Skip to main content
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 2004 Mar;24(5):2083–2090. doi: 10.1128/MCB.24.5.2083-2090.2004

Id2 Is Dispensable for Myc-Induced Epidermal Neoplasia

Daniel J Murphy 1, Lamorna Brown Swigart 1, Mark A Israel 2, Gerard I Evan 1,*
PMCID: PMC350569  PMID: 14966287

Abstract

We have previously described a transgenic mouse model of epidermal neoplasia wherein expression of a switchable form of c-Myc, MycERTAM, is targeted to the postmitotic suprabasal keratinocytes of murine epidermis via the involucrin promoter. Sustained activation of c-MycERTAM results in a progressive neoplastic phenotype characterized by aberrant ectopic proliferation and delayed differentiation of suprabasal keratinocytes, culminating in papillomatosis. Transcription of the Id2 gene is regulated by Myc family proteins. Moreover, Id2 is implicated as a pivotal determinant of cell fate in multiple lineages and has a demonstrated role in mediating Myc-dependent cell proliferation in vitro through its interaction with retinoblastoma protein. Using Id2 nullizygous mice, we assessed in vivo the requirement for Id2 in mediating Myc-induced papilloma formation in skin. We show that absence of Id2 has no discernible impact on any measurable attribute of Myc function or on the timing or extent of eventual tumor formation. Thus, our data argue against any essential role for Id2 in mediating Myc action in vivo.


Deregulated expression of myc family oncogenes occurs in a wide range of human cancers and is often associated with aggressive, poorly differentiated tumors (28). As members of the bHLH-Zip transcription factor family, Myc proteins are thought to exert their biological effects by modulating, either positively or negatively, expression of downstream target genes (24). Indeed, recent advances in expression array and serial analysis of gene expression technologies have indicated that Myc proteins regulate a bewilderingly diverse variety of genes which are variously implicated in almost every aspect of cellular activity, including proliferation and differentiation, growth and apoptosis, metabolism, intracellular transport and organization, and interactions with the somatic cell environment (6, 10, 27, 31, 41). The breadth of potential Myc target genes, together with the highly contingent nature of the pathways and processes they oversee, makes it a great challenge to determine which attributes of Myc proteins are most critical for their tumorigenic properties.

The Id2 gene was recently identified as a direct transcriptional target of both N-Myc and c-Myc (23). Using a conditional form of N-Myc (N-MycER), in which N-Myc activity is rendered dependent on the presence of the ligand 4-hydroxy-tamoxifen (4-OHT) by fusion with the estrogen receptor ligand binding domain (25), activation of N-Myc was demonstrated to rapidly induce expression of Id2 at both mRNA and protein levels. Induction of Id2 by N-Myc (and by c-Myc) is dependent on the presence of two Myc consensus E boxes located within the Id2 5′ regulatory region. Consistent with this, chromatin immunoprecipitation analysis has indicated binding of c-Myc/Max heterodimers to the Id2 promoter (23). Moreover, transforming growth factor β-mediated inhibition of Id2 expression is associated with displacement of Myc/Max heterodimers from, and enhanced binding of Mad4/Max heterodimers to, the Id2 promoter and correlates with proliferative arrest in both mouse mammary epithelial cells and human keratinocytes (42). Intriguingly, the combination of deregulated Myc and constitutively activated Ras fails to transform Id2-deficient mouse embryonic fibroblasts in vitro (23; D. J. Murphy and M. A. Israel, unpublished results), intimating that Id2 may mediate a Myc-dependent function(s) necessary for cell transformation. An additional study revealed a close correlation between N-Myc amplification and Id2 expression in neuroblastomas, implicating Id2 as a potential prognostic indicator for this disease (21), although more recent analyses have questioned this particular finding (40, 44, 45).

Id2 is one of four related and evolutionarily conserved helix-loop-helix (HLH) proteins that dimerize with the various basic region HLH (bHLH) transcription factors whose members modulate diverse aspects of cell differentiation, proliferation, and survival (29, 30, 48). Because the Id proteins lack a DNA binding basic motif, their heterodimerization with bHLH proteins prevents the latter from binding E-box DNA elements. Consequently, Id proteins act as endogenous negative regulators of bHLH function (3, 17). Indeed, Id proteins are widely expressed during embryogenesis and appear to be intimately involved in regulating cellular differentiation in a spectrum of lineages (15, 16, 37).

Several in vitro studies have indicated that Id proteins promote cell proliferation. Thus, antisense blockade of Id1, Id2, and Id3 expression significantly extends the G1 phase of the cell cycle (1, 11), while both Id2 and Id4 bind the retinoblastoma gene (Rb) product Rb and related proteins, p107 and p130, antagonizing their ability to repress E2F-dependent transcription and cell cycle progression (13, 22; previously discussed in reference 29). Moreover, Id1 (and probably other Id proteins) blocks the ability of the ubiquitous bHLH protein E2A to induce expression of the cell cycle inhibitor p21 (35), while Id4 blocks E protein-mediated induction of p21CIP1, p15INK4b, and p16INK4a promoter activity (33). In addition, Id1, Id2, and Id3 can all inhibit Ets domain transcription factors (47), and Id1 specifically inhibits induction of p16INK4a by Ets1 and Ets2 (32). The demonstrated role of Id proteins in promoting cell proliferation in vitro is corroborated by the general observation that Id proteins are more highly expressed in rapidly dividing cells and absent from most terminally differentiated adult tissues. Furthermore, Id genes are frequently expressed at high levels in many human tumors while enforced transgenic expression of Id proteins is tumorigenic in several tissues, including pancreas, colon, and thymus (14, 39, 43). Taken together, these various observations show that the Id proteins are excellent candidates for coordinating the often mutually exclusive processes of differentiation and proliferation.

All four Id genes have been germ line ablated individually in mice, and while each alone exhibits a relatively mild phenotype, the combined loss of any two of the Id1, Id2, and Id3 genes results in embryonic lethality (26; previously discussed in references 29 and 39). Deletion of Id2 alone results in a dramatic reduction in NK cell number and the absence of secondary lymphoid organs. In addition, Id2-null mice, while indistinguishable from their wild-type (wt) littermates at birth, exhibit stunted growth by adulthood and, furthermore, mammary gland maturation is defective in pregnant Id2-null females. Intriguingly, deletion of Id2 partially rescues Rb-null embryos, which, instead of aborting by embryonic day 14.5, survive to term. However, such Id2/Rb double nullizygous pups are stillborn, most likely as a consequence of reduced skeletal muscle development leading to inadequate respiratory muscle function postpartum (23). Although this might suggest that Rb functions in part during embryogenesis to regulate Id2 and that the lethality of Rb-null embryos at embryonic day 14.5 is in part due to unrestrained Id2 activity, recent studies indicating that the lethality of Rb-null mice is principally a placental defect (7, 46) have complicated interpretation. Nonetheless, in vitro bromodeoxyuridine incorporation experiments have shown that the inability of Myc to prevent cell cycle exit of Id2-null mouse embryonic fibroblasts upon serum withdrawal is corrected when Rb is also deleted, suggesting that Myc requires Id2 to overcome the Rb-mediated cell cycle arrest (23).

Previously, we reported the development of an acutely inducible mouse model of epidermal hyperplasia in which the 4-OHT-dependent switchable c-MycERTAM protein is targeted to suprabasal keratinocytes of the murine epidermis via the involucrin promoter. Topical application of 4-OHT to the dorsal skin of such Inv-MycERTAM mice activates MycERTAM function, triggering rapid entry of normally postmitotic immediate suprabasal keratinocytes into the cell cycle. This leads to progressive suprabasal hyperplasia associated with delayed keratinocyte differentiation, profound angiogenesis in the adjacent dermal compartment, and, eventually, papilloma formation. The rapidity, reproducibility, and pleiotropism of Myc action in this in vivo model make it an excellent system with which to assess the role of Id2 as an obligate downstream Myc effector. Here, we present data demonstrating that the absence of Id2 has no discernible influence on any measured aspect of Myc function in murine epidermis.

MATERIALS AND METHODS

Mice, genotyping, treatment, and sample collection.

All mice were housed, fed, and treated in accordance with protocols approved by the committee for animal research at the University of California, San Francisco. Inv-MycERTAM mice, on a mixed C57Bl6/CBA background, were bred to Id2 heterozygous mice, on a 129 background, and backcrossed to yield Inv-MycERTAM/Id2-null and Inv-MycERTAM/Id2-wt offspring. Genotyping was performed on tail snip DNA by PCR with the following primer sets: MycS3 (forward, AGGGTCAAGTTGGACAGTGTCAGAGTC); MycERTAM (reverse, CCAAAGGTTGGCAGCCCTCATGTC); ID2-105 (forward, AGGCGCCAGTCTGCTTCTTGTAAC); ID2-3 (wt) (reverse, CAAAACTGTAGCCCTCTGAG); and NEO-8 (Id2 null) (reverse, TAGCCTGAAGAACGAGATCAGCAG).

Two- to four-month-old mice were shaved to reveal an ∼2-cm2 area of dorsal skin and topically treated daily with 200 μl of 4-OHT (5 mg/ml) in ethanol or 200 μl of ethanol alone. Two to three mice of each genotype were euthanized with CO2, followed by cervical dislocation, at each indicated time point. Skin tissue was harvested from the treatment area, bisected, either frozen fresh in OCT (TissueTek) or fixed in 4% neutral buffered paraformaldehyde (PFA), dehydrated, and embedded in paraffin.

In situ hybridization.

Antisense RNA probes were transcribed in vitro from linearized plasmid template DNA in the presence of 35S-UTP. To probe for Id2 expression, a 235-bp XbaI-SalI fragment representing 3′ untranslated sequence, subcloned into pBluescript SK (Stratagene), was linearized with BglII and transcribed with T7 RNA polymerase. To probe for Id4 expression, a 443-bp EcoRI fragment representing 3′ untranslated sequence, subcloned into pCRII (Invitrogen), was linearized with NotI and transcribed with SP6 RNA polymerase. ODC-1 probe was generated against an ∼530-bp HindIII-NcoI fragment from the 3′ end of the ODC-1 cDNA, subcloned into pBluescript SK, linearized with HindIII, and transcribed with T7 RNA polymerase. Probes were hydrolyzed to ∼300 bp (Id2 probe excepted) in 2× sodium carbonate buffer (1 M NaHCO3-1 M Na2CO3 [pH 10]), neutralized with acetic acid (to a final concentration of 0.3%), precipitated in ethanol, and resuspended in 10 mM dithiothreitol.

Ten-micrometer-thick frozen tissue sections were thawed, air dried, and pretreated at room temperature (RT) for hybridization as follows: 20 min in 4% PFA, 4 min in 3× phosphate-buffered saline (PBS), two times for 4 min in 1× PBS, air dried briefly, 20 min in proteinase K solution (100 mM Tris [pH 8.0]-50 mM EDTA-1 μg of proteinase K/ml), 5 min in 4% PFA, 4 min in 3× PBS, two times for 4 min in 1× PBS, 15 s in diethyl pyrocarbonate-treated distilled water, air dried briefly, 10 min in 200 ml of 0.1 M triethanolamine containing 500 μl of acetic anhydride, rinsed twice in diethyl pyrocarbonate-treated distilled water, and air dried prior to hybridization.

Riboprobes (106 dpm/slide) were heat denatured at 65°C for 5 min and mixed with hybridization solution (50% [vol/vol] formamide, 10% [wt/vol] dextran sulfate, 2× Denhardt's solution, 5× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate], 10 mM β-mercaptoethanol, 250 μg of yeast tRNA/ml, 500 μg of single-stranded DNA/ml; ∼100 μl/slide) preheated to 55°C. Probe was added directly to sample slides, which were then covered with Parafilm and incubated overnight at 55°C in a humid chamber. After hybridization, Parafilm strips were removed and slides were washed in the following solutions before being dehydrated through graded ethanol and air dried: 30 min at 55°C in 50% formamide-2× SSC-1 mM EDTA-10 mM β-mercaptoethanol, 30 min at RT in 2× SSC, 1 h at RT in 2× SSC-1 mM EDTA-20 μg of RNase A/ml-1 U of RNase T1/ml, two times for 30 min at 55°C in 2× SSC, and 5 min at RT in 0.2× SSC. Radiolabeled slides were dipped in photographic emulsion (Kodak) mixed at a ratio of 1:1 with 1% glycerol, dried, and stored for 4 to 10 days. Slides were then immersed in developing solution (Kodak no. 146 4593) for 5 min at 16°C, rinsed in water, and fixed (Kodak fixer no. 197 1746) and then dehydrated through graded ethanol and mounted with coverslips. Labeled sections were analyzed by dark-field imaging using a Leica DM RXA microscope.

Immunohistochemistry.

The primary antibodies used were anti-K10 (1:2,000 dilution) and anti K14 (1:10,000 dilution; Covance PRB-155p and PRB-159p), anti-PCNA (1:100 dilution; Biogenex-mu206-uc), CD-31 (1:50 dilution; Pharmingen 01951D), and anti-Id1 (1:50 dilution) and anti-Id3 (1:50 dilution; Santa Cruz sc488 and sc490). Immunohistochemistry and immunofluorescence analyses were performed on 5-μm-thick paraffin-embedded sections as previously described (34), with the exception of CD31 staining, which was performed on 10-μm-thick frozen sections. Briefly, paraffin-embedded slides were deparaffinized and rehydrated through graded ethanols. For MCM-7, PCNA, and K14, antigen retrieval was performed by microwaving on low power for 5 min in 10 mM sodium citrate (pH 6.0). Sections were incubated in blocking solution (4% bovine serum albumin-3% preimmune goat serum-2% fish gelatin) for 1 h at RT, and primary antibodies were added in blocking buffer and incubated overnight at 4°C. Secondary antibodies were diluted 1:200 in blocking solution and incubated at RT for 1 h. Horseradish peroxidase (HRP)-conjugated goat anti-rabbit (Pierce) was used to identify K10 and K14 staining, HRP-conjugated goat anti-mouse immunoglobulin M (Vector) was used for PCNA staining, Alexa 488-conjugated goat anti-rabbit was used to detect anti-Id1 and Id3 antibodies, and Alexa 488-conjugated goat anti-rat (Molecular Probes) was used to detect CD-31. Alexa 488-stained sections were counterstained with propidium iodide (1 μg/ml) in fluorescent mounting medium (Dako) and analyzed by fluorescence microscopy. HRP-labeled sections were incubated with ABC reagent (Vectastain) and developed with diacylbutyrate (DAB). DAB-stained slides were counterstained lightly with hematoxylin, dehydrated through graded ethanols, mounted with coverslips, and analyzed by light microscopy.

RESULTS

Id2 is expressed in c-Myc-induced epidermal hyperplasia.

We first investigated whether Id2 is expressed in skin epidermis following c-Myc activation. Myc-induced papillomatous epidermal lesions were elicited by topical treatment of shaved dorsal Inv-MycERTAM mouse skin (2 cm2) daily with 1 mg of 4-OHT/day for a period of 2 weeks, as described previously (34). Littermate transgene-negative mice were treated similarly to serve as controls. At the end of the 2-week treatment, Inv-MycERTAM skin was visibly thickened and flaking, as described previously (34). Mice were then euthanized, and the treated area of skin was harvested. Half of the sample was fixed with 4% PFA and paraffin-embedded, while the other half was snap frozen.

Histological analysis of Inv-MycERTAM skin revealed the epidermis of 4-OHT-treated mice to be several layers thicker than that of transgene-negative control samples. Immunohistochemistry confirmed the marked accumulation of less differentiated suprabasal keratinocytes. Expression of Id2 was then assayed by in situ hybridization, while adjacent sections were probed for expression of the well-characterized Myc target gene ODC-1 to confirm Myc transcriptional activity (Fig. 1). As a negative control, we used antisense riboprobe for Id4, which is not expressed in skin (16). ODC-1 expression was detectable in all nucleated keratinocytes, with essentially uniform expression across the epidermal strata. Id2 was also detected throughout the epidermis, although in this case a gradient of expression was apparent, with highest expression of Id2 in the inner (i.e., basal and immediately suprabasal) layers. This gradient in expression is consonant with that of the proliferation markers PCNA and Ki67 (34; I. Flores, D. J. Murphy, L. Brown Swigart, and L. Evan, unpublished data). Thus, the pattern of Id2 expression correlates with the proliferative state of keratinocytes rather better than with Myc activity, as assessed by ODC-1 expression. Id4 expression was undetectable anywhere within either normal or hyperplastic epidermis.

FIG. 1.

FIG. 1.

Id2 is expressed in hyperplastic Inv-MycERTAM epidermis. Frozen sections of dorsal epidermis from wt (left panels) and Inv-MycERTAM (right panels) mice treated for 2 weeks with 4-OHT were hybridized with 35S-labeled antisense riboprobe specific for ODC-1, Id2, or Id4 mRNA. Dark-field microscopy revealed the presence of ODC-1 transcripts throughout all layers of the hyperplastic epidermis and a gradient of Id2 transcripts, highest in the inner (less differentiated) layers of the hyperplastic epidermis. Id4 transcripts by contrast were absent from normal and hyperplastic epidermis. Staining of hair cells was nonspecific.

Id2 is dispensable for development and full progression of Myc-induced papillomas.

To determine the extent to which Id2 expression might be required for any aspect of the Myc-induced papilloma phenotype, Inv-MycERTAM mice were crossed with Id2-deficient mice and then backcrossed to yield either Inv-MycERTAM/Id2-null or Inv-MycERTAM/Id2-wt offspring. Two- to four-month-old mice of appropriate genotypes were then treated topically with 4-OHT as before, and littermate or age-matched cohorts were sacrificed after 7, 14, or 22 days of sustained MycERTAM activation. We could discern no difference between Id2-deficient animals and Id2-wt controls with regard to either the rate or extent of Myc-induced tumor formation (Fig. 2). After 7 days of sustained MycERTAM activation, the epidermis of both Inv-MycERTAM/Id2-null and Inv-MycERTAM/Id2-wt mice presented five to six layers of nucleated keratinocytes in place of the normal one to two layers. Epidermal thickness roughly doubled over the second week of Myc activation and was accompanied by progressive dysplasia, with papillomatosis clearly evident by the onset of the third week of Myc activation.

FIG. 2.

FIG. 2.

Id2 is not required for the Myc-induced papillomatous phenotype. Hematoxylin and eosin (H&E) staining of Inv-MycERTAM/Id2-wt and Inv-MycERTAM/Id2-null epidermis after 7, 14, or 22 days of Myc activation. Inv-MycERTAM-positive mice treated for 22 days with ethanol (top panels) and Inv-MycERTAM-negative mice treated with 4-OHT (data not shown) comprised negative controls.

Id2 is not required for Myc-induced keratinocyte proliferation.

Although absence of Id2 had no overall effect on Myc-induced papillomatosis, it remained possible that lack of Id2 might compromise specific aspects of Myc function that are then compensated for in some way. For this reason, we assessed separately the effects of Id2 loss on Myc-induced keratinocyte proliferation and apoptosis.

In normal epidermis, proliferating keratinocytes are present only within the basal layer: as cells detach from the basal lamina and migrate into the suprabasal compartment, they drop out of cycle and differentiate (8). In contrast, Myc-induced epidermal hyperplasia in Inv-MycERTAM mice is characterized by the presence of proliferating keratinocytes several layers into the expanded suprabasal compartment. To assess whether the absence of Id2 affected Myc-induced keratinocyte proliferation, we used antibodies specific for the cell proliferation marker PCNA to analyze immunohistochemically the proliferative status of skin cells (Fig. 3). As expected, activation of Myc in the suprabasal compartment of murine epidermis resulted in the progressive accumulation of cycling suprabasal keratinocytes in Inv-MycERTAM/Id2-wt mice. Within 7 days of onset of sustained MycERTAM activation, PCNA expression was clearly evident in the immediately suprabasal cell layers. By 3 weeks, PCNA expression extended all the way through the hyperplastic suprabasal skin to the granular layer. Essentially identical staining was observed using antibodies specific for the DNA replication licensing factor MCM-7 (data not shown). We could discern no difference in the onset or prevalence of Myc-induced suprabasal keratinocyte proliferation in the absence of Id2 nor on the polarity of accumulation (from the basal layer outwards).

FIG. 3.

FIG. 3.

Myc-induced keratinocyte proliferation is unaffected by deletion of Id2. Inv-MycERTAM/Id2-wt and Inv-MycERTAM/Id2-null mice were treated with 4-OHT for 7, 14, or 22 days or with ethanol for 22 days. Expression of PCNA, indicative of cycling cells, is normally restricted to the basal layer of murine epidermis (top panels). DAB staining of keratinocyte nuclei reveals PNCA expression gradually extending through all layers of the suprabasal epidermis upon prolonged activation of MycERTAM with 4-OHT.

Negligible apoptosis accompanies Myc-induced epidermal hyperplasia in Id2-wt mice (34; Flores et al., unpublished). We observed a similar absence of detectable keratinocyte apoptosis in the absence of Id2 (data not shown).

Id2 expression is not required for c-Myc to delay keratinocyte differentiation.

The augmented proliferation and hyperplasia of suprabasal keratinocytes induced by activation of MycERTAM is accompanied by accumulation of less differentiated suprabasal cells. This is manifested by the persistent expression of basal markers such as keratin K14 and p63 out into the suprabasal layers together with a delayed or reduced expression of suprabasal cell markers such as involucrin and keratins K1 and K10 (34; Flores et al., unpublished). To explore any influence of Id2 absence on this aspect of Myc action, we examined the effects of Myc activation in Id2-wt and Id2-null mice immunohistochemically by using basal and suprabasal epidermal markers.

In normal epidermis, K10 is expressed exclusively in the spinous and granular layers (5). After 3 weeks of sustained suprabasal MycERTAM activation, expression of K10 becomes progressively lost from the inner suprabasal layers, shifting outwards into the greatly thickened spinous and granular layers (Fig. 4A). In contrast, expression of the basal marker K14 progressively extends out from the basal compartment into the suprabasal one in a manner reciprocal to that of K10 (Fig. 4B). Such apposition was identical in Id2-null mice. The absence of Id2 altered neither the timing nor the extent of these Myc-induced effects, challenging the notion that Id2 is a key mediator of Myc's ability to disrupt differentiation.

FIG. 4.

FIG. 4.

FIG. 4.

Deletion of Id2 does not alter the delayed differentiation of suprabasal keratinocytes, induced by prolonged Myc activation. (A) Expression of keratin K10 in Inv-MycERTAM/Id2-wt and Inv-MycERTAM/Id2-null skin treated with 4-OHT for 7, 14, or 22 days. K10 expression normally initiates in the immediately suprabasal cell layer (top panels) but is delayed in onset and reduced in levels of expression after 14 days and especially after 22 days of continuous Myc activation. (B) Expression of keratin K14 in Inv-MycERTAM/Id2-wt and Inv-MycERTAM/Id2-null skin treated with 4-OHT for 7, 14, or 22 days. Keratin K14 identifies basal keratinocytes and keratinocyte stem cells. Because K14 is a relatively stable protein, DAB staining extends into the immediately suprabasal layer, but K14 is nonetheless lost in the outer layers of early hyperplastic epidermis (compare Myc “off” with Myc “on” at 7 days). Prolonged activation of Myc results in the retention of K14 protein throughout the late hyperplastic epidermis.

Id2 is dispensable for Myc-induced angiogenesis.

Although double knockout Id1/Id3 mice die in utero, Id1-heterozygous/Id3-null and Id1-null/Id3-heterozygous mice are viable and, moreover, exhibit profound resistance to tumor xenografts because of a defect in tumor angiogenesis (26). Id1, Id2, and Id3 are all expressed in the endothelial cells lining the vasculature, with the exception that Id2 is absent from central nervous system vasculature (2, 4). Although Id2-deficient mice are viable, with no apparent deficit in vasculature, there remained the possibility that Id2 status might affect the profound angiogenesis that suprabasal activation of c-Myc elicits in adjacent dermis, most notably in areas of papilloma formation (34). We used the marker of vascular endothelium, CD31, to explore any role for Id2 in Myc-induced skin angiogenesis (Fig. 5). In both Inv-MycERTAM/Id2-null and Inv-MycERTAM/Id2-wt mice, activation of Myc for 2 to 3 weeks induced similar robust dermal angiogenesis in the region of skin treated with 4-OHT. Thus, Id2 appears not to be required for Myc-dependent angiogenesis.

FIG. 5.

FIG. 5.

Id2 is dispensable for Myc induction of dermal angiogenesis. The endothelial cell marker CD31 (FITC labeled) was used to identify total vasculature in the dermis of Inv-MycERTAM/Id2-wt and Inv-MycERTAM/Id2-null skin treated with 4-OHT for 14 or 22 days. Control tissue consisted of transgene-negative Id2-wt and Id2-null skin treated with 4-OHT for 22 days. Prolonged Myc activation in suprabasal epidermis results in an increase in the complexity and epidermal proximity of the underlying dermal vasculature irrespective of Id2 status.

Id1 and Id3 are abundantly expressed in hyperplastic Inv-MycERTAM epidermis.

Although there is no evidence that any other member of the Id family is regulated by Myc, it is possible that the lack of a discernible influence of the absence of Id2 upon the Myc-induced papillomatous phenotype in Id2-null animals is due to functional redundancy with other expressed Id proteins. We therefore investigated whether other Id proteins are expressed in the hyperplastic epidermis of 4-OHT-treated Inv-MycERTAM skin.

Myc was activated for 14 days in Inv-MycERTAM mice, either Id2-wt or Id2-null, and sections were then assayed for expression of Id1 and Id3 by immunofluorescence. Abundant cytoplasmic Id1 staining was observed in all nucleated layers from hyperplastic epidermis of both Id2-wt and Id2-null mice. Id3 was also expressed in all nucleated keratinocytes in both Id2-wt and Id2-null mice, although in contrast to what was seen with Id1, Id3 staining was predominantly nuclear (Fig. 6). These results concur perfectly with those reported previously for expression of Id proteins in samples of human squamous cell carcinoma of the skin (19). The presence or absence of Id2 had no significant effect on expression of either Id1 or Id3. Thus, both Id1 and Id3 are expressed in Myc-induced hyperplastic epidermis. However, neither Id1 nor Id3 expression correlates with Myc-induced keratinocyte proliferation nor indeed with the differentiation status of Inv-MycERTAM suprabasal keratinocytes. It is therefore unlikely that either Id1 or Id3 mediates Myc's tumorigenic function in this tissue.

FIG. 6.

FIG. 6.

Id1 and Id3 are abundantly expressed in Inv-MycERTAM-induced epidermal hyperplasia. Inv-MycERTAM/Id2-wt and Inv-MycERTAM/Id2-null skin treated with 4-OHT for 14 days was stained for the presence of Id1 protein (top set of panels) or Id3 protein (bottom set of panels) by immunofluorescence. Alexa 488-conjugated secondary antibody (green), visible on the fluorescein isothiocyanate (FITC) channel, was used for detection, and sections were counterstained with propidium iodide (PI) (blue). Deletion of Id2 does not appreciably influence expression of Id1 or Id3 in the hyperplastic epidermis. Ab, antibody.

DISCUSSION

We used a switchable MycERTAM transgenic approach to investigate the potential role for Id2 in Myc-dependent tumorigenesis in skin in vivo. Sustained activation of MycERTAM in the suprabasal keratinocytes of murine epidermis results in a complex neoplastic phenotype, characterized by progressive hyperplasia accompanied by anaplasia, dysplasia, and angiogenesis and culminating in papillomatosis. Despite the published evidence indicating that Id2 is a pivotal proliferative effector of Myc (21, 23) and the abundance of Id2 transcripts in the MycERTAM-induced skin hyperplasia, we found that deletion of the Id2 gene has no detectable influence on the extent or the kinetics of the complex neoplastic phenotype elicited by Myc in skin.

Substantial data exist to implicate Myc family proteins in the regulation of Id2 transcription. The Id2 promoter contains multiple E-box sequences which, by transient reporter analysis, are required both for induction by c-Myc and N-Myc and also for transforming growth factor β-dependent repression of Id2, demonstrably mediated in part by the Myc antagonist Mad-4. Direct binding of c-Myc/Max and Mad-4/Max complexes to the Id2 promoter in vivo has also been demonstrated in both fibroblasts and immortalized keratinocytes by chromatin immunoprecipitation (23, 42). Moreover, while the initial report suggesting a close correlation between N-Myc amplification and Id2 expression in neuroblastoma (21) has recently been called into question (40, 44, 45), some correlation between c-Myc and Id2 expressions appears to exist although Id2 still lacked prognostic value for neuroblastoma in this and other studies (40, 45). However, regulation of the Id2 promoter is quite complex. Id2 promoter activity is induced by a number of mitogenic signals and fluctuates in response to various tissue culture conditions, such as plating and refeeding of cells (30, 48). In addition to the potential Myc-binding E boxes, the Id2 promoter also contains at least one SP-1 site and is, furthermore, bound by Ets domain and ATF family transcription factors (9, 18) and activated by both BMP4 and STAT3 (12, 36). Given that the bulk of the present evidence suggests only a modest (i.e., approximately twofold) influence of Myc on Id2 expression, it seems unlikely that Myc is the decisive arbiter of Id2 transcription. Consistent with this, our own in situ analysis suggests that while Myc may indeed contribute to Id2 transcription in hyperplastic keratinocytes, the principal determinant of Id2 expression is the overall proliferative status of keratinocytes in which it is expressed.

Generally speaking, Id proteins are highly expressed in rapidly dividing and less differentiated cell populations. We found that Id1, Id2, and Id3 are all expressed in the hyperplastic epidermis of 4-OHT-treated Inv-MycERTAM skin, in close agreement with the results of a previous report demonstrating Id protein expression in human squamous cell carcinoma of the skin (19). It is possible that the extensive expression of Id1 and Id3 functionally compensates for loss of Id2 in the Myc-induced phenotype. All four Id proteins can bind the ubiquitously expressed E-box proteins E2A, HEB, and E2-2, disrupting their interaction with tissue-specific bHLH transcription factors (30). Expression of E2A has been demonstrated in keratinocytes, although tissue-specific interacting proteins that regulate epidermal lineage commitment have yet to be defined (19). Furthermore, Id proteins can bind tissue-specific bHLH proteins (e.g., MyoD, Neuro D, and Mash 1) directly, although they do so with differing affinities (21). Id1, Id2, and Id3 are each also capable of binding paired domain transcription factors, Pax-2, Pax-5, and Pax-8, as well as Ets domain proteins Elk-1 and Sap-1, although, again, they each exhibit varying affinities for these factors (38, 47). Thus, there is ample potential for degeneracy of function between Id family proteins that might compensate for loss of any one during development. Nonetheless, whereas Id2 mRNA expression correlates well with the delay in differentiation of MycERTAM keratinocytes, no such correlation is evident for Id1 or Id3. This absence of any such correlation between Id1 or Id3 expression and either keratinocyte proliferation or the Myc-induced disruption of keratinocyte differentiation strongly argues against any role for Id1 or Id3 in mediating Myc's tumorigenic properties in this tissue, either in the presence or absence of Id2.

By crossing our Inv-MycERTAM mice into an Id2-null background, we were able to interrogate directly the potential role of Id2 as a mediator of Myc's oncogenic properties in vivo. Careful analysis of MycERTAM-induced epidermal neoplasia throughout its progression revealed no obvious phenotypic deficit ascribable to the absence of Id2 expression. The rate and extent of keratinocyte proliferation, delay in keratinocyte differentiation, dermal angiogenesis, and eventual papillomatosis elicited by Myc were all identical in the presence or absence of Id2. While it remains possible that Id2 may still mediate critical Myc functions in specific tissues or tumor types, our studies indicate that Id2 is not a universal requirement for any of the diverse aspects of Myc's biological function.

Acknowledgments

This work was supported by grants from Mt. Zion Health Systems, Inc., San Francisco, Calif., and National Institutes of Health grant 5P30 CA23108-24. D.J.M. is supported by National Research Service award 1 F32 CA99363-01 from the National Cancer Institute.

We thank Tobias Dansen, David Elson, Ignacio Flores, and Jin-Sea Rhee for technical assistance and Luika Timmerman for critical evaluation of the manuscript.

REFERENCES

  • 1.Barone, M. V., R. Pepperkok, F. A. Peverali, and L. Philipson. 1994. Id proteins control growth induction in mammalian cells. Proc. Natl. Acad. Sci. USA 91:4985-4988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Benezra, R. 2001. Role of Id proteins in embryonic and tumor angiogenesis. Trends Cardiovasc. Med. 11:237-241. [DOI] [PubMed] [Google Scholar]
  • 3.Benezra, R., R. L. Davis, D. Lockshon, D. L. Turner, and H. Weintraub. 1990. The protein Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell 61:49-59. [DOI] [PubMed] [Google Scholar]
  • 4.Benezra, R., S. Rafii, and D. Lyden. 2001. The Id proteins and angiogenesis. Oncogene 20:8334-8341. [DOI] [PubMed] [Google Scholar]
  • 5.Brysk, M. M., I. Arany, H. Brysk, S. H. Chen, K. H. Calhoun, and S. K. Tyring. 1995. Gene expression of markers associated with proliferation and differentiation in human keratinocytes cultured from epidermis and from buccal mucosa. Arch. Oral Biol. 40:855-862. [DOI] [PubMed] [Google Scholar]
  • 6.Coller, H. A., C. Grandori, P. Tamayo, T. Colbert, E. S. Lander, R. N. Eisenman, and T. R. Golub. 2000. Expression analysis with oligonucleotide microarrays reveals that MYC regulates genes involved in growth, cell cycle, signaling, and adhesion. Proc. Natl. Acad. Sci. USA 97:3260-3265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.de Bruin, A., L. Wu, H. I. Saavedra, P. Wilson, Y. Yang, T. J. Rosol, M. Weinstein, M. L. Robinson, and G. Leone. 2003. Rb function in extraembryonic lineages suppresses apoptosis in the CNS of Rb-deficient mice. Proc. Natl. Acad. Sci. USA 100:6546-6551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Fuchs, E., and S. Raghavan. 2002. Getting under the skin of epidermal morphogenesis. Nat. Rev. Genet. 3:199-209. [DOI] [PubMed] [Google Scholar]
  • 9.Fukuma, M., H. Okita, J. Hata, and A. Umezawa. 2003. Upregulation of Id2, an oncogenic helix-loop-helix protein, is mediated by the chimeric EWS/Ets protein in Ewing sarcoma. Oncogene 22:1-9. [DOI] [PubMed] [Google Scholar]
  • 10.Guo, Q. M., R. L. Malek, S. Kim, C. Chiao, M. He, M. Ruffy, K. Sanka, N. H. Lee, C. V. Dang, and E. T. Liu. 2000. Identification of c-Myc responsive genes using rat cDNA microarray. Cancer Res. 60:5922-5928. [PubMed] [Google Scholar]
  • 11.Hara, E., T. Yamaguchi, H. Nojima, T. Ide, J. Campisi, H. Okayama, and K. Oda. 1994. Id-related genes encoding helix-loop-helix proteins are required for G1 progression and are repressed in senescent human fibroblasts. J. Biol. Chem. 269:2139-2145. [PubMed] [Google Scholar]
  • 12.Hollnagel, A., V. Oehlmann, J. Heymer, U. Rüther, and A. Nordheim. 1999. Id genes are direct targets of bone morphogenetic protein induction in embryonic stem cells. J. Biol. Chem. 274:19838-19845. [DOI] [PubMed] [Google Scholar]
  • 13.Iavarone, A., P. Garg, A. Lasorella, J. Hsu, and M. A. Israel. 1994. The helix-loop-helix protein Id-2 enhances cell proliferation and binds to the retinoblastoma protein. Genes Dev. 8:1270-1284. [DOI] [PubMed] [Google Scholar]
  • 14.Israel, M. A., M. C. Hernandez, M. Florio, P. J. Andres-Barquin, A. Mantani, J. H. Carter, and C. M. Julin. 1999. Id gene expression as a key mediator of tumor cell biology. Cancer Res. 59:1726S-1730S. [PubMed] [Google Scholar]
  • 15.Jen, Y., K. Manova, and R. Benezra. 1997. Each member of the Id gene family exhibits a unique expression pattern in mouse gastrulation and neurogenesis. Dev. Dyn. 208:92-106. [DOI] [PubMed] [Google Scholar]
  • 16.Jen, Y., K. Manova, and R. Benezra. 1996. Expression patterns of Id1, Id2, and Id3 are highly related but distinct from that of Id4 during mouse embryogenesis. Dev. Dyn. 207:235-252. [DOI] [PubMed] [Google Scholar]
  • 17.Kadesch, T. 1993. Consequences of heteromeric interactions among helix-loop-helix proteins. Cell Growth Differ. 4:49-55. [PubMed] [Google Scholar]
  • 18.Kurabayashi, M., R. Jeyaseelan, and L. Kedes. 1994. Doxorubicin represses the function of the myogenic helix-loop-helix transcription factor MyoD. Involvement of Id gene induction. J. Biol. Chem. 269:6031-6039. [PubMed] [Google Scholar]
  • 19.Langlands, K., G. A. Down, and T. Kealey. 2000. Id proteins are dynamically expressed in normal epidermis and dysregulated in squamous cell carcinoma. Cancer Res. 60:5929-5933. [PubMed] [Google Scholar]
  • 20.Langlands, K., X. Yin, G. Anand, and E. V. Prochownik. 1997. Differential interactions of Id proteins with basic-helix-loop-helix transcription factors. J. Biol. Chem. 272:19785-19793. [DOI] [PubMed] [Google Scholar]
  • 21.Lasorella, A., R. Boldrini, C. Dominici, A. Donfrancesco, Y. Yokota, A. Inserra, and A. Iavarone. 2002. Id2 is critical for cellular proliferation and is the oncogenic effector of N-myc in human neuroblastoma. Cancer Res. 62:301-306. [PubMed] [Google Scholar]
  • 22.Lasorella, A., A. Iavarone, and M. A. Israel. 1996. Id2 specifically alters regulation of the cell cycle by tumor suppressor proteins. Mol. Cell. Biol. 16:2570-2578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lasorella, A., M. Noseda, M. Beyna, Y. Yokota, and A. Iavarone. 2000. Id2 is a retinoblastoma protein target and mediates signalling by Myc oncoproteins. Nature 407:592-598. [DOI] [PubMed] [Google Scholar]
  • 24.Levens, D. 2002. Disentangling the MYC web. Proc. Natl. Acad. Sci. USA 99:5757-5759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Littlewood, T. D., D. C. Hancock, P. S. Danielian, M. G. Parker, and G. I. Even. 1995. A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res. 23:1686-1690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lyden, D., A. Z. Young, D. Zagzag, W. Yan, W. Gerald, R. O'Reilly, B. L. Bader, R. O. Hynes, Y. Zhuang, K. Manova, and R. Benezra. 1999. Id1 and Id3 are required for neurogenesis, angiogenesis and vascularization of tumour xenografts. Nature 401:670-677. [DOI] [PubMed] [Google Scholar]
  • 27.Menssen, A., and H. Hermeking. 2002. Characterization of the c-MYC-regulated transcriptome by SAGE: identification and analysis of c-MYC target genes. Proc. Natl. Acad. Sci. USA 99:6274-6279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Nesbit, C. E., J. M. Tersak, and E. V. Prochownik. 1999. MYC oncogenes and human neoplastic disease. Oncogene 18:3004-3016. [DOI] [PubMed] [Google Scholar]
  • 29.Norton, J. D. 2000. ID helix-loop-helix proteins in cell growth, differentiation and tumorigenesis. J. Cell Sci. 113(Pt. 22):3897-3905. [DOI] [PubMed] [Google Scholar]
  • 30.Norton, J. D., R. W. Deed, G. Craggs, and F. Sablitzky. 1998. Id helix-loop-helix proteins in cell growth and differentiation. Trends Cell Biol. 8:58-65. [PubMed] [Google Scholar]
  • 31.O'Hagan, R. C., N. Schreiber-Agus, K. Chen, G. David, J. A. Engelman, R. Schwab, L. Alland, C. Thomson, D. R. Ronning, J. C. Sacchettini, P. Meltzer, and R. A. DePinho. 2000. Gene-target recognition among members of the Myc superfamily and implications for oncogenesis. Nat. Genet. 24:113-119. [DOI] [PubMed] [Google Scholar]
  • 32.Ohtani, N., Z. Zebedee, T. J. Huot, J. A. Stinson, M. Sugimoto, Y. Ohashi, A. D. Sharrocks, G. Peters, and E. Hara. 2001. Opposing effects of Ets and Id proteins on p16INK4a expression during cellular senescence. Nature 409:1067-1070. [DOI] [PubMed] [Google Scholar]
  • 33.Pagliuca, A., P. Gallo, P. De Luca, and L. Lania. 2000. Class A helix-loop-helix proteins are positive regulators of several cyclin-dependent kinase inhibitors' promoter activity and negatively affect cell growth. Cancer Res. 60:1376-1382. [PubMed] [Google Scholar]
  • 34.Pelengaris, S., T. Littlewood, M. Khan, G. Elia, and G. Evan. 1999. Reversible activation of c-Myc in skin: induction of a complex neoplastic phenotype by a single oncogenic lesion. Mol. Cell 3:565-577. [DOI] [PubMed] [Google Scholar]
  • 35.Prabhu, S., A. Ignatova, S. T. Park, and X. H. Sun. 1997. Regulation of the expression of cyclin-dependent kinase inhibitor p21 by E2A and Id proteins. Mol. Cell. Biol. 17:5888-5896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Prisco, M., F. Peruzzi, B. Belletti, and R. Baserga. 2001. Regulation of Id gene expression by type I insulin-like growth factor: roles of Stat3 and the tyrosine 950 residue of the receptor. Mol. Cell. Biol. 21:5447-5458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Riechmann, V., I. Vancruchten, and F. Sablitzky. 1994. The expression pattern of Id4, a novel dominant negative helix-loop-helix protein, is distinct from Id1, Id2 and Id3. Nucleic Acids Res. 22:749-755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Roberts, E. C., R. W. Deed, T. Inoue, J. D. Norton, and A. D. Sharrocks. 2001. Id helix-loop-helix proteins antagonize Pax transcription factor activity by inhibiting DNA binding. Mol. Cell. Biol. 21:524-533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ruzinova, M. B., and R. Benezra. 2003. Id proteins in development, cell cycle and cancer. Trends Cell Biol. 13:410-418. [DOI] [PubMed] [Google Scholar]
  • 40.Sato, Y., Y. Kobayashi, H. Sasaki, T. Toyama, S. Kondo, M. Kiriyama, and Y. Fujii. 2003. Expression of Id2 mRNA in neuroblastoma and normal ganglion. Eur. J. Surg. Oncol. 29:284-287. [DOI] [PubMed] [Google Scholar]
  • 41.Schuldiner, O., and N. Benvenisty. 2001. A DNA microarray screen for genes involved in c-MYC and N-MYC oncogenesis in human tumors. Oncogene 20:4984-4994. [DOI] [PubMed] [Google Scholar]
  • 42.Siegel, P. M., W. Shu, and J. Massague. 2003. Mad upregulation and Id2 repression accompany TGF-β-mediated epithelial cell growth suppression. J. Biol. Chem. 278:35444-35450. [DOI] [PubMed] [Google Scholar]
  • 43.Sikder, H. A., M. K. Devlin, S. Dunlap, B. Ryu, and R. M. Alani. 2003. Id proteins in cell growth and tumorigenesis. Cancer Cell 3:525-530. [DOI] [PubMed] [Google Scholar]
  • 44.Vandesompele, J., A. Edsjo, K. De Preter, H. Axelson, F. Speleman, and S. Pahlman. 2003. ID2 expression in neuroblastoma does not correlate to MYCN levels and lacks prognostic value. Oncogene 22:456-460. [DOI] [PubMed] [Google Scholar]
  • 45.Wang, Q., G. Hii, S. Shusterman, Y. Mosse, C. L. Winter, C. Guo, H. Zhao, E. Rappaport, M. D. Hogarty, and J. M. Maris. 2003. ID2 expression is not associated with MYCN amplification or expression in human neuroblastomas. Cancer Res. 63:1631-1635. [PubMed] [Google Scholar]
  • 46.Wu, L., A. de Bruin, H. I. Saavedra, M. Starovic, A. Trimboli, Y. Yang, J. Opavska, P. Wilson, J. C. Thompson, M. C. Ostrowski, T. J. Rosol, L. A. Woollett, M. Weinstein, J. C. Cross, M. L. Robinson, and G. Leone. 2003. Extra-embryonic function of Rb is essential for embryonic development and viability. Nature 421:942-947. [DOI] [PubMed] [Google Scholar]
  • 47.Yates, P. R., G. T. Atherton, R. W. Deed, J. D. Norton, and A. D. Sharrocks. 1999. Id helix-loop-helix proteins inhibit nucleoprotein complex formation by the TCF ETS-domain transcription factors. EMBO J. 18:968-976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Zebedee, Z., and E. Hara. 2001. Id proteins in cell cycle control and cellular senescence. Oncogene 20:8317-8325. [DOI] [PubMed] [Google Scholar]

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES