p<0.05). There was no observable difference between candesartan- and vehicle-treated mice after sham injury (Figure 5b). These results suggest that candesartan treatment significantly improved spatial learning and memory 4 weeks after CCI injury.
PPARγ Activation may Contribute to the Neuroprotective Effects of Candesartan Following Brain Injury
We wished to determine whether the PPARγ agonist activity of candesartan was contributing to its efficacy in promoting recovery after CCI. We first examined whether short-term candesartan would elevate PPARγ mRNA expression. No significant differences were observed in PPARγ mRNA expression in the cortex when comparing naive mice to injured mice, nor between those treated with candesartan compared with mice treated with vehicle at 3 dpi (Figure 6a). We then treated mice with candesartan, the PPARγ antagonist, T0070907, or a combination of candesartan with T0070907, injecting once daily, starting 5 h before injury as previously. At 3 dpi, the beneficial effects of candesartan treatment alone were maintained—with reduced lesion volume, decreased number of Iba-1-positive microglial cells, and an enhanced ability to stay on the rotarod as compared with vehicle-treated mice (Figure 6). However, candesartan's protective effects were reduced or eliminated when given together with T0070907. Mice treated with T0070907 alone showed no significant difference from vehicle-treated mice after CCI. Mice treated with T0070907 together with candesartan showed significantly more microglial activation than mice treated with candesartan alone and were not significantly different from vehicle-treated mice (Figure 6c), However, mice co-treated with candesartan and T0070907 developed a lesion volume and showed recovery of motor function that was neither significantly different from vehicle-treated nor candesartan-treated mice (Figures 6b and d). Thus, PPARγ antagonism diminishes or abolishes the beneficial effects of candesartan treatment on recovery from CCI injury.
DISCUSSION
The search for an effective therapy to treat TBI patients has been ongoing for many years. After over 30 failed clinical trials for TBI it is becoming increasingly recognized that the sequelae of events after TBI is so complex that a multifunctional approach is more likely to be effective (Loane and Faden, 2010; Marklund and Hillered, 2011). ARBs are known to have a multifaceted action in the brain. They reduce brain inflammation, protect from stroke, and are directly neuroprotective (Benicky et al, 2011; Kasahara et al, 2010; Rodriguez-Pallares et al, 2008). In this study, we show that administration of the ARB candesartan resulted in a significant reduction in lesion volume, neuronal cell death, and activated microglial cells after CCI injury in the mouse. The improved pathology resulted in better motor and cognitive recovery up to 4 weeks after the injury. We also show that some of the beneficial effects of candesartan may be due to PPARγ activation. Thus, the ARBs may have potential therapeutic value for treating TBI because of their dual action on the AT1R and PPARγ receptors.
TBI initially causes an acute decrease in the CBF, often with periodic episodes of cerebral vasospasm in the days to weeks following injury (Barkhoudarian et al, 2011). These alterations in CBF contribute to the detrimental effects on structure and function resultant from TBI. Studies after ischemia indicate that candesartan exerts an important beneficial effect. Blockade of AT1R in the cerebral vasculature decreases vasoconstriction and this diminishes the CBF reduction provoked by ischemia (Ariza et al, 2006; Baranov and Armstead, 2003; Engelhorn et al, 2004; Ito et al, 2002). The mechanisms of CBF protection by ARBs include increased microcirculation, partially through the formation of new collaterals resulting in an increase in vascular flow (Li et al, 2008), increased expression of endothelial nitric oxide synthase in the cerebral vasculature (Yamakawa et al, 2003) and direct reduction of cerebral vasoconstriction resulting from AT1R blockade (Ito et al, 2002; Nishimura et al, 2000; Zhou et al, 2006). When measured 18 h after CCI, we found that in mice treated with candesartan the reduction in CBF returned to pre-injury levels, in comparison with the still depressed CBF in vehicle-treated mice after CCI (Figure 3). Our results concur with other reports showing that candesartan partially restored diminished CBF following fluid percussion brain injury in a neonatal pig model (Baranov and Armstead, 2003). Demonstrated effects of PPARγ on the vasculature seem restricted to a long-term protective effect that may even be mediated via inhibition of the renin−angiotensin system, mediated by AT1R (Sugawara et al, 2011). Thus, the ability of candesartan to protect CBF after TBI demonstrates the important role of cerebrovascular AT1R blockade (Zhou et al, 2006).
TGFβ1 is an important cytokine that is rapidly induced following TBI (Wang et al, 2007). It has many functions in the nervous system, which are both beneficial and detrimental to the recovery from TBI including promoting glial scar formation (Chodobski et al, 2003; Vivien and Ali, 2006; Wang et al, 2007). Ang II can induce the expression or activation of TGFβ1 in many different tissues (Harasawa et al, 2010; Jiao et al, 2011; Sun et al, 1998; Yu et al, 2001). Indeed, TGFβ1 mediates Ang II dependent functions in the heart (Rosenkranz, 2004). In the spinal cord, Lanz et al. (2010) show that Ang II-dependent neuroinflammation in an experimental autoimmune encephalomyelitis model is mediated through upregulation of TGFβ, and that candesartan ameliorated this neuroinflammation acting through AT1Rs in astrocytes and microglia. We found that candesartan potently reduces TGFβ1 expression in cortical and hippocampal astrocytes following CCI injury. Therefore, our results support the concept that TGFβ1 acts as a downstream mediator of Ang II in the nervous system. Conversely and somewhat surprisingly, we found that candesartan treatment led to an upregulation of TGFβ3 expression in cortical and hippocampal astrocytes. TGFβ3, despite its similarity to TGFβ1, favors repair processes, and has been used in clinical trials for scar reduction in the skin (Occleston et al, 2008). Thus, candesartan differentially regulates two different TGFβ family members through unknown mechanisms. The significance of the candesartan-mediated induction of TGFβ3 levels is not known.
Increased neuronal cell death after TBI has many potential mechanisms including reduced blood flow, cerebral vasoconstriction, blood−brain barrier breakdown, excitotoxicity, oxidative stress, and pro-inflammatory processes (Barkhoudarian et al, 2011). Previous studies have demonstrated that candesartan reduces superoxide production and preserves antioxidant capacity after global cerebral ischemia (Sugawara et al, 2005) and after intracerebral hemorrhage (Jung et al, 2007). As AT1R expression in the cortex is low, it is probable that the reduction in lesion volume and neuroprotection mediated by candesartan is a result of a more global reduction in inflammation and oxidative stress, mediated by the actions of candesartan on other cell types, including the cerebral vasculature (Zhou et al, 2006). Following peripheral administration of bacterial endotoxin, candesartan decreases inflammation throughout the brain preventing microglia activation (Benicky et al, 2011). Candesartan also directly reduces markers of inflammation in neuronal, microglial, and cerebrovascular endothelial cell cultures (Benicky et al, 2011) and in human circulating monocytes (Larrayoz et al, 2009). Indeed, we found that candesartan treatment reduces the activation of microglial cells in the injured cortex after TBI (Figure 2). As microglial expression of AT1R is very low (data not shown), we postulate that effects beyond AT1R blockade may be at least partially responsible for the therapeutic effects of candesartan.
One major additional effect of candesartan is PPARγ activation. The nuclear receptor PPARγ is expressed in most if not all cells in the CNS, including astrocytes, oligodendrocytes, microglia, and neurons (Bernardo and Minghetti, 2006). PPARγ activation curtails inflammation through decreasing the expression and release of pro-inflammatory cytokines, and reducing the activation of microglial activation (Gillespie et al, 2011). PPARγ agonists have beneficial effects in a variety of animal models including spinal cord injury, stroke and TBI (Gillespie et al, 2011; McTigue et al, 2007; Zuhayra et al, 2011). The anti-inflammatory properties of PPARγ suggest that PPARγ activation may contribute to the anti-inflammatory effects of ARBs (Malchiodi-Albedi et al, 2008). Telmisartan is the ARB with the greatest PPARγ agonist activity (Benson et al, 2004). However, candesartan can also activate PPARγ-mediated gene expression (Erbe et al, 2006; Zorad et al, 2006). Indeed, the significant reduction in the protective effects of candesartan by co-administration of a PPARγ antagonist (Figure 6) suggests that PPARγ agonist activity forms a significant if not the major component of the beneficial, anti-inflammatory actions of candesartan. Candesartan did not appear to induce expression of PPARγ mRNA at 3 dpi (Figure 6). Instead, candesartan may bind directly to PPARγ as part of the heterodimer with retinoid X receptor causing dissociation of co-repressor molecules and recruitment of transcriptional coactivators to induce transcription (Erbe et al, 2006).
The relative role of AT1R blockade and PPARγ activation in the therapeutic effects of ARBs is still under investigation. The protection of CBF, decreased vasoconstriction, regulation of TGFβ expression, and direct neuroprotective effects, are probably attributable to blockade of the AT1R. However, it appears that the contribution of AT1R blockade and PPARγ activation is dependent on cell type. For example, candesartan protects human circulating monocytes expressing very few AT1Rs by activating PPARγ (Larrayoz et al, 2009). Conversely, the neuroprotective effect of another ARB, telmisartan in neuronal cultures expressing AT1Rs, is independent of PPARγ activation (Pang et al, 2012).
In our study, PPARγ inhibition abolished the significant protective effects of candesartan on microglial activation (Figure 6c). However, PPARγ inhibition reduced, but did not eliminate the beneficial effect of candesartan on lesion volume or motor function, as treatment with T0070907 together with candesartan was not significantly different from treatment with either vehicle or candesartan alone (Figures 6b and d). The PPARγ agonist activity of some ARBs, including candesartan, may not be independent of their AT1R-blocking properties. There is cross-talk between AT1R and PPARγ activation (Xiao et al, 2009); PPARγ agonists reduce AT1R-mediated inflammation and hypertension in vivo (Ji et al, 2009), and downregulates AT1R expression (Zhao et al, 2008), whereas Ang II, by stimulating the AT1R, downregulates PPARγ activity (Tham et al, 2002). Further studies are necessary to elucidate the relative role of AT1R inhibition and PPARγ activation in neuroprotection after TBI. Nevertheless, use of the ARBs as treatment for TBI may have more efficacy because of the dual anti-inflammatory action of inhibition of AT1R and activation of PPARγ (Yi et al, 2008).
While we were completing the studies presented here, Timaru-Kast et al (2012) published their study showing that a 0.1 mg/kg dose of candesartan, but not a 1 mg/kg dose, administered by subcutaneous injection up to 4 h after injury, reduced the lesion size after CCI injury in mice and improved the neurologic severity score. We found efficacy of candesartan at 1 mg/kg/day, administered by osmotic minipump, starting 5 h before injury. The difference in the efficacy of 1 mg/kg/day between our data and that of Timaru-Kast et al (2012) may be explained by different mechanisms of administration. There is a significant drop in blood pressure following TBI that could be detrimental (Guan et al, 2011; Sookplung et al, 2011). Thus, medication that lowers blood pressure further may be problematic in treating TBI. Candesartan can lower blood pressure at high doses (Omura-Matsuoka et al, 2009). Injection of 1 mg/kg candesartan immediately following injury may be more detrimental than injecting it 5 h before injury. Indeed, Timaru-Kast et al, (2012) found that 1 mg/kg significantly lowered blood pressure. With the use of indirect tail cuff measurements, we found only a slight nonsignificant drop in blood pressure (Figure 3). It is probable that the neuroprotective effects of candesartan are not dependent on its hypotensive action, and thus the dose dependence of neuroprotection and blood pressure reduction can be separated. Indeed, beneficial effects of candesartan after stroke have been shown for doses that are not hypotensive (Omura-Matsuoka et al, 2009). The results of Timaru-Kast et al (2012), show that post-injury administration of candesartan up to 4 h after injury are beneficial to recovery when assessed at 24 h after injury. We have shown that the beneficial cognitive effects of candesartan can be detected up to 28 days after injury. Ultimately, for ARBs to be pursued as therapeutics, we need to determine the maximum time window after injury for candesartan administration to retain its efficacy in improving functional recovery 1 or 2 months after injury.
Together our data show that treatment with ARBs in mice attenuated the TBI-induced neuronal death, in part through reducing the amount of inflammatory response. This improvement in pathology bestowed improved cognitive and motor functional outcomes after injury. The reduced lesion size, and enhanced cell survival translated into longer-term improvement in cognitive memory, as shown by the improved function in the MWM. To our knowledge, this is the first study that shows that candesartan can enhance recognition and spatial memory 4 weeks after TBI. Thus, candesartan, and therefore potentially other ARBs that cross the blood−brain barrier, could be promising therapeutics for TBI. The ability of these drugs to address several different mechanisms simultaneously makes them particularly attractive treatments for TBI.
Acknowledgments
This study was supported by a pilot award from the Center for Neuroscience and Regenerative Medicine (CNRM) grant (AJS). SV is supported by a CNRM postdoctoral fellowship. JMS and ESL are supported by the Division of Intramural Research Programs, National Institute of Mental Health, National Institutes of Health. We thank Laura Tucker, Oz Malkesman, and Amanda Fu from the CNRM pre-clinical core facility for expert advice, Dr Tim ÓNeil for his assistance with blood pressure measurements. We are grateful to members of the Symes and Saavedra laboratories for their helpful comments and suggestions. The opinions and assertions contained herein are the private opinions of the authors and are not to be construed as reflecting the views of the Uniformed Services University of the Health Sciences or the US Department of Defense.
The authors declare no conflict of interest.
Footnotes
Supplementary Information accompanies the paper on the Neuropsychopharmacology website (http://www.nature.com/npp)
Supplementary Material
References
- An J, Nakajima T, Kuba K, Kimura A. Losartan inhibits LPS-induced inflammatory signaling through a PPARgamma-dependent mechanism in human THP-1 macrophages. Hypertens Res Off J Jap Soc Hypertens. 2010;33:831–835. doi: 10.1038/hr.2010.79. [DOI] [PubMed] [Google Scholar]
- Ando H, Jezova M, Zhou J, Saavedra JM. Angiotensin II AT1 receptor blockade decreases brain artery inflammation in a stress-prone rat strain. Ann N Y Acad Sci. 2004a;1018:345–350. doi: 10.1196/annals.1296.043. [DOI] [PubMed] [Google Scholar]
- Ando H, Zhou J, Macova M, Imboden H, Saavedra JM. Angiotensin II AT1 receptor blockade reverses pathological hypertrophy and inflammation in brain microvessels of spontaneously hypertensive rats. Stroke. 2004b;35:1726–1731. doi: 10.1161/01.STR.0000129788.26346.18. [DOI] [PubMed] [Google Scholar]
- Ariza M, Matarin MD, Junque C, Mataro M, Clemente I, Moral P, et al. Influence of Angiotensin-converting enzyme polymorphism on neuropsychological subacute performance in moderate and severe traumatic brain injury. J Neuropsychiatry Clin Neurosci. 2006;18:39–44. doi: 10.1176/jnp.18.1.39. [DOI] [PubMed] [Google Scholar]
- Awad AS. Effect of combined treatment with curcumin and candesartan on ischemic brain damage in mice. J Stroke Cerebrovasc Dis. 2011;20:541–548. doi: 10.1016/j.jstrokecerebrovasdis.2010.03.008. [DOI] [PubMed] [Google Scholar]
- Baranov D, Armstead WM. Selective blockade of AT1 receptor attenuates impairment of hypotensive autoregulation and improves cerebral blood flow after brain injury in the newborn pig. Anesthesiology. 2003;99:1118–1124. doi: 10.1097/00000542-200311000-00018. [DOI] [PubMed] [Google Scholar]
- Barkhoudarian G, Hovda DA, Giza CC.2011The molecular pathophysiology of concussive brain injury Clin Sports Med 3033–48.vii-iii. [DOI] [PubMed] [Google Scholar]
- Benicky J, Sanchez-Lemus E, Honda M, Pang T, Orecna M, Wang J, et al. Angiotensin II AT(1) receptor blockade ameliorates brain inflammation. Neuropsychopharmacology. 2011;36:857–870. doi: 10.1038/npp.2010.225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Benigni A, Cassis P, Remuzzi G. Angiotensin II revisited: new roles in inflammation, immunology and aging. EMBO Mol Med. 2010;2:247–257. doi: 10.1002/emmm.201000080. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Benson SC, Pershadsingh HA, Ho CI, Chittiboyina A, Desai P, Pravenec M, et al. Identification of telmisartan as a unique angiotensin II receptor antagonist with selective PPARgamma-modulating activity. Hypertension. 2004;43:993–1002. doi: 10.1161/01.HYP.0000123072.34629.57. [DOI] [PubMed] [Google Scholar]
- Bernardo A, Minghetti L. PPAR-gamma agonists as regulators of microglial activation and brain inflammation. Curr Pharm Des. 2006;12:93–109. doi: 10.2174/138161206780574579. [DOI] [PubMed] [Google Scholar]
- Burson JM, Aguilera G, Gross KW, Sigmund CD. Differential expression of angiotensin receptor 1A and 1B in mouse. Am J Physiol. 1994;267:E260–267. doi: 10.1152/ajpendo.1994.267.2.E260. [DOI] [PubMed] [Google Scholar]
- Chodobski A, Chung I, Kozniewska E, Ivanenko T, Chang W, Harrington JF, et al. Early neutrophilic expression of vascular endothelial growth factor after traumatic brain injury. Neuroscience. 2003;122:853–867. doi: 10.1016/j.neuroscience.2003.08.055. [DOI] [PubMed] [Google Scholar]
- Davies NM, Kehoe PG, Ben-Shlomo Y, Martin RM. Associations of anti-hypertensive treatments with Alzheimer's disease, vascular dementia, and other dementias. J Alzheimers Dis. 2011;26:699–708. doi: 10.3233/JAD-2011-110347. [DOI] [PubMed] [Google Scholar]
- Davisson RL, Oliverio MI, Coffman TM, Sigmund CD. Divergent functions of angiotensin II receptor isoforms in the brain. J Clin Invest. 2000;106:103–106. doi: 10.1172/JCI10022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Engelhorn T, Goerike S, Doerfler A, Okorn C, Forsting M, Heusch G, et al. The angiotensin II type 1-receptor blocker candesartan increases cerebral blood flow, reduces infarct size, and improves neurologic outcome after transient cerebral ischemia in rats. J Cereb Blood Flow Metab. 2004;24:467–474. doi: 10.1097/00004647-200404000-00012. [DOI] [PubMed] [Google Scholar]
- Erbe DV, Gartrell K, Zhang YL, Suri V, Kirincich SJ, Will S, et al. Molecular activation of PPARgamma by angiotensin II type 1-receptor antagonists. Vascul Pharmacol. 2006;45:154–162. doi: 10.1016/j.vph.2006.05.002. [DOI] [PubMed] [Google Scholar]
- Fogari R, Zoppi A. Effect of antihypertensive agents on quality of life in the elderly. Drugs Aging. 2004;21:377–393. doi: 10.2165/00002512-200421060-00003. [DOI] [PubMed] [Google Scholar]
- Gillespie W, Tyagi N, Tyagi SC. Role of PPARgamma, a nuclear hormone receptor in neuroprotection. Indian J Biochem Biophys. 2011;48:73–81. [PubMed] [Google Scholar]
- Guan W, Kozak A, El-Remessy AB, Johnson MH, Pillai BA, Fagan SC. Acute Treatment with Candesartan Reduces Early Injury After Permanent Middle Cerebral Artery Occlusion. Transl Stroke Res. 2011;2:179–185. doi: 10.1007/s12975-010-0061-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hamm RJ. Neurobehavioral assessment of outcome following traumatic brain injury in rats: an evaluation of selected measures. J Neurotrauma. 2001;18:1207–1216. doi: 10.1089/089771501317095241. [DOI] [PubMed] [Google Scholar]
- Hansson L, Lithell H, Skoog I, Baro F, Banki CM, Breteler M, et al. Study on COgnition and Prognosis in the Elderly (SCOPE) Blood Press. 1999;8:177–183. doi: 10.1080/080370599439715. [DOI] [PubMed] [Google Scholar]
- Harasawa S, Otsuka Y, Okubo K, Koike M, Fujita H, Kushiro T, et al. Amlodipine suppressed cardiac gene expression of brain natriuretic peptide, transforming growth factor-beta and fibronectin mediated by aldosterone in male stroke-prone spontaneously hypertensive rats. J Pharm Pharmacol. 2010;62:1740–1745. doi: 10.1111/j.2042-7158.2010.01164.x. [DOI] [PubMed] [Google Scholar]
- Igase M, Kohara K, Miki T. The Association between Hypertension and Dementia in the Elderly. Int J Hypertens. 2012;2012:320648. doi: 10.1155/2012/320648. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ito T, Nishimura Y, Saavedra J. Pre-treatment with candesartan protects from cerebral ischaemia. J Renin Angiotensin Aldosterone Syst. 2001;2:174–179. doi: 10.3317/jraas.2001.024. [DOI] [PubMed] [Google Scholar]
- Ito T, Yamakawa H, Bregonzio C, Terron JA, Falcon-Neri A, Saavedra JM. Protection against ischemia and improvement of cerebral blood flow in genetically hypertensive rats by chronic pretreatment with an angiotensin II AT1 antagonist. Stroke. 2002;33:2297–2303. doi: 10.1161/01.str.0000027274.03779.f3. [DOI] [PubMed] [Google Scholar]
- Ji Y, Liu J, Wang Z, Liu N, Gou W. PPARgamma agonist, rosiglitazone, regulates angiotensin II-induced vascular inflammation through the TLR4-dependent signaling pathway. Lab Invest J Tech Methods Pathol. 2009;89:887–902. doi: 10.1038/labinvest.2009.45. [DOI] [PubMed] [Google Scholar]
- Jiao B, Wang YS, Cheng YN, Gao JJ, Zhang QZ. Valsartan attenuated oxidative stress, decreased MCP-1 and TGF-beta1 expression in glomerular mesangial and epithelial cells induced by high-glucose levels. Biosci Trends. 2011;5:173–181. doi: 10.5582/bst.2011.v5.4.173. [DOI] [PubMed] [Google Scholar]
- Johren O, Saavedra JM. Expression of AT1A and AT1B angiotensin II receptor messenger RNA in forebrain of 2-wk-old rats. Am J Physiol. 1996;271:E104–112. doi: 10.1152/ajpendo.1996.271.1.E104. [DOI] [PubMed] [Google Scholar]
- Jung KH, Chu K, Lee ST, Kim SJ, Song EC, Kim EH, et al. Blockade of AT1 receptor reduces apoptosis, inflammation, and oxidative stress in normotensive rats with intracerebral hemorrhage. J Pharmacol Exp Ther. 2007;322:1051–1058. doi: 10.1124/jpet.107.120097. [DOI] [PubMed] [Google Scholar]
- Kasahara Y, Taguchi A, Uno H, Nakano A, Nakagomi T, Hirose H, et al. Telmisartan suppresses cerebral injury in a murine model of transient focal ischemia. Brain Res. 2010;1340:70–80. doi: 10.1016/j.brainres.2010.03.101. [DOI] [PubMed] [Google Scholar]
- Lanz TV, Ding Z, Ho PP, Lou J, Agrawal AN, Srinagesh H, et al. Angiotensin II sustains brain inflammation in mice via TGF-β. J Clin Invest. 2010;120:2782–2794. doi: 10.1172/JCI41709. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Larrayoz IM, Pang T, Benicky J, Pavel J, Sanchez-Lemus E, Saavedra JM. Candesartan reduces the innate immune response to lipopolysaccharide in human monocytes. J Hypertens. 2009;27:2365–2376. doi: 10.1097/HJH.0b013e3283314bc7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li JM, Mogi M, Iwanami J, Min LJ, Tsukuda K, Sakata A, et al. Temporary pretreatment with the angiotensin II type 1 receptor blocker, valsartan, prevents ischemic brain damage through an increase in capillary density. Stroke. 2008;39:2029–2036. doi: 10.1161/STROKEAHA.107.503458. [DOI] [PubMed] [Google Scholar]
- Liu H, Kitazato KT, Uno M, Yagi K, Kanematsu Y, Tamura T, et al. Protective mechanisms of the angiotensin II type 1 receptor blocker candesartan against cerebral ischemia: in-vivo and in-vitro studies. J Hypertens. 2008;26:1435–1445. doi: 10.1097/HJH.0b013e3283013b6e. [DOI] [PubMed] [Google Scholar]
- Loane DJ, Faden AI. Neuroprotection for traumatic brain injury: translational challenges and emerging therapeutic strategies. Trends Pharmacol Sci. 2010;31:596–604. doi: 10.1016/j.tips.2010.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maeda A, Okazaki T, Inoue M, Kitazono T, Yamasaki M, Lemonnier FA, et al. Immunosuppressive effect of angiotensin receptor blocker on stimulation of mice CTLs by angiotensin II. Int Immunopharmacol. 2009;9:1183–1188. doi: 10.1016/j.intimp.2009.06.006. [DOI] [PubMed] [Google Scholar]
- Malchiodi-Albedi F, Matteucci A, Bernardo A, Minghetti L. PPAR-gamma, microglial cells, and ocular inflammation: new venues for potential therapeutic approaches. PPAR Res. 2008;2008:295784. doi: 10.1155/2008/295784. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marklund N, Hillered L. Animal modelling of traumatic brain injury in preclinical drug development: where do we go from here. Br J Pharmacol. 2011;164:1207–1229. doi: 10.1111/j.1476-5381.2010.01163.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McTigue DM, Tripathi R, Wei P, Lash AT. The PPAR gamma agonist pioglitazone improves anatomical and locomotor recovery after rodent spinal cord injury. Experimental neurology. 2007;205:396–406. doi: 10.1016/j.expneurol.2007.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Meredith PA, Murray LS, McMurray JJ. A putative placebo comparison of the SCOPE and LIFE trials. J Renin Angiotensin Aldosterone Syst. 2004;5:59–63. doi: 10.3317/jraas.2004.011. [DOI] [PubMed] [Google Scholar]
- Nishimura Y, Ito T, Hoe K, Saavedra JM. Chronic peripheral administration of the angiotensin II AT(1) receptor antagonist candesartan blocks brain AT(1) receptors. Brain Res. 2000;871:29–38. doi: 10.1016/s0006-8993(00)02377-5. [DOI] [PubMed] [Google Scholar]
- O'Connor WT, Smyth A, Gilchrist MD. Animal models of traumatic brain injury: a critical evaluation. Pharmacol Ther. 2011;130:106–113. doi: 10.1016/j.pharmthera.2011.01.001. [DOI] [PubMed] [Google Scholar]
- Occleston NL, Laverty HG, O'Kane S, Ferguson MW. Prevention and reduction of scarring in the skin by transforming growth factor beta 3 (TGFbeta3): from laboratory discovery to clinical pharmaceutical. J Biomater Sci Polym Ed. 2008;19:1047–1063. doi: 10.1163/156856208784909345. [DOI] [PubMed] [Google Scholar]
- Omura-Matsuoka E, Yagita Y, Sasaki T, Terasaki Y, Oyama N, Sugiyama Y, et al. Postischemic administration of angiotensin II type 1 receptor blocker reduces cerebral infarction size in hypertensive rats. Hypertens Res. 2009;32:548–553. doi: 10.1038/hr.2009.69. [DOI] [PubMed] [Google Scholar]
- Ozacmak VH, Sayan H, Cetin A, Akyildiz-Igdem A. AT1 receptor blocker candesartan-induced attenuation of brain injury of rats subjected to chronic cerebral hypoperfusion. Neurochem Res. 2007;32:1314–1321. doi: 10.1007/s11064-007-9305-1. [DOI] [PubMed] [Google Scholar]
- Pang T, Benicky J, Wang J, Orecna M, Sanchez-Lemus E, Saavedra JM. Telmisartan ameliorates lipopolysaccharide-induced innate immune response through peroxisome proliferator-activated receptor-gamma activation in human monocytes. J Hypertens. 2012;30:87–96. doi: 10.1097/HJH.0b013e32834dde5f. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paul M, Poyan Mehr A, Kreutz R. Physiology of local renin-angiotensin systems. Physiol Rev. 2006;86:747–803. doi: 10.1152/physrev.00036.2005. [DOI] [PubMed] [Google Scholar]
- Poon IO. Effects of antihypertensive drug treatment on the risk of dementia and cognitive impairment. Pharmacotherapy. 2008;28:366–375. doi: 10.1592/phco.28.3.366. [DOI] [PubMed] [Google Scholar]
- Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK. The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation. Nature. 1998;391:79–82. doi: 10.1038/34178. [DOI] [PubMed] [Google Scholar]
- Robbins ME, Zhao W, Garcia-Espinosa MA, Diz DI. Renin-angiotensin system blockers and modulation of radiation-induced brain injury. Curr Drug Targets. 2010;11:1413–1422. doi: 10.2174/1389450111009011413. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rodriguez-Pallares J, Rey P, Parga JA, Munoz A, Guerra MJ, Labandeira-Garcia JL. Brain angiotensin enhances dopaminergic cell death via microglial activation and NADPH-derived ROS. Neurobiol Dis. 2008;31:58–73. doi: 10.1016/j.nbd.2008.03.003. [DOI] [PubMed] [Google Scholar]
- Rosenkranz S. TGF-beta1 and angiotensin networking in cardiac remodeling. Cardiovasc Res. 2004;63:423–432. doi: 10.1016/j.cardiores.2004.04.030. [DOI] [PubMed] [Google Scholar]
- Rotman N, Wahli W. PPAR modulation of kinase-linked receptor signaling in physiology and disease. Physiology (Bethesda) 2010;25:176–185. doi: 10.1152/physiol.00018.2010. [DOI] [PubMed] [Google Scholar]
- Saavedra JM. Brain and pituitary angiotensin. Endocr Rev. 1992;13:329–380. doi: 10.1210/edrv-13-2-329. [DOI] [PubMed] [Google Scholar]
- Saavedra JM, Sanchez-Lemus E, Benicky J. Blockade of brain angiotensin II AT1 receptors ameliorates stress, anxiety, brain inflammation and ischemia: therapeutic implications. Psychoneuroendocrinology. 2011;36:1–18. doi: 10.1016/j.psyneuen.2010.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Santos CC, Zhang H, Liu M, Slutsky AS. Bench-to-bedside review: biotrauma and modulation of the innate immune response. Crit Care. 2005;9:280–286. doi: 10.1186/cc3022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Savoia C, Schiffrin EL. Vascular inflammation in hypertension and diabetes: molecular mechanisms and therapeutic interventions. Clin Sci (Lond) 2007;112:375–384. doi: 10.1042/CS20060247. [DOI] [PubMed] [Google Scholar]
- Sookplung P, Siriussawakul A, Malakouti A, Sharma D, Wang J, Souter MJ, et al. Vasopressor use and effect on blood pressure after severe adult traumatic brain injury. Neurocrit Care. 2011;15:46–54. doi: 10.1007/s12028-010-9448-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stenman E, Edvinsson L. Cerebral ischemia enhances vascular angiotensin AT1 receptor-mediated contraction in rats. Stroke. 2004;35:970–974. doi: 10.1161/01.STR.0000121642.53822.58. [DOI] [PubMed] [Google Scholar]
- Sugawara A, Uruno A, Matsuda K, Funato T, Saito-Hakoda A, Kudo M, et al. Effects of PPARgamma agonists against vascular and renal dysfunction. Curr Mol Pharmacol. 2011. [DOI] [PubMed]
- Sugawara T, Kinouchi H, Oda M, Shoji H, Omae T, Mizoi K. Candesartan reduces superoxide production after global cerebral ischemia. Neuroreport. 2005;16:325–328. doi: 10.1097/00001756-200503150-00004. [DOI] [PubMed] [Google Scholar]
- Sun Y, Zhang JQ, Zhang J, Ramires FJ. Angiotensin II, transforming growth factor-beta1 and repair in the infarcted heart. J Mol Cell Cardiol. 1998;30:1559–1569. doi: 10.1006/jmcc.1998.0721. [DOI] [PubMed] [Google Scholar]
- Susarla BT, Laing ED, Yu P, Katagiri Y, Geller HM, Symes AJ. Smad proteins differentially regulate transforming growth factor-β mediated induction of chondrotin sulfate proteoglycans. J Neurochem. 2011;119:868–878. doi: 10.1111/j.1471-4159.2011.07470.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tham DM, Martin-McNulty B, Wang YX, Wilson DW, Vergona R, Sullivan ME, et al. Angiotensin II is associated with activation of NF-kappaB-mediated genes and downregulation of PPARs. Physiol Genomics. 2002;11:21–30. doi: 10.1152/physiolgenomics.00062.2002. [DOI] [PubMed] [Google Scholar]
- Thone-Reineke C, Steckelings UM, Unger T. Angiotensin receptor blockers and cerebral protection in stroke. J Hypertens Suppl. 2006;24:S115–121. doi: 10.1097/01.hjh.0000220416.07235.37. [DOI] [PubMed] [Google Scholar]
- Timaru-Kast R, Wyschkon S, Luh C, Schaible EV, Lehmann F, Merk P, et al. Delayed inhibition of angiotensin II receptor type 1 reduces secondary brain damage and improves functional recovery after experimental brain trauma*. Crit Care Med. 2012;40:935–944. doi: 10.1097/CCM.0b013e31822f08b9. [DOI] [PubMed] [Google Scholar]
- Tsutsumi K, Saavedra JM. Characterization and development of angiotensin II receptor subtypes (AT1 and AT2) in rat brain. Am J Physiol. 1991;261:R209–216. doi: 10.1152/ajpregu.1991.261.1.R209. [DOI] [PubMed] [Google Scholar]
- Van Mieghem W, Billiouw JM, Brohet C, Dupont AG, Gazagnes MD, Heller F, et al. Are ACE-inhibitors or ARB's still needed for cardiovascular prevention in high risk patients? Insights from profess and transcend. Acta Clin Belg. 2010;65:107–114. doi: 10.1179/acb.2010.022. [DOI] [PubMed] [Google Scholar]
- Villapol S, Fau S, Renolleau S, Biran V, Charriaut-Marlangue C, Baud O. Melatonin promotes myelination by decreasing white matter inflammation after neonatal stroke. Pediatr Res. 2011;69:51–55. doi: 10.1203/PDR.0b013e3181fcb40b. [DOI] [PubMed] [Google Scholar]
- Vivien D, Ali C. Transforming growth factor-beta signalling in brain disorders. Cytokine Growth Factor Rev. 2006;17:121–128. doi: 10.1016/j.cytogfr.2005.09.011. [DOI] [PubMed] [Google Scholar]
- Wang Y, Moges H, Bharucha Y, Symes A. Smad3 null mice display more rapid wound closure and reduced scar formation after a stab wound to the cerebral cortex. Exp Neurol. 2007;203:168–184. doi: 10.1016/j.expneurol.2006.08.006. [DOI] [PubMed] [Google Scholar]
- Xiao J, Leung JC, Chan LY, Tang SC, Lai KN. Crosstalk between peroxisome proliferator-activated receptor-gamma and angiotensin II in renal tubular epithelial cells in IgA nephropathy. Clin Immunol. 2009;132:266–276. doi: 10.1016/j.clim.2009.04.004. [DOI] [PubMed] [Google Scholar]
- Yamakawa H, Jezova M, Ando H, Saavedra JM. Normalization of endothelial and inducible nitric oxide synthase expression in brain microvessels of spontaneously hypertensive rats by angiotensin II AT1 receptor inhibition. J Cereb Blood Flow Metab. 2003;23:371–380. doi: 10.1097/01.WCB.0000047369.05600.03. [DOI] [PubMed] [Google Scholar]
- Yi JH, Park SW, Brooks N, Lang BT, Vemuganti R. PPARgamma agonist rosiglitazone is neuroprotective after traumatic brain injury via anti-inflammatory and anti-oxidative mechanisms. Brain Res. 2008;1244:164–172. doi: 10.1016/j.brainres.2008.09.074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu CM, Tipoe GL, Wing-Hon Lai K, Lau CP. Effects of combination of angiotensin-converting enzyme inhibitor and angiotensin receptor antagonist on inflammatory cellular infiltration and myocardial interstitial fibrosis after acute myocardial infarction. J Am Coll Cardiol. 2001;38:1207–1215. doi: 10.1016/s0735-1097(01)01518-2. [DOI] [PubMed] [Google Scholar]
- Zanchetti A, Elmfeldt D. Findings and implications of the Study on COgnition and Prognosis in the Elderly (SCOPE) – a review. Blood Press. 2006;15:71–79. doi: 10.1080/08037050600771583. [DOI] [PubMed] [Google Scholar]
- Zhao SM, Shen LH, Li HW, Wang L, Chen H, Wang YL, et al. Down-regulation of the expression of angiotensin II type 1 receptor in neonatal rat cardiac fibroblast by activation of PPARgamma signal pathway. Chin J Physiol. 2008;51:357–362. [PubMed] [Google Scholar]
- Zhou J, Ando H, Macova M, Dou J, Saavedra JM. Angiotensin II AT1 receptor blockade abolishes brain microvascular inflammation and heat shock protein responses in hypertensive rats. J Cereb Blood Flow Metab. 2005;25:878–886. doi: 10.1038/sj.jcbfm.9600082. [DOI] [PubMed] [Google Scholar]
- Zhou J, Pavel J, Macova M, Yu ZX, Imboden H, Ge L, et al. AT1 receptor blockade regulates the local angiotensin II system in cerebral microvessels from spontaneously hypertensive rats. Stroke. 2006;37:1271–1276. doi: 10.1161/01.STR.0000217404.64352.d7. [DOI] [PubMed] [Google Scholar]
- Zorad S, Dou JT, Benicky J, Hutanu D, Tybitanclova K, Zhou J, et al. Long-term angiotensin II AT1 receptor inhibition produces adipose tissue hypotrophy accompanied by increased expression of adiponectin and PPARgamma. Eur J Pharmacol. 2006;552:112–122. doi: 10.1016/j.ejphar.2006.08.062. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zuhayra M, Zhao Y, von Forstner C, Henze E, Gohlke P, Culman J, et al. Activation of cerebral peroxisome proliferator-activated receptors gamma (PPARgamma) reduces neuronal damage in the substantia nigra after transient focal cerebral ischaemia in the rat. Neuropathol Appl Neurobiol. 2011;37:738–752. doi: 10.1111/j.1365-2990.2011.01169.x. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.