Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2012 Dec;194(24):6802–6817. doi: 10.1128/JB.01353-12

Genome of Enterobacteriophage Lula/phi80 and Insights into Its Ability To Spread in the Laboratory Environment

Ella Rotman a,*, Elena Kouzminova a, Guy Plunkett III b, Andrei Kuzminov a,✉
PMCID: PMC3510586  PMID: 23042999

Abstract

The novel temperate bacteriophage Lula, contaminating laboratory Escherichia coli strains, turned out to be the well-known lambdoid phage phi80. Our previous studies revealed that two characteristics of Lula/phi80 facilitate its spread in the laboratory environment: cryptic lysogen productivity and stealthy infectivity. To understand the genetics/genomics behind these traits, we sequenced and annotated the Lula/phi80 genome, encountering an E. coli-toxic gene revealed as a gap in the sequencing contig and analyzing a few genes in more detail. Lula/phi80's genome layout copies that of lambda, yet homology with other lambdoid phages is mostly limited to the capsid genes. Lula/phi80's DNA is resistant to cutting with several restriction enzymes, suggesting DNA modification, but deletion of the phage's damL gene, coding for DNA adenine methylase, did not make DNA cuttable. The damL mutation of Lula/phi80 also did not change the phage titer in lysogen cultures, whereas the host dam mutation did increase it almost 100-fold. Since the high phage titer in cultures of Lula/phi80 lysogens is apparently in response to endogenous DNA damage, we deleted the only Lula/phi80 SOS-controlled gene, dinL. We found that dinL mutant lysogens release fewer phage in response to endogenous DNA damage but are unchanged in their response to external DNA damage. The toxic gene of Lula/phi80, gamL, encodes an inhibitor of the host ATP-dependent exonucleases, RecBCD and SbcCD. Its own antidote, agt, apparently encoding a modifier protein, was found nearby. Interestingly, Lula/phi80 lysogens are recD and sbcCD phenocopies, so GamL and Agt are part of lysogenic conversion.

INTRODUCTION

The laboratory setting is, by design, an inhospitable environment, as very few species are capable of overcoming the researcher-imposed barriers for growth, multiplication, and spread. The well-known examples of organisms successfully propagating in the laboratory environment are mycoplasmas (76) and HeLa cells (39), both of which cross-contaminate mammalian cell cultures and spread through the laboratories around the world with appalling ease (48). Part of their success is their rapid growth and hardiness, giving them the ability to outgrow and outlive any laboratory strain competitors. Until recently, however, no such creature was known for cultures of rapidly growing microbes, which, precisely because of their speed of growth, effectively deny such chances to a contaminating competitor. This has changed with a description of a temperate phage, Lula, that infects Escherichia coli, converts it into a lysogen, and efficiently spreads in the laboratory setting, stealthily contaminating laboratory strains without researchers' knowledge (75). Lula contamination is apparently widespread yet not broadly recognized, and, because of this combination, it can be a scourge in shared facilities that handle both contaminated cultures (lysogens) and noncontaminated cultures (nonlysogens), resulting in a frustratingly high frequency of lysis and growth inhibition of the latter “for no apparent reason.” Besides being superinfectious, Lula also changes the phenotype of cells in which it established itself as a lysogen, making them extra sensitive to any DNA damage (75), so its lysogenic conversion is not limited to a typical cross-resistance of lysogens to infection by lytic phages.

Besides being the first characterized microbial culture-contaminating agent, Lula exemplifies a distinct, viral strategy of spreading in the laboratory environment; thus, study of Lula provides original insights into the ways viruses breach human-imposed barriers to cross-contamination. This is a topic of critical importance for mammalian cell cultures, where viral cross-contamination among cell lines is pervasive, sometimes with fatal consequences for researchers (37). In a previous paper we analyzed Lula's characteristics that allow it to spread in the laboratory setting and concluded that these are (i) stealthy infectivity at 37°C (lysogenization instead of lytic development), allowing Lula infection to avoid detection, and (ii) cryptic lysogen productivity, yielding normally growing cultures of Lula lysogens carrying extremely high loads of infectious phage (75). The latter property is critically enhanced by Lula's stability in stationary-phase cultures (75). These characteristics could be the consequence of Lula's distinct genome organization relative to that of other temperate phages or could be due to specific genes unique to Lula. In our efforts to understand the genetic and genomic bases for the above-described traits that make Lula so efficient in overcoming the researcher-imposed barriers to its spread in the laboratory environment, in this paper we describe sequencing and annotation of the Lula genome, as well as characterization of several Lula mutants.

MATERIALS AND METHODS

Strains, plasmids and growth conditions.

The E. coli strains and plasmids used in the experiments are described in Tables S1 and S2 in the supplemental material, respectively. Alleles were moved among strains by P1 transduction (63). All strains were propagated in liquid LB with shaking at 200 rpm or on LB plates (containing, per 1 liter, 10 g of peptone and 5 g of yeast extract, 5 g of NaCl [pH 7.4] with 250 μl of 4 M NaOH and 15 g of agar) (63). Antibiotics were used in the following final concentrations: 50 μg/ml for kanamycin (Kan), 100 μg/ml for ampicillin, 10 μg/ml for tetracycline, and 12.5 μg/ml for chloramphenicol.

Sequencing of the phage genome.

A 405-μl portion of high-titer phage stock was treated with 45 μl DNase I buffer and 1 μl DNase I (NEB) at 37°C for 15 min to eliminate E. coli chromosomal DNA. Fifty microliters of 10% SDS was added, and the phage was lysed at 70°C for 10 min, followed by 5 min on ice. Phage DNA was extracted by shaking with 500 μl phenol, with 500 μl phenol-chloroform, and finally with 500 μl chloroform; the aqueous phase was transferred to a fresh tube at each step. The DNA was precipitated twice with 20 μl of 5 M NaCl and 1 ml of 100% ethanol and dissolved first in 500 μl Tris-EDTA (TE) buffer and then in a final volume of 100 μl TE buffer. The DNA concentration was approximately 40 ng/μl, as measured with a fluorometer. As a quality control, Southern blots using the isolated phage DNA as a probe revealed no hybridization to nonlysogen E. coli DNA. Two micrograms of this phage DNA was submitted for shotgun sequencing (done at the W.M. Keck Center for Comparative and Functional Genomics, University of Illinois at Urbana-Champaign). A total of 587 sequence runs of 800 to 1,000 nucleotides (nt) in length were compiled using the program Sequencher 4.9.

Digestion with restriction enzymes.

Standard restriction digestion for phage and other DNA (∼1 μg) was done in 100-μl reaction volumes, using 1 μl NEB enzyme (typically 10 to 20 U) and in the recommended NEB buffer. Digestions were for 1 h at 37°C; prior to gel loading, DNA was concentrated by ethanol precipitation.

Southern blotting.

Approximately 1 μg of total DNA of a strain containing Lula was digested as described above for 4.5 h at 37°C and separated in an agarose gel. The gel was treated for transfer by gentle shaking in 0.2 M HCl for 40 min, followed by 45 min in 0.5 N NaOH and 15 min in Tris-HCl, pH 8.0. After capillary transfer, DNA was cross-linked to the membrane by UV irradiation, and the membrane was incubated in hybridization buffer (5% SDS, 0.5 M sodium phosphate, pH 7.4) at 65°C for 5 h. To probe the membrane, 32P-labeled BamHI-digested Lula DNA was added to the hybridization buffer and the membrane was hybridized overnight. After three washes in 0.1× hybridization buffer, the membrane was exposed for 9 h and quantified with a PhosphorImager.

Determination of cell titer.

Saturated cultures were serially diluted 10-fold at each step in 1% NaCl. Ten-microliter spots of each dilution were placed onto LB or BBL agar (10 g BBL Trypticase, 5 g NaCl, 250 μl 4 M NaOH, and 15 g agar per liter) plates and incubated overnight at 30°C. A stereomicroscope was used to count the dilutions which contained between 30 and 200 colonies to determine the original titer.

Determination of Lula/phi80 titer.

Saturated cultures of lysogens were pelleted in a microcentrifuge. The supernatant was serially diluted in TM buffer (10 mM Tris-HCl [pH 8.0] and 10 mM MgSO4), and 10-μl aliquots were placed atop a lawn of susceptible cells on BBL agar. The lawn consisted of 150 μl saturated culture mixed with 4 ml top BBL agar (half TM and half BBL) incubated for 1 h at 30°C before spotting the phage. Plates were incubated overnight at 30°C, and individual plaques were counted to determine the original titer.

UV survival.

Logarithmic-phase cultures were serially diluted in 1% NaCl to 10−6, and 10-μl portions of the six dilutions (10−1 to 10−6) were spotted onto BBL agar square plates in six rows (one strain per 36-position plate, with six spots of the same dilution per row) and allowed to dry. The plates were irradiated with a UV gradient perpendicular to the dilution gradient and incubated overnight in the dark at 30°C. The titers in the UV-treated columns were normalized to the titer of the unirradiated column.

T4 spotting.

Suspensions of phage T4 and T4 2 mutants were diluted in TM buffer. Plates were made of Hershey agar (13 g tryptone, 2 g sodium citrate, 8 g NaCl, 1.3 g glucose, 4 mg thiamine, and 15 g agar per liter) (8). The lawn was created by subculturing cells 1:100 in LB broth (supplemented with 100 μg/ml ampicillin and 1 mM IPTG [isopropyl-β-d-thiogalactopyranoside] as needed). Cultures were grown to an optical density at 600 nm (OD600) of 0.2 to 0.25, and 110 μl of cells was mixed with 1.4 ml top agar (equal volumes of TM buffer and Hershey agar with 1 mM IPTG) and poured onto a small (60-mm) plate. The lawn was dried for 20 min at room temperature before spotting the T4 dilutions. The plates were incubated overnight at 37°C.

Construction of mutations in Lula.

Gene knockouts in Lula/phi80 were made by the Datsenko-Wanner method of deletion-replacement (24) in lysogens of AB1157. The entire gene was replaced with a chloramphenicol resistance cassette to allow for backcrossing into different backgrounds (either by P1 transduction into lysogens or by direct infection with Lula). See Table S1 in the supplemental material for more details.

Lambda-pal phage methods. (i) Phage genotypes.

Lambda-pal is MMS1632 pal571 cI857 b1453 Chi+76. b1453 is a deletion spanning the int, xis, exo, bet, and gam genes (38). The pal571 palindrome was described previously (11). DKC14 is red270 gam210 cI857 ChiC (Stahl lab collection).

(ii) Phage lambda titer determination.

Plating cultures were grown from overnight cultures diluted 100-fold in tryptone broth (TB) (10 g of tryptone and 5 g of NaCl per 1 liter with the pH adjusted to 7.2 with 4 M NaOH) supplemented with 0.1% maltose at 37°C. One milliliter of late-log-phase culture was spun down and resuspended in 0.5 ml of TM buffer. A 0.5-ml portion of the plating culture was mixed with 3 ml of top BBL agar and poured on a freshly prepared 25-ml BBL plate, and the plates were dried for 30 min before spotting phage. Phages were serially diluted in TM buffer, and 10-μl dilutions were spotted on the plates with the plating culture in top agar. Plates were incubated overnight at 35°C. High-titer phage stocks were purified according to the one-plate protocol (45) with the host JC7623.

Nucleotide sequence accession number.

The sequence of the Lula/phi80 genome has been deposited in GenBank under accession number JX871397.

RESULTS

Sequencing of the Lula/phi80 genome.

We sequenced the Lula genome by the Sanger technique via construction of a shotgun library from isolated virion (linear) DNA. Instead of the expected single contig, the reads assembled into two separate contigs, 29,331 bp and 16,250 bp in length, both with a 10-fold coverage. Two of the four ends of the two contigs carried the same 12 nucleotide sequence GGGCGGCGACCT (one on the 3′ end and the other on the 5′ end), apparently identifying the two ends of the opened cos site of the virion DNA (which also happens to be the sequence of the “sticky ends” of bacteriophage lambda). We reasoned that the two other ends defined the gap in Lula DNA spanning a gene(s) that could not be cloned in E. coli. We closed this 569-nt-long gap by sequencing a PCR product across the gap, which allowed us to link the two contigs into a single one.

The total Lula genome turned out to comprise 46,150 bp, in line with other lambdoid phages (48,502 bp for lambda and 46,375 bp for N15). While there were no similar genomes in the database at the time of Lula sequencing, several sequenced genes of the well-known but now forgotten lambdoid phage from the 1960s and 1970s called phi80 (77) were identical to the corresponding Lula sequences. In fact, although it was never published, the phi80 genome was sequenced by the members of the Blattner lab in Wisconsin (27), who used its DNA to troubleshoot a variety of sequencing technologies in the 1980s and who have made the resultant sequence available to individual researchers. Comparing the Wisconsin phi80 and Lula sequences revealed complete identity of the two genomes, down to the last nucleotide. It was remarkable that, after so many years of spreading in various laboratories (our “Illinois” phage came originally from Arizona via Oregon), there was not a single nucleotide change in the two sequences.

Sequence analysis and annotation of Lula/phi80 genome was as previously described (56, 72). The overall GC content of Lula/phi80 is 52%, which is similar to E. coli's 51%. No tRNA genes were found by tRNAscan (57).

Overall genome layout.

As already mentioned, the linear (virion) Lula/phi80 genome starts and ends with the 12-nt complementary (“sticky”) ends indicating a cut cos site, which shows during sequencing as 12-bp direct repeats bracketing the genome. The genome features an attachment site roughly in the middle of the chromosome near the integrase (int) gene, four major promoters (pL, pRm, pR, and pR′), and at least nine transcription terminators. The disposition of promoters and terminators is mostly preserved between the Lula/phi80 and lambda genomes, which means that the direction of expression and composition of the major gene clusters are also preserved. Thus, the overall layout of the Lula/phi80 genome is very much lambda-like (Fig. 1), with the linearized-at-cos genome starting at the left with the cluster of head functions, followed by, in order, a cluster of tail functions, a cluster of infection specificity functions, site-specific recombination functions, homologous recombination functions, regulation and replication initiation functions, and finally, on the right end of the chromosome, the host cell lysis functions. The only apparent exception to the lambda order of genes is the reversal of the integrase-containing region in the middle of the Lula/phi80 chromosome, perhaps because of the presence of the gene for Pin invertase nearby. At the same time, the level of identity at the nucleotide level is limited: Lula/phi80 and lambda share only ∼18.5 kbp of common DNA, with an average level of identity in this DNA at just below 70%. Sequence identity is mostly clustered in the morphogenesis (head and tail) part of the genome, with the rest of the two genomes highly divergent but harboring occasional islands of identity (Fig. 1), a result which is in line with the early physical analysis (32).

Fig 1.

Fig 1

The layout of the Lula/phi80 genome versus that of the lambda genome. The two genomes, which are 46,150 bp and 48,502 bp in length, respectively, are shown in their virion forms, linearized at the cos site, with the terminase genes on the left. Black arrows, genes transcribed from left to right; gray arrows, genes transcribed from right to left. The names of the important/interesting genes are indicated. The regions of shared sequence identity (averaging 70%) are indicated by gray parallelograms. The genome region labels are as follows: Head, head assembly and DNA packaging (terminase); Tail, tail assembly; Legs, tail fibers; Att, attachment site and integration/excision; Rec, homologous recombination and host exonuclease inhibition; Reg-Rep, regulation/decision making and replication initiation; Lysis, host cell lysis.

Preservation of the overall genome layout is especially striking in the control region (Fig. 2). This region is the location of the following important actions: (i) prophage repression, (ii) lysis/lysogeny decision-making, (iii) replication initiation, and (iv) transcription antitermination. The control region spans approximately 11 kbp both in Lula/phi80 and in lambda, but the shared homology between Lula/phi80 and lambda (again, ∼70% identity) is limited to the total of ∼1.5 kbp of DNA (Fig. 2), split between the 600-bp ppp (ninI) gene (coding for a nonessential phage protein phosphatase; this homology was noted earlier [14, 46]), the 250-bp 5′-terminal half of the Rz gene (coding for the lysis protein), and 800 bp spanning the postiteron 3′ half of the O gene and the 5′ half of the P gene (suggesting that the corresponding parts of the O and P proteins physically interact). None of the control genes or sequence elements show any similarity between the two phages, with the exception of a weak homology between the Q genes. Specifically for our goal, though, the overall genome structure of Lula/phi80 does not provide any insight into its ability to spread in the laboratory, so next we considered specific genes of Lula/phi80.

Fig 2.

Fig 2

Comparison of the control regions of Lula/phi80 and lambda. The region bracketed by kil on the left and Rz on the right is shown, with the (mostly) control genes indicated above the genome line and control sequence elements below the genome line. The gray parallelograms indicate the three regions to which the ∼70% sequence identity between the two genomes is limited.

Annotation of the Lula/phi80 genome.

A brief annotation of the major features of the Lula/phi80 genome is in Table 1. Even though Lula/phi80 has its own history of genetic research, with many genes known by their (nonconsecutive) numbers (77), we decided to part from that time-honored nomenclature, instead numbering the Lula/phi80 genes consecutively, following the standards of modern phage genomics. The numbering starts at the left end with the gene for the small terminase subunit as gene 1, but we also decided to assign Lula/phi80 genes “second” names according to lambda (or other lambdoid phage) gene nomenclature, as more biologically meaningful ones.

Table 1.

Lula/phi80 sites and ORF annotation summary

Gene no.a Position (nt)
Length
Reading frame Identity of encoded proteinb or sequence description/best homolog(s) from other phages or bacteria N15 homolog
Start End nt aa
s 1 12 GGGCGGCGACCT, sticky end
s 109 165 Inverted repeat, AGAAAGGAAA(38 N)TTTCCTTTCT
1 190 732 543 181 F1 Terminase small subunit (Nu1)/lambda gp1
2 710 2629 1920 640 F2 Terminase large subunit (A)/lambda gp2
3 2632 2835 204 68 F1 Head-tail joining protein (W)/N15, lambda gp3
4 2835 4424 1590 530 F3 Capsid portal protein (B)/N15, lambda gp4
5 4408 5748 1341 447 F1 Capsid serine protease (C)/N15, lambda gp5
6 5761 6090 330 110 F1 Head DNA stabilization protein (D)/N15, lambda gp7
7 6161 7183 1023 341 F2 Major capsid (head) protein (E)/N15, lambda gp8
8 7196 7645 450 150 F2 DNA-packaging protein (FI)/N15, lambda gp9
9 7660 8010 351 117 F1 Head-tail joining protein (FII)/N15, lambda gp10
10 8023 8604 582 194 F1 Minor tail protein (Z)/Fels-1, Gifsy-1, N15, lambda gp11
11 8604 8999 396 132 F3 Tail capping + head interface protein (U)/N15, lambda gp12
12 9173 9559 386 129 F2 Putative protein, internal to gpV
12 9010 9750 741 247 F1 Major tail protein (V)/N15, lambda gp13
13 9764 10192 429 143 F2 Tail assembly chaperonec (G)/N15, lambda gp14
14 10246 10515 270 90 F1 Minor tail protein (T)/N15, lambda gp15
s 10429 10469 Inverted repeat, GTCATCAGCG(21 N)CGCTGATGAC
15 10502 13636 3135 1045 F2 Tail length tape measure protein precursor (H)/Fels-1, lambda, Gifsy-1, Gifsy-2, N15 gp16
16 13636 13971 336 112 F1 Minor tail protein (M)/N15, lambda gp17
s 13996 14011 Rightward transcription terminator (between M and L)
17 14031 14765 735 245 F3 Minor tail protein (L)/N15, HK022, HK97, lambda gp18
s 14721 14737 Rightward transcription terminator (at the very end of L)
18 14770 15486 1401 467 F1 Tail fiber cell wall hydrolase (K)/N15, HK022, HK97 gp19
19 15482 16096 615 205 F2 Tail assembly protein (I)/T1, N15, HK022 and HK97 gp20
20 16104 16634 531 177 F3 Putative protein, 24% identity to molybdate-binding protein ModA
21 16630 20205 3576 1192 F1 Host specificity protein, tail fiber protein (J)/HK022, HK97, N15, lambda gp21
22 20210 20509 300 100 F2 Hypothetical phage protein, identical to HK022 gp24/N15, T1 gp22
23 20512 21183 672 224 F1 Hypothetical phage protein/HK022, N15, T1 gp23
24 21298 21528 231 77 F1 Phage superinfection exclusion protein Cor/HK022, N15, T1 Cor
s 21553 21568 Rightward transcription terminator (after cor)
25 21592 22800 1209 403 F1 Mosaic tail fiber protein/HK97, HK022, T1
s 22746 22761 16 Weak LexA box.
26 22877 23188 312 104 F2 Putative protein, perfect antisense for dinL (the next gene)
27 23169 22933 237 79 R2 DinL (MsgA virulence protein) (macrophage survival gene), a relative of host DinI (DNA damage-inducible protein I)/Gifsy-2
s 23210 23225 16 Strong LexA box in front of dinL/msgA
28 23526 23419 108 36 R2 Conserved hypothetical protein
29 23874 23686 189 63 R2 Tail collar domain protein (gpH)/CP-933H
s 23919 23945 27 Inverted repeat, CTTCTCCTGTTtttacAACAGGAGAAG, in front of pin
30 23951 24466 516 172 F2 DNA invertase, resolvase, site-specific recombinase Pin/e14
s 24623 24639 attP (ACACTTTCTTAAATTGT)
31 24808 26013 1206 402 F1 Experimentally established phi80 integrase (Int)/CP-933H, Gifsy-1
s 25961 25981 Leftward transcription terminator (to stop xis transcription antisensing int)
32 26210 26015 195 65 R3 Experimentally established phi80 excisionase (Xis)
33 26497 26255 243 81 R1 Conserved hypothetical protein
34 26930 26497 429 143 R2 DamL, a putative DNA adenine methylase protein, the C-terminal two-fifths/Salmonella enterica, P1, P7
35 27379 26924 456 152 R1 DamL, a putative DNA adenine methylase protein, the N-terminal three-fifths/S. enterica, P1, P7
36 27959 27528 432 144 R3 Putative protein
37 28630 27953 678 226 R1 DNA exonuclease (Exo), homologous recombination/CP-933K, lambda
38 29544 28630 915 305 R2 RecT, the phage recombinase-annealing protein/Rac
39 29835 29557 278 93 R2 GamLd (host RecBCD/SbcCD enzyme inhibitor), toxic without Agt
40 30811 29846 966 322 R1 Agtd (alleviates Gam toxicity), the antitoxin for the toxic Lula GamL/ Sf6
41 31752 30919 834 278 R2 Putative protein
42 31972 31766 207 69 R1 Kil, FtsZ inhibitor protein (blocks cell division)/Salmonella CT18 prophage, Rac
43 31904 32143 240 80 F2 Putative protein, completely overlaps and antisenses gp44
44 32169 31972 198 66 R2 Putative protein, completely overlaps and antisenses gp43
s 32262 32299 Leftward transcription terminator tL1B
s 32473 32495 Leftward transcription terminator tL1A
45 32790 32497 294 98 R2 Early transcription antiterminator protein N
s 33078 33089 CACGTAAACGTG, nutL core (reverse orientation)
s 33134 33142 TGCTTTTTA, nutL boxA (reverse orientation)
s 33207 33225 oL1
s 33207 33212 pL, −10 box
s 33230 33248 oL2
s 33230 33235 pL, −35 box
s 33273 33292 oL3
46 34454 33591 864 288 R3 “Protein 40A” of phi80 (other phage exclusion function?) (acetate kinase superfamily domain)
47 35355 34594 762 254 R2 CI transcriptional regulator
s 35321 35326 pRM, −10 box
s 35323 35341 oR3
s 35344 35349 pRM, −35 box
s 35347 35365 oR2
s 35360 35365 pR, −35 box
s 35380 35398 oR1
s 35383 35388 pR, −10 box
48 35419 35637 219 73 F1 Cro-like transcriptional regulator
49 35671 36210 540 180 F1 CII decision-making protein
RNA 36229 36288 oop RNA (M3 RNA)
50 36299 37204 906 302 F2 Replication initiation protein (O), analog of host DnaA/lambda
s 36663 36677 ori iteron 4
s 36683 36698 ori iteron 3
s 36704 36719 ori iteron 2
s 36725 36739 ori iteron 1
51 37204 37890 687 229 F1 Replication initiation protein (P), analog of host DnaC/lambda
52 37957 38673 717 239 F1 Conserved hypothetical protein /CdtI gp45
s 38786 38809 24 Inverted repeat, CGCATTTAAGgggaCTTAAATGCG
53 38897 39349 453 151 F2 Putative conserved phage protein
54 39519 40184 666 222 F3 Phage protein phosphatases (PPP) (NinI, AKA Nin221)/lambda, P1, P7
55 40180 40818 639 213 F1 DNA junction-specific endonuclease NinG (Rap, [Nin204])/lambda, P22
56 40818 41021 204 68 F3 Restriction alleviation protein, Lar family
57 41137 41943 807 269 F1 Late transcription antitermination protein (Q)/Gifsy-2, lambda
s 41989 41994 pR′, −35 box
s 42012 42017 pR′, −10 box
s 42070 42098 Rightward transcription terminator (after Q)
s 42362 42385 Rightward transcription terminator (before S)
58 42425 42646 222 74 F2 Phage lysis protein (S), holin/DLP12, Qin
59 42627 43118 492 164 F3 Phage lysozyme (R) (Lysis protein)/DLP12, PS119, PS34
60 43118 43573 456 152 F2 Phage Rz lysis protein, endopeptidase (Rz)/Sf6, DLP12, lambda
61 43338 43520 183 61 F3 Phage lipoprotein (Rz1) precursor/HK97, Sf6, lambda
s 43609 43631 Rightward transcription terminator (after Rz)
62 43739 44290 552 184 F2 Phage regulatory protein Rha, DNA synthesis inhibition in integration host factor-negative hosts
63 44979 44368 612 204 R2 Hypothetical protein
64 44960 45187 228 76 F2 Fur-regulated protein 1
65 45528 45232 297 99 R2 Putative protein
66 45352 46077 726 242 F1 Conserved hypothetical protein/phiKO2 gp59
s 46139 46150 GGGCGGCGACCT, sticky end
a

s, DNA site.

b

Lambda nomenclature, where applicable.

c

Roger Hendrix, personal communication (October 2009).

d

Experiments, this lab.

We identified a total of 79 open reading frames (ORFs) (not shown) and proposed 66 actual genes (Table 1), with 51 of them producing proteins with either known or apparent functions and another 15 of them coding for putative proteins, some of them conserved with other phages, or whose synthesis was experimentally demonstrated before. Of the phage proteins with known functions, 18 are involved in capsid formation and DNA packaging (head, tail, and terminase), five are involved in the infection process and its specificity (tail fibers, superinfection immunity, and cell wall hydrolase), 12 are involved in various aspects of the phage DNA metabolism (replication, site-specific recombination, repair, and modification), five are involved in transcription regulation (repression, antitermination, and decision-making), and four are involved with cell lysis. The remaining “miscellaneous” proteins of Lula/phi80 are represented by such typical phage functions as Kil (cell division inhibitor) (17, 81) and Lar (restriction alleviation) (44), common phage functions such as phage protein phosphatase (PPP) (13, 14), and some unknown functions such as “protein 40A” (judging by its position in the same operon with the cI repressor, its function may be exclusion of other lytic phages), a molybdate-binding protein, and regulatory protein Rha.

The capsid proteins of Lula/phi80 are those with most recognizable homology to other lambdoid phages, especially lambda and N15, with sequence identity ranging from 30% to 90% depending on the protein and homology to N15 generally higher than that to lambda. However, as mentioned above, such a high level of homology to lambda and N15 is generally limited to the capsid region and is already absent in the tail fiber region, which codes for mosaic proteins with relatedness to several phages, mostly HK022, HK97, lambda, N15, and T1. It should be mentioned that the two major tail fiber genes, 21 (lambda J) and 25, bracket three genes, 22, 23, and 24 (cor), that Lula/phi80 strongly shares with only four other phages: HK022, N15, ES18, and T1. All four phages use the host siderophore receptor FhuA (also known as TonA) for attachment, which the phage-produced and cell-exported Cor lipoprotein then plugs to prevent superinfection (91). Since the surrounding tail fiber proteins are shared among many other phages with various receptor specificities, it was argued that homologs of gp22 and gp23 determine the phage specificity to FhuA (91).

The DNA metabolism proteins of Lula/phi80 are weakly related to those of various phages, including CP-933H, Gifsy-1, Gifsy-2, P1, P7, P22, lambda, and e14. They include an integrase with excisionase, DNA exonuclease and annealing protein (the RecT type) for homologous recombination, and lambda-related replication-initiation proteins O and P. Finally, among the cell lysis proteins of Lula/phi80, the highest homology is to DLP12 and Sf6. Thus, the Lula/phi80 genome is a classic case of phage mosaic genomes, with various genes having recognizable relatedness to corresponding genes of other phages but, with the exception of the morphogenesis region, no extended homology to any particular phage. Thus, the overall gene content of Lula/phi80 provides no insights into its ability to spread in the laboratory.

We reasoned that if we were to find the genetic basis of Lula/phi80's stealthy infectivity and covert productivity, we should concentrate on atypical genes (those found only in some phages), whose products could be involved in the regulatory aspects of DNA metabolism. A few Lula/phi80 genes fall under this category: gene 27 (a homolog of the host DNA damage-inducible gene dinI), gene 30 (encoding an invertase, Pin), gene 34/35 (a homolog of the host dam DNA adenine methylase gene), and perhaps the toxic gene 39, which apparently caused the sequencing gap between nucleotides 29332 and 29900. In search for insights into Lula/phi80 infectivity, we targeted some of these genes for further analysis.

Deletion of genes 34/35 (damL).

We reported before (75) that the virion DNA of Lula/phi80 is cut by BamHI, but our attempts to cut it with several other common restriction enzymes, such as EcoRI and HindIII, were unsuccessful (Fig. 3A and C; see Fig. S1 in the supplemental material). The suspected DNA modification was absent from the prophage Lula/phi80 DNA, inserted into the host chromosome, as this DNA became cuttable by both EcoRI and HindIII (Fig. 3A). Curiously, the enzymes that we originally found to cut Lula/phi80 virion DNA, BamHI (G′GATTC), HaeIII (GG′CC), and AvaII (G′GWCC), all have the GG dinucleotides in their recognition sequence. At the same time, some other enzymes with GG dinucleotides in their sequences, such as RsrII (CG′GWCCG) or StuI (AGG′CCT), still failed to cut under conditions that would cut similarly isolated lambda DNA to completion.

Fig 3.

Fig 3

Lula/phi80 virion DNA modification and the ΔdamL mutant. Ethidium bromide (EtBr)-stained gels are framed and inverted for clarity. (A) Virion Lula/phi80 DNA is not cuttable by many restriction enzymes that cut genomic DNA from lysogens. Left and central panels, inverted pictures of EtBr-stained gels; right panel, Southern blot of the genomic DNA digest, hybridized with whole-genome Lula probe. (B) Scheme of the damL (34/35) gene and its position in the Lula/phi80 genome. The genome of Lula/phi80 is shown in lambda genome notation, opened at the cos site, with the att site indicated in the middle. Gene 34 starts with two Phe residues, while gene 35 ends with two Phe residues, with a +1 nucleotide frameshift between the two genes. (C) The virion DNA from the ΔdamL phage is equally uncuttable by EcoRI and HindIII. (D) The Δdam host has a 100-fold-higher titer of Lula/phi80 in overnight cultures of lysogens. Strains: Host WT Lula WT, EL103; Host WT Lula damL, EL124; Host dam Lula WT, EL125; Host dam Lula damL, EL123.

DNA of large lytic phages, such as T4, is resistant to restriction by the host enzymes due to extensive modification (hydroxymethylation and glucosylation of cytosines) (9). The virion Lula/phi80 DNA could be similarly resistant to restriction if the phage modifies its own DNA during the lytic cycle, for example, by producing a relaxed-specificity methylase. Interestingly, like several other enteric phages (T1 [79], P1 [18], and T2/T4 [9]), Lula/phi80 carries a DNA adenine methylase gene. It is a split gene in this phage, with the N-terminal 3/5 of it in gene 35 and the remaining C-terminal 2/5 of it in gene 34 (Fig. 3B), separated by an apparent ribosome slippage site in the run of 8 A's. The corresponding fused (in silico) product of the two genes is 46% identical to the host Dam methylase that methylates “A” in GATC sites, so we called the fused gene 34/35 damL (dam of Lula/phi80). The specificity of the DamL methylase is not known, but a precise deletion of gene 34 and 35 ORFs did not make Lula/phi80 virion DNA cuttable by the enzymes that failed to cut virion DNA of wild-type (WT) phage (Fig. 3C), demonstrating that DamL is not responsible for the resistance of the virion Lula/phi80 DNA to restriction enzymes. Suspecting a general inhibitor in phage DNA preparations, we used 10 times more restriction enzyme, which helped with some enzymes, such as MluI and SphI, but did not help with EcoRI or HindIII (see Fig. S1 in the supplemental material), so some Lula/phi80 virion DNA modification is still not ruled out.

We noticed that the Δ34/35 (ΔdamL) Lula/phi80 lysogen formed smaller colonies, indicating a growth defect. In the case of the other phages mentioned above, the phage-encoded Dam methylase targets the same GATC site methylated by the host Dam enzyme, supplementing the host enzyme activity and making this methylation possible on phage DNA that may carry other modifications (9). Our results above were also consistent with DamL of Lula/phi80 being a narrow-specificity enzyme, methylating the same GATC sites that its host homolog does. To test whether Lula/phi80 uses its own DamL methylase to supplement host GATC methylation during lysogeny, we measured the titers of the wild-type and ΔdamL Lula/phi80 in cultures of lysogens of wild-type and Δdam mutant E. coli. We found that the Lula/phi80 ΔdamL defect increases the lysogen culture titers only modestly, in contrast to the host dam mutation, which increases the titer by almost two orders of magnitude (Fig. 3D). There is no further increase in phage titer if the dam host is a lysogen of the ΔdamL Lula/phi80 mutant (Fig. 3D). Thus, these data make it unlikely that Lula/phi80 supplements the host methylase with its own enzyme, although the host Dam methylase does reduce the frequency of spontaneous Lula/phi80 induction, probably by reducing SOS induction (70). It is known that dam mutations cause lambda lysogens of E. coli to release more free phage during growth in culture (61).

Deletion of gene 27 (dinL).

The increased UV sensitivity of Lula/phi80 lysogens, compared with that of nonlysogens (Fig. 4A) or lambda lysogens (75), could be due to the action of phage genes, attuned to the host DNA damage response. The DNA damage response in E. coli is called the SOS response (55), and it is induced whenever the homologous pairing and strand exchange protein RecA forms filaments on single-stranded DNA (ssDNA) (53, 71). In E. coli, the genes responding to DNA damage are controlled by the LexA repressor, which is destroyed during the SOS induction by RecA filaments. The LexA repressor has a well-defined DNA binding site with the consensus sequence TACTGTATATATATACAGTA, where the underlined pair of trinucleotides, as well as the precise distance between them, is absolutely conserved (31). Phage lambda has several potential LexA binding sites in its genome that could be repressing its terminase and Gam and Int protein production in the absence of DNA damage. Perhaps the best-known LexA binding site in the lambda genome is found in the control region, between the decision-making gene cII and the replication initiation gene O (51). Not only could the binding of LexA to this site inhibit expression of the replication initiation protein, but it also inhibits the production of the oop transcript (its likely main target), which runs antisense to the cII transcript. The effect of this antisensing is that in the SOS-induced cells, production of the cII protein is inhibited, strongly favoring lytic development over lysogenization, as demonstrated by oop RNA overproduction experiments (87).

Fig 4.

Fig 4

Lack of phenotypes of the ΔdinL mutant of Lula/phi80. (A) UV survival curves. All the values are means of three independent measurements ± standard errors of the means (SEM). Strains: Nonlysogen, AB1157; WT Lula/phi80, EL103; ΔdinL Lula/phi80, EL113. (B) Phage titer at 60 min or 180 min postinduction with 0, 4, or 10 J/m2 UV. All the values are means of four independent measurements ± SEM. Strains: WT phage, EL103; ΔdinL phage, EL113. (C) Cell titer at 60 or 180 min postinduction with 0, 4, or 10 J/m2 UV. All the values are means of four independent measurements ± SEM. Strains are the same as in panel B. (D) UV sensitivity of the WT-Lula WT lysogen versus that of the ΔdinI-Lula ΔdinL lysogen. The WT and ΔdinI nonlysogens are shown for comparison. All the values are means of five independent measurements ± SEM. Strains: ΔdinI-no prophage, EL120; WT-no prophage, AB1157; WT-Lula WT, EL103; ΔdinI-Lula ΔdinL, EL122.

Lula/phi80, like lambda, has at least four potential LexA binding sites. Two potential LexA binding sites are in the regulatory region, one controlling the oop RNA production downstream of cII, as in lambda (Fig. 2), and the other in the middle of the cI repressor gene. Curiously, binding of LexA to the latter site in cells without DNA damage should reduce production of the phage repressor, making lysogens easier to induce spontaneously but (potentially) harder to induce in response to DNA damage. In contrast to lambda, Lula/phi80 also has a high-affinity LexA binding site (TACTGTtTATtTATACAGTG) in front of gene 27, which is a homolog of a gene called msgA (“macrophage survival gene A”) found in several temperate phages. This gene is implicated in resistance to macrophages in Salmonella (35) and is related to the E. coli SOS-inducible gene dinI (51), which is also present in temperate phages (10). Since Lula/phi80 gene 27 shares 37% amino acid identity with E. coli dinI, we decided to call it dinL (DNA damage-inducible gene of Lula/phi80). There is one more LexA binding site, with a lower affinity, just downstream of dinL, apparently controlling the expression of gene 26, whose mRNA is antisense for dinL mRNA.

In vitro, the DinI protein of E. coli stabilizes RecA filaments (without enhancing their formation) (59, 60), at the same time inhibiting the RecA filament-mediated self-cleavage of the LexA repressor and the UmuD protein (93, 94). The in vivo behavior of dinI mutants of E. coli is also consistent with the idea that DinI is an SOS response modulator, enhancing the DNA repair function of RecA while decreasing its SOS-inducing function (74). If Lula supplements host DinI with its own DinL, amplifying SOS modulation during DNA damage, then inactivation of dinL should make the prophage even more lethal after DNA damage. To test this idea, we deleted dinL in a lysogen. In contrast to our expectations, the UV sensitivities of the Lula/phi80 wild-type and ΔdinL lysogens were the same (Fig. 4A). Moreover, we detected no difference between the ΔdinL Lula/phi80 lysogen and the wild-type lysogen in titers of the phage released after UV induction at two different times and with two different UV doses (Fig. 4B). Under the same conditions, the titer of surviving cells also showed no significant difference (Fig. 4C). Thus, the status of the dinL gene has no influence on the gross parameters of Lula/phi80 lysogen induction by UV.

Only when we added the effect of ΔdinI mutation of the host did we detect a small difference in UV sensitivity between the WT-Lula WT lysogen and the ΔdinI-Lula ΔdinL lysogen (Fig. 4D). The latter was more UV sensitive, as would be expected if DinI of the host and DinL of the prophage work together either to reduce the SOS response or to augment the recombinational repair, or both. However, our efforts to distinguish the effects of these two mutations were not successful, as the effects of the single mutants were mostly not statistically significant (see Fig. S2 in the supplemental material). Thus, under the conditions we tried, the dinI-dinL status of the lysogen contributes little to the lytic infection in response to exogenous DNA damage.

We noticed that during growth of a lysogen with no exogenous DNA damage, a dinL mutation in the prophage reduced the free phage titer severalfold (see Fig. S3 in the supplemental material). We reported before that the recA mutation decreases Lula/phi80 titers in the lysogen supernatants by almost five orders of magnitude (75), which is understood in terms of phi80 repressor cleavage catalyzed by RecA filaments (28). Now we found that the lexA3 mutation, which renders the host SOS response noninducible (54, 65), actually increases supernatant titer of wild-type Lula/phi80 by at least one order of magnitude (see Fig. S3 in the supplemental material). This increased titer in the lexA3 host is again decreased severalfold if the Lula/phi80 lysogen carries the ΔdinL mutation (see Fig. S3 in the supplemental material). We conclude that (i) the functional dinL+ gene elevates phage output of the lysogen in response to endogenous (background) DNA damage and (ii) Lula/phi80 has at least one more LexA-sensitive gene, with the product of this gene inhibiting lytic induction. This could be the cI repressor itself, reacting to the uncleavable LexA due to the LexA inhibition of its synthesis proposed above, or gene 26 running antisense to dinL.

Mutagenesis of the nonessential genes.

To isolate Lula/phi80 mutants that would not be as sensitive to UV as lysogens of the wild-type phage, we mutagenized a Lula/phi80 lysogen with the pRL27 insertional kan cassette (49), pooled the library of independent inserts, isolated the total phage from the supernatant of the overnight culture of this pool, used it to infect a nonlysogen, and plated for individual kanamycin-resistant colonies. Pools of these Kan-resistant lysogens were plated and UV irradiated with doses of 40 or 80 J/m2, but all the rare survivors showed wild-type (high) sensitivity to UV.

Although we failed to isolate Lula/phi80 mutants with defective reaction to DNA damage, we realized that, by insisting that mutant phages complete the full infection cycle (first lytic induction and then phage production, a new infection, and establishment of a new lysogeny), we had isolated Lula/phi80 mutants with mutations in nonessential functions (called “accessory genes” in lambda [19]). Sequencing five of these mutants confirmed our reasoning. Two of the five were different hits in the same gene (gene 20, coding for a putative protein), bracketed by the tail assembly gene I (19) and the tail fiber gene J (21), one insert was at the very C terminus of gene 9 encoding the head-tail joining protein FII, one landed in the long intergenic region between Q and S (57 and 58), and the last one was in gene 63, again coding for a hypothetical protein. Thus, pRL27 mutagenesis of a Lula/phi80 lysogen, with the subsequent isolation of phage and relysogenization, can be used to isolate mutants with mutations in the nonessential Lula/phi80 functions.

GamL and its modifier Agt.

Gene 39 demanded attention because it caused the 569-nt-long gap in the Lula/phi80 genome contig (with otherwise 10-fold coverage on both sides), apparently coding for a toxic protein. Cloning of gene 39 confirmed that its expression noticeably inhibits wild-type E. coli cells and is quite toxic for recA mutant cells, especially if overexpressed (Fig. 5A). This inhibition was the likely reason why gene 39 caused the gap in the Lula/phi80 sequencing contig, as our sequencing approach entailed cloning random genome pieces in a multicopy plasmid and recovering the plasmid library in a recA mutant.

Fig 5.

Fig 5

Lula/phi80 genes 39 and 40, coding for GamL and its modifier Agt. (A) Overexpressed gene 39 is toxic to cells, especially if they are recA mutants. Strains: recA+, ER119; recA−, DH5α Z1. (B) Toxicity of the overexpressed gene 39 is alleviated by overexpression of gene 40, which has no effect on its own. The cells are all recA mutants (DH5α Z1). Plasmids: vector, pLAC11; 40, pER17; 39, pER18; 39 + 40, pER19. (C) Expression of gene 39, alone or together with gene 40, makes E. coli cells ExoV− phenocopies, as shown by spotting of T4 2 mutant phages as a test for ExoV status of E. coli. Top, wild-type AB1157 cells are ExoV+ and therefore are nonpermissive for the T4 2 mutant, while the recBC mutants are ExoV− and therefore allow T4 2 mutant plating. Bottom, plasmids are as in panel B. The lawn is wild-type strain ALS225. (D) Expression of GamL or Agt, alone or together, has little influence on the recombinational repair capacity of E. coli, as tested by sensitivity to UV. Plasmids are as in panel B, while the strain is ALS225.

Toxin genes are usually accompanied by cognate antitoxin genes, to provide the organism with immunity from toxicity. Indeed, gene 40, just upstream of gene 39, apparently codes for such an antitoxin, because when the two genes are cloned together, the inhibition by gene 39 is significantly relieved, even in recA mutant cells (Fig. 5B). Although true toxin-antitoxin pairs are ubiquitous and recognizable (89, 92), a BLAST search failed to provide a clue to the possible functions of genes 39 and 40, since the only homology found was to other conserved phage proteins of unknown functions. Toxin-antitoxin pairs are typically functions that contribute to the stability of plasmids (89), but since the Lula/phi80 prophage resides in the chromosome, rather than being a free plasmid, like its N15 relative (73), the utility of such a pair to Lula/phi80, even if indeed confirmed at the protein level as a stable toxin and unstable antitoxin, is not apparent. It could contribute to the development of persisters (50) of its lysogenic host, which would increase the chances of population survival after lethal damage to growing cells. Recently, type III toxin-antitoxin pairs that work to prevent infection of the cell by lytic phages were described (33), giving one more rationale for a toxin-antitoxin system benefit to a temperate phage.

A potential function of gene 39 was suggested by its position in the Lula/phi80 genome just upstream of recT, which codes for strand annealing/exchange homologous recombination activity. The analogous position in the phage lambda genome, upstream of the lambda strand annealing/exchange homologous recombination activity bet, is occupied by gam (22, 23), coding for an inhibitor of the host RecBCD helicase/nuclease (AKA ExoV) (43); a similar gene arrangement was proposed for phi80, based on genetic studies (64). In E. coli cells, the RecBCD enzyme has the highest affinity to double-stranded DNA ends and degrades linear DNA starting from such ends with the highest known rate for linear DNA degradation, at least 1 kbp/s (26). Therefore, phages with linear genomes protect their DNA from this host enzyme, either by inhibiting RecBCD directly or by capping double-strand ends with special proteins (3, 34, 78). In phage T4, the double-strand end-capping protein is the product of gene 2; as a result, T4 2 mutant phages cannot plate on wild-type E. coli but can plate if the RecBCD nuclease/helicase is mutationally inactivated (the ExoV− phenotype of recBC mutants) (85) (Fig. 5C, top). Although the Lula/phi80 gp39 and lambda Gam proteins show no relatedness, plating of T4 2 mutant phage confirmed that gp39 indeed inhibits the host RecBCD exonuclease, in both the presence and the absence of gene 40 (Fig. 5C bottom). Therefore, we gave gene 39 the second name “gamL” to reflect its likely in vivo function in Lula/phi80. We also gave gene 40 the mnemonic name “agt” (alleviates GamL toxicity). Interestingly, lambda Gam exists in a long version and a short version, with the short version being quite toxic for E. coli cells if overexpressed (81), so in the case of lambda Gam it can be argued that Gam and Agt functions have been fused in a single polypeptide.

Lambda Gam makes a significant contribution to phage lambda productivity during lytic infection in the RecBCD+ hosts, as the yield of gam mutant infections is only 40% of that of gam+ infections (30). Because of this consideration, measuring the levels of free phage titers in cultures of ΔgamL Lula/phi80 lysogens could be misleading, reflecting mostly the decreased productivity of lytic development rather than a less frequent induction. Therefore, instead of deleting gamL, we decided to look at the nature of the RecBCD defect that GamL induces. There are two types of recBCD-defective mutants of E. coli: the recD mutants are reduced for linear DNA degradation power but still retain all recombinational repair capabilities of the wild-type strain, while the recBC mutants are deficient in both linear DNA degradation and recombinational repair (4). For example, expression of lambda Gam in E. coli cells sensitizes them to UV radiation (34, 66), suggesting inhibition of recombinational repair. To test whether expression of GamL turns cells into recD mutant or recBC mutant phenocopies, we tested the UV sensitivity of cells expressing either GamL or Agt alone or the two together. We found that expression of GamL alone slightly reduces the cells' resistance to UV, whereas expression of Agt alone or of GamL and Agt together is inconsequential for UV resistance (Fig. 5D), indicating normal recombinational repair capability and, therefore, the RecBC+ status of all combinations. We conclude that expression of GamL modifies the host RecBCD to inhibit linear DNA degradation but not the recombinational repair functions of the enzyme, effectively turning E. coli cells into recD mutant phenocopies.

gamL and agt are expressed in Lula lysogens.

“Lysogenic conversion” is the change in the host cell phenotype as a consequence of lysogenization with a prophage. Immunity to infection by self or by phages with the same immunity region is an example of lysogenic conversion, afforded by the prophage repressor (cI, in case of lambdoid phages). Directly downstream of the cI repressor gene of phage lambda are the rexAB genes, which allow lambda prophage to kill the cell upon lytic development of other phages (69). This “other lytic phage exclusion” function is also typical of lysogenic conversion, except that in case of lambda, wild-type T4 already developed an antidote to it, in the form of its rII cistron (83). Interestingly, just downstream of its cI gene, Lula/phi80 has a single gene of unknown function (gene 46), historically known as gene 40AB (67), with a BLAST-identified “acetate kinase superfamily domain,” which could be Lula/phi80's “other lytic phage exclusion” function.

A gene 2 mutant of T4 plates equally poorly on nonlysogens and lambda lysogens, indicating no expression of the lambda gam gene from lambda prophage (62). In contrast to lambda lysogens, Lula/phi80 lysogens allow T4 2 mutants to plate (Fig. 6A), suggesting that Gam (plus Agt) is produced by the prophage as well. We also found that Lula/phi80 lysogens exclude wild-type T4 (Fig. 6A), perhaps by gp46. The curious fact that Lula/phi80 lysogens exclude wild-type T4 yet allow plating of a T4 2 mutant, which is defective in the pilot protein that protects the ends of the T4 linear chromosome (52), not only means that Lula/phi80 prophage inactivates ExoV activity of the host RecBCD enzyme to allow T4 2 development but also suggests that the “other lytic phage exclusion” function of Lula/phi80 recognizes the T4 gp2 protein and somehow kills the cell that expresses this specific protein. In any case, ExoV inactivation is a part of the Lula/phi80-induced lysogenic conversion.

Fig 6.

Fig 6

The Lula/phi80 lysogen is an ExoV− SbcCD− phenocopy. (A) The Lula/phi80 lysogen allows T4 2 mutant plating but restricts T4 WT phage. Strains: WT nonlysogen, AB1157; WT lysogen, EL103; recBC nonlysogen, SK129; recBC lysogen, ER114. (B) Gene 39 (Lula/phi80 gamL), is the only gene required for plating of lambda-pal. On the right is a scheme of the truncated phi80 DNA in DH5α and the constructs we built. Lawns were made with the following strains: (i) recBC(Ts), SK129; (ii) DH5α Δ(attP-46), L-264; (iii) L-264/pTOPO:2; (iv) L-264/pER17; (v) L-264/pER18; and (vi) L-264/pER19. The phage is lambda-pal, MMS1632. (C) Titer of lambda-pal on a recA mutant in the AB1157 background, carrying various additional mutations or ExoV-inactivating plasmids. Strains according to bar number on the right: 1. DH5α; 2, DH5α/pER19; 3, JC10287; 4, AK10; 5, L-293; 6, JC10287 Lula/phi80 lysogen; 7, JC10287/pER19; 8, JC10287/pKM590; 9, JC10287/pKM590.

There is genetic evidence that, besides the ExoV activity of RecBCD, lambda Gam also inactivates the host SbcCD enzyme (47), a relative of eukaryotic SMC proteins (82) and a helicase/nuclease (16) that attacks hairpins formed by inverted palindromes (15). In the classic E. coli K-12 AB1157 background (5), either a recD mutation (ExoV− phenotype) or a sbcCD mutation (as was shown before [11]), as well as Lula/phi80 prophage (as we show now), all allow full-titer plating of a lambda red gam mutant (deficient both in the phage-encoded homologous recombination system and in inhibition of the host ExoV) carrying a large palindrome (lambda-pal) (Table 2, top four rows). Since we knew that the Lula/phi80 prophage makes AB1157 strain ExoV−, we wondered if the lysogens could also become sbcCD mutant phenocopies. In an unrelated line of research, we observed that a recA+ derivative of the standard BRL-developed DH5α (6), which is genetically recD+ sbcCD+ but carries a truncated phi80 prophage (27), nevertheless plates lambda-pal (Table 2, strain L-41). At the same time, DH5α recA+ is not an ExoV− phenocopy (Table 2, L-41), suggesting that lambda-pal permissivity is due to an sbcCD mutant phenocopy of the strain, which we confirmed (Table 2, compare strains L-41 and L-243). This SbcCD− phenotype was due to the truncated phi80 prophage, as deleting it made the strain restrict lambda-pal plating, but introducing the sbcCD mutation in the latter strain restored the plating (Table 2, strains L-41, L-262, and L-263). Finally, we found that to produce the lambda-pal-nonpermissive phenotype, only 10 kbp between attP and gene 46 in the truncated phi80 has to be removed (Table 2 [strain L-264] and Fig. 6B). The deletion strain starts plating lambda-pal again if genes 33 to 40 of Lula/phi80 are introduced back (4.4 kbp on plasmid TOPO:2) (Fig. 6B) or if GamL, alone or in combination with Agt (but not Agt alone) is produced off a plasmid (Table 2 [two bottom rows] and Fig. 6B). All the observations with strain L-41 supported the idea that GamL of Lula/phi80 inhibits the SbcCD enzyme.

Table 2.

Plating of T4 2 mutant (for ExoV status) and lambda-pal (for SbcCD status) on strains with the recD or sbcCD mutations or carrying various Lula/phi80 sequencesa

Background Strain Relevant genotypeb ExoV phenotype Lambda-pal titer
AB1157 AB1157 WT + 106
AK74 recD − 1010
L-310 sbcCD + 1010
AB1157(Lula) phi80+ − 1010
DH5α recA+ L-41 phi80t + 1010
L-243 phi80t sbcCD + 1010
L-262 Δphi80t NDc 107
L-263 Δphi80t sbcCD + 1010
L-264 Δ(attP-46) phi80t + 107
L-264/pER17 Δ(attP-46) phi80t Agt+++ ND 107
L-264/pEAK73 Δ(attP-46) phi80t GamL+++ − 1010
a

Palindrome phage, MMS1632 pal571 cI1857 b1453 k + 76. Control phage DKC14 plated with equal efficiency in these experiments.

b

phi80t, truncated phi80, as in DH10B (27).

c

ND, not done.

Because red gam lambda mutants cannot plate on recA mutant hosts (30, 95), the original DH5α strain, which is a recA mutant, does not plate lambda-pal (Fig. 6C, bar 1) but becomes permissive for lambda-pal if the GamL and Agt proteins of Lula/phi80 are overproduced (Fig. 6C, bar 2). The interplay of recD and sbcCD mutant phenotypes in palindrome permissivity could be resolved in a recA mutant background, as was first shown for the phi80-free E. coli K-12 by Chalker et al. (11). We confirmed their findings in our recA mutant nonlysogen: the original recA mutant does not plate lambda-pal (Fig. 6C, bar 3), a recA recD double mutant plates it poorly (Fig. 6C, bar 4), and the addition of the sbcCD mutation allows normal plating of the palindrome-containing phage, as we show for a Lula/phi80 lysogen of this recA mutant (Fig. 6C, bars 5 and 6). This lambda-pal-permissive phenotype of the Lula/phi80 lysogen in the recA mutant background is reproduced by expression of only two Lula/phi80 proteins, GamL and Agt, in this recA mutant (Fig. 6C, bar 7); we also show that the same phenotype is produced by overexpression of the Gam protein of phage lambda (Fig. 6C, bars 8 and 9), which is consistent with previous genetic data (47). We conclude that the Lula/phi80 lysogen makes recA mutant cells both recD and sbcCD phenocopies, while the truncated phi80 lysogen in DH5α makes cells only sbcCD mutant phenocopies but not ExoV− ones (they plate lambda-pal only if made RecA+).

Overall, we found that Lula/phi80 lysogens are both recD and sbcCD mutant phenocopies, due to expression of a single Lula/phi80 gene, gamL, while expression of the nearby agt makes expression of gamL less toxic for the host. Since GamL and Agt are produced during lysogeny, they are candidates for activities that underlie Lula/phi80's high lysogen output, although how this may happen mechanistically is unclear at this point.

DISCUSSION

The Lula prophage was found to contaminate a significant fraction of E. coli laboratory strains, stealthily spreading in the laboratory environment—a highly unusual feat (75). In fact, Lula contamination is so pervasive that at the time of its initial sequence analysis, its tail fiber protein gene (gene 21) returned 99% identity to two human loci (LOC338829 and LOC392563; records of these human genes were later discontinued). While characterizing Lula's physiology, we found at least two of its features that contribute to this phage's ability to breach human-imposed barriers to cross-contamination: cryptic lysogen productivity and stealthy infectivity (see the introduction) (75). Since nucleotide sequences of a few Lula restriction fragments revealed no homologies in the databases current at that time, we sequenced the genome of this new temperate phage in order to seek explanations for Lula's cross-contaminating powers in its genome structure/content. The whole 46,150-bp sequence of the Lula genome did not match anything in the database, but turned out to be a 100% match to the unpublished genome of phi80, a lambdoid phage from the 1960s and 1970s (77) that, apparently, “decided to take dwelling in the lab” rather than to fall into oblivion. The overall layout of the Lula/phi80 genome turned out to be very much lambda-like, even though the limited homology between the two genomes (∼70% nucleotide identity) was mostly concentrated in the leftmost 1/3 of the chromosome, in the morphogenesis region (Fig. 1), consistent with the earlier physical analysis (32) and confirming a general pattern of genome relatedness between several lambdoid phages (86). Especially striking is the similarity of the control region layout, further emphasized by there being no sequence relatedness between the control genes themselves (Fig. 2). Not only is the overall layout of the multiple important elements of the region essentially the same, but the general dimensions, including the sizes of the analogous regulatory genes and the distances between various regulatory sites, are carefully preserved. The only explanation for this remarkable layout conservation that we can think of is that in vivo the whole region functions as a nucleoprotein complex of a particular structure, and this particular structure is critical for its functionality, while the actual sequences of either DNA sites or proteins that interact with these sites are not important. It was noted before on several occasions that lambdoid phages, while sharing only limited sequence homology, have the same genome structure (7, 12, 41); the general colinearity of the lambda and Lula/phi80 genetic maps was specifically noted (77).

Since none of the 66 proposed genes of Lula/phi80 offered an obvious explanation for the phage's stealthy infectivity or cryptic lysogen productivity, we further investigated three phage genes, damL, dinL, and gamL, whose products could have played a controlling function in the DNA metabolism of the phage or the host cell. Deletion of damL does not make Lula/phi80's virion DNA cuttable, but it increases the phage titer in saturated cultures of the corresponding lysogen severalfold, making DamL a negative factor in the phage's spontaneous lytic induction. Deletion of the SOS-regulated dinL does not make Lula/phi80 lysogens more UV resistant and has no influence on either the released phage titer or the decrease in cell titer after UV induction, although it does decrease severalfold the spontaneous phage titer in lysogen cultures, making DinL a positive factor. Finally, GamL acts to reduce ExoV activity of the host RecBCD nuclease/helicase without affecting the host's recombinational repair capability and also inhibits the host SbcCD enzyme, allowing propagation of phages carrying large palindromes. At the same time, the Lula/phi80 genome does not have palindromes of its own. If lambda's Gam mutant is considered an example, inactivation of GamL should have significantly reduced the titer of Lula/phi80 in cultures of lysogens, but that would be explained by GamL's important role in normal lytic development (phage DNA replication is more productive in the absence of ExoV). The production of the GamL protein is inhibitory for the host cells without coproduction of its neighbor Agt and kills the recA mutant bacteria. Surprisingly, GamL and Agt are also expressed in lysogens (maybe because Lula/phi80 has only two terminators downstream of N, while lambda has five [Fig. 2]), so the RecBCD and SbcCD inactivation is a part of Lula/phi80 lysogenic conversion (see below).

There are two types of Gam proteins known: those that bind and modify the RecBCD (and SbcCD) enzymes directly and those that bind double-stranded DNA ends, thus denying access to the RecBCD enzyme. Phage lambda Gam protein is the prototype of the former, mimicking in its structure a piece of duplex DNA (20), while the Gam protein of phage Mu, a distant relative of the eukaryotic Ku DNA end-binding proteins (21) is the prototype of the latter (1, 3). Since expression of GamL does not sensitize E. coli to DNA damage, it is likely that GamL acts by binding to and modifying the enzymes rather than making DNA ends inaccessible to DNA repair functions.

Finally, even though gene 30, coding for invertase Pin, could be responsible for the original inversion of the integrase-containing region in the Lula/phi80 genome relative to the lambda genome, we did not experiment with it, mostly because there is no evidence for continuing periodic inversions in the Lula/phi80 genome and no obvious candidates for a pair of Pin recognition sequences. We suspect that one of the Pin recognition sites has been mutated/deleted, and so Pin cannot catalyze inversion in Lula/phi80 anymore. A candidate for the remaining Pin site is the palindrome in front of the pin gene (Table 1). It is also possible that Pin catalyzes resolution of Lula/phi80 circular dimers/multimers, for which a single site per genome will suffice.

Genes behind Lula/phi80's ability to survive in the laboratory.

As was already mentioned, Lula/phi80's silent and efficient spread in the laboratory environment depends on at least two factors: its cryptic lysogen productivity and its stealthy infectivity (75). Cryptic lysogen productivity depends on Lula/phi80's opportunistic induction and its stability in laboratory protocols. Stealthy infectivity is due to the known temperature sensitivity of Lula/phi80 vegetative development and the much higher frequency of lysogenization compared with that of lambda. We will try to relate these properties to Lula/phi80's specific genome determinants.

We argued before (75) that Lula/phi80's cryptic lysogen productivity during normal growth, compared to that of other prophages, is the result of its increased prophage induction in response to spontaneous chromosomal damage—what can be called “opportunistic induction.” Whereas other prophages are not induced by spontaneous chromosomal damage events and are induced only by massive exogenous DNA damage and only after a significant delay, Lula/phi80 reacts instantly to any but the lowest doses of exogenous DNA damage and, apparently, goes lytic even from a small fraction of endogenous chromosomal damage events, such as the simultaneous collapse of two or more replication forks in a cell. After finding an SOS-inducible gene in the Lula/phi80 genome, dinL, we suspected it to be the “DNA damage sensor” of the phage, but deletion of dinL did not change Lula/phi80's “overreaction” to exogenous DNA damage, lowering the supernatant titer of the phage only severalfold. In the absence of any other apparent SOS-inducible gene, the major DNA damage sensor may be Lula's cI repressor itself, which is known to be the easiest repressor for activated RecA to cleave in vitro out of several lambdoid phage repressors, as it is still efficiently cleaved by the RecA430 mutant protein, which cannot even cleave the LexA repressor (25, 28). In combination with the suspected LexA repression of the cI production in uninduced cells, this may make Lula/phi80's cI the main DNA damage sensor of the prophage. If this sensor is set up to react even to a fraction of spontaneous DNA damage events, this will contribute to the high supernatant phage titer in the cultures of Lula/phi80 lysogens.

The second important contributor to the cryptic lysogen productivity of Lula/phi80 lysogens is the ability of the phage to survive in lysogen cultures of any density or age. The titer of infectious lambda phage rapidly drops in saturated cultures of both nonlysogens and (lambda) lysogens, but the Lula/phi80 titer is stable under the same conditions (75). This is likely a reflection of Lula/phi80's known ability to infect only metabolically active cells, which are capable of energy-driven enzymatic reactions in the cell envelope (36). Curiously, the only other well-known phage that infects only metabolically active cells is T1 (36, 88); this is in contrast to the case for most other phages, which are known to inject their DNA into stationary-phase or heat-inactivated cells, through cell membranes of lysed cells, or even through artificial membrane-like surfaces (88). The nature of this energy-dependent irreversible step in the case of T1 and Lula/phi80 is postulated to be formation of a covalent bond between the tip of the phage tail and the phage receptor (36, 88), which for both phages happens to be the outer membrane receptor FhuA (TonA) for transport of hydroxamate-type siderophores (29, 36, 42). The specific T1 and Lula/phi80 virion proteins that bind to FhuA or catalyze the formation of the bond are not known. Remarkably, homology between the two phages is limited to only three genes (22, 23, and 24 in Lula/phi80 [Table 1]) in the tail fiber region of the genome. In fact, these three genes are shared between all phages (HK022, N15, ES18, T1, and Lula/phi80) that are known to bind FhuA (91). Moreover, gene 24 is known to code for superinfection exclusion lipoprotein Cor (the postinfection plug for FhuA) (90), so we propose that the phage protein that enzymatically connects with the FhuA receptor is either gp22 (a 100-amino-acid [aa] protein with subdomains related to multidrug resistance proteins and to dehydrogenases) or gp23 (a 224-aa protein related to O-acetylhomoserine sulfhydrylases and cystathionine gamma-synthases). These may be the genetic determinants of Lula/phi80 preservation in cultures.

The stealthy infectivity of Lula/phi80 under standard laboratory conditions is due to at least two features. The first is its much lower optimal temperature for vegetative development (30°C, compared with lambda's 40°C). In fact, Lula/phi80 development at 42°C is so poor that this temperature can be used for transduction from lysogens if reinfection with Lula/phi80 is to be avoided (75, 84). Curiously, this temperature sensitivity of Lula/phi80 contributes to its much longer infection cycle at 37°C compared with lambda (25, 75), explaining the difficulty of detecting Lula/phi80's lytic development in contaminated cultures grown at the optimal E. coli temperatures (which are in the 37 to 40°C range [40]). The temperature-sensitive components of Lula/phi80 are not known, but they are unlikely to reside in the 1/4 of the chromosome transcribed from right to left (gray arrows in Fig. 1), as these genes are transcribed with the same (immediate/constant) temporal pattern during both lambda and Lula/phi80 infections (58), and this transcription from the pL promoter is much higher at 42°C than at 35°C (2). Not only do the genes transcribed from the opposite strand (black arrows in Fig. 1) show a different temporal transcription pattern in both phages (delayed initiation followed by 100-fold induction), but the timing of this induction at 37°C is two times longer in Lula/phi80 than in lambda (58), indicating that the temperature sensitivity of Lula/phi80 development starts at the level of the rightward transcription and ultimately results in late mRNA production. Indeed, both the lysis genes and the morphogenesis genes in Lula/phi80 are transcribed much more poorly at 42°C than at 35°C (2). However, the defect in the rightward transcription seems to start at pR, rather than at pR′, as even initiation of DNA replication is delayed at 42°C relative to 35°C by some 20 min (2). Thus, the temperature sensitivity of the rightward transcription in Lula/phi80 may be due to failure of N antitermination, rather than Q antitermination. Intriguingly, the temperature sensitivity of phi80 is even more complex, as studies with lambda-phi80 hybrids show that there are at least two additional heat-sensitive determinants in both the head and tail morphogenesis regions, in homologs of the A and L genes (lambda nomenclature) (77, 80). Why so many stages of Lula/phi80 development are blocked or delayed at higher temperatures is a mystery.

The second feature contributing to stealthy infectivity is Lula/phi80's much higher frequency of lysogeny than lambda: we estimate it at 1/10, with lambda's at 1/1,000, at 37°C (75). That is, 9/10 of Lula/phi80 infections still result in cell lysis, but the survival of 10% lysogenic cells makes the ongoing infection much less conspicuous, especially on plates (75). This feature is definitely defined by the Lula/phi80′ control circuit, but comparison with the control region of lambda does not yield any differences that could provide a clue (Fig. 2). If lambda's control circuit is the model, then the lysis/lysogeny balance should depend mostly on protein cII (the activator of cI repressor synthesis) or cIII (the inhibitor of FtsH protease, which degrades cII) (68). The apparent absence of cIII in the current Lula/phi80 annotation is due to our inability to identify which of the several small ORFs between kil and N (see the supplemental material) encodes this genetically demonstrated function (77). Since the rightward transcription from pR is proposed to be temperature sensitive in Lula/phi80 (see above), one needs also to measure the ratio of lysis to lysogeny at different temperatures, if only to test for the possibility that the preference for lysogeny is observed only at higher temperatures and is a simple reflection of inhibition of the rightward transcription at these temperatures.

ACKNOWLEDGMENTS

This work was supported by grant GM 073115 from the National Institutes of Health. The Wisconsin sequencing was carried out under the auspices of the E. coli Genome Project at UW–Madison, supported by NIH grant P01 HG01428 (from the Human Genome Project).

We thank Frederick R. Blattner for making the data from the E. coli Genome Project available. We also thank the late Robert A. Weisberg for originally providing the Wisconsin group with phi80 and Martin Marinus, Kenan Murphy, and Frank Stahl for phages, strains, and plasmids.

Footnotes

Published ahead of print 5 October 2012

Supplemental material for this article may be found at http://jb.asm.org/.

REFERENCES

  • 1. Abraham ZH, Symonds N. 1990. Purification of overexpressed gam gene protein from bacteriophage Mu by denaturation-renaturation techniques and a study of its DNA-binding properties. Biochem. J. 269:679–684 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Aizawa S, Matsushiro A. 1975. Studies on temperature sensitive growth of phage phi80. I. Prophage excision. Virology 67:168–178 [DOI] [PubMed] [Google Scholar]
  • 3. Akroyd JE, Clayson E, Higgins NP. 1986. Purification of the gam gene-product of bacteriophage Mu and determination of the nucleotide sequence of the gam gene. Nucleic Acids Res. 14:6901–6914 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Amundsen SK, Neiman AM, Thibodeaux SM, Smith GR. 1990. Genetic dissection of the biochemical activities of RecBCD enzyme. Genetics 126:25–40 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Bachmann BJ. 1987. Derivations and genotypes of some mutant derivatives of Escherichia coli K-12, p 1190–1219 In Neidhardt FC, et al. (ed), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, DC [Google Scholar]
  • 6. Bethesda Research Laboratories 1986. BRL pUC host: E. coli DH5α competent cells. Focus 8:9 [Google Scholar]
  • 7. Campbell A. 1994. Comparative molecular biology of lamboid phages. Annu. Rev. Microbiol. 48:193–222 [DOI] [PubMed] [Google Scholar]
  • 8. Carlson K, Miller ES. 1994. Working with T4, p 421–426 In Karam JD. (ed), Molecular biology of bacteriophage T4. ASM Press, Washington, DC [Google Scholar]
  • 9. Carlson K, Raleigh EA, Hattman S. 1994. Restriction and modification, p 369–381 In Karam JD. (ed), Molecular biology of bacteriophage T4. ASM Press, Washington, DC [Google Scholar]
  • 10. Casjens SR, et al. 2004. The pKO2 linear plasmid prophage of Klebsiella oxytoca. J. Bacteriol. 186:1818–1832 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Chalker AF, Leach DRF, Lloyd RG. 1988. Escherichia coli sbcC mutants permit stable propagation of DNA replicons containing a long palindrome. Gene 71:201–205 [DOI] [PubMed] [Google Scholar]
  • 12. Clark AJ, Inwood W, Cloutier T, Dhillon TS. 2001. Nucleotide sequence of coliphage HK620 and the evolution of lambdoid phages. J. Mol. Biol. 311:657–679 [DOI] [PubMed] [Google Scholar]
  • 13. Cohen PT, Cohen P. 1989. Discovery of a protein phosphatase activity encoded in the genome of bacteriophage lambda. Probable identity with open reading frame 221. Biochem. J. 260:931–934 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Cohen PTW, Collins JF, Coulson AFW, Berndta N, OBda Cruz e Silva 1988. Segments of bacteriophage λ (orf221) and φ80 are homologous to genes coding for mammalian protein phosphatases. Gene 69:131–134 [DOI] [PubMed] [Google Scholar]
  • 15. Connelly JC, Kirkham LA, Leach DRF. 1998. The SbcCD nuclease of Escherichia coli is a structural maintenance of chromosomes (SMC) family protein that cleaves hairpin DNA. Proc. Natl. Acad. Sci. U. S. A. 95:7969–7974 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Connelly JC, Leach DR. 1996. The sbcC and sbcD genes of Escherichia coli encode a nuclease involved in palindrome inviability and genetic recombination. Genes Cells 1:285–291 [DOI] [PubMed] [Google Scholar]
  • 17. Conter A, Bouché JP, Dassain M. 1996. Identification of a new inhibitor of essential division gene ftsZ as the kil gene of defective prophage Rac. J. Bacteriol. 178:5100–5104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Coulby JN, Sternberg NL. 1988. Characterization of the phage P1 dam gene. Gene 74:191. [DOI] [PubMed] [Google Scholar]
  • 19. Court D, Oppenheim A. 1983. Phage lambda's accessory genes, p 251–277 In Hendrix RW, Roberts JW, Stahl FW, Weisberg RA. (ed), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY [Google Scholar]
  • 20. Court R, Cook N, Saikrishnan K, Wigley D. 2007. The crystal structure of lambda-Gam protein suggests a model for RecBCD inhibition. J. Mol. Biol. 371:25–33 [DOI] [PubMed] [Google Scholar]
  • 21. d'Adda di Fagagna F, Weller GR, Doherty AJ, Jackson SP. 2003. The Gam protein of bacteriophage Mu is an orthologue of eukaryotic Ku. EMBO Rep. 4:47–52 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Daniels DL, Schroeder JL, Szybalski W, Sanger F, Blattner FR. 1983. A molecular map of coliphage lambda, p 469–517 In Hendrix RW, Roberts JW, Stahl FW, Weisberg RA. (ed), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY [Google Scholar]
  • 23. Daniels DL, et al. 1983. Complete annotated lambda sequence, p 519–676 In Hendrix RW, Roberts JW, Stahl FW, Weisberg RA. (ed), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY [Google Scholar]
  • 24. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97:6640–6645 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Devoret R, Pierre M, Moreau PL. 1983. Prophage phi80 is induced in Escherichia coli K12 recA430. Mol. Gen. Genet. 189:199–206 [DOI] [PubMed] [Google Scholar]
  • 26. Dillingham MS, Kowalczykowski SC. 2008. RecBCD enzyme and the repair of double-stranded DNA breaks. Microbiol. Mol. Biol. Rev. 72:642–671 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Durfee T, et al. 2008. The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse. J. Bacteriol. 190:2597–2606 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Eguchi Y, Ogawa T, Ogawa H. 1988. Cleavage of bacteriophage phi80 cI repressor by RecA protein. J. Mol. Biol. 202:565–573 [DOI] [PubMed] [Google Scholar]
  • 29. Endriss F, Braun V. 2004. Loop deletions indicate regions important for FhuA transport and receptor functions in Escherichia coli. J. Bacteriol. 186:4818–4823 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Enquist LW, Skalka A. 1973. Replication of bacteriophage l DNA dependent on the function of host and viral genes. I. Interaction of red, gam, and rec. J. Mol. Biol. 75:185–212 [DOI] [PubMed] [Google Scholar]
  • 31. Fernández de Henestrosa AR, et al. 2000. Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol. Microbiol. 35:1560–1572 [DOI] [PubMed] [Google Scholar]
  • 32. Fiandt M, Hradecna Z, Lozeron HA, Szybalski W. 1971. Electron micrographic mapping of deletions, insertions, inversions and homologies in the DNAs of coliphages lambda and Phi 80, p 329–354 In Hershey AD. (ed), The bacteriophage lambda. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY [Google Scholar]
  • 33. Fineran PC, et al. 2009. The phage abortive infection system, ToxIN, functions as a protein-RNA toxin-antitoxin pair. Proc. Nat. Acad. Sci. U. S. A. 106:894–899 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Friedman SA, Hays JB. 1986. Selective inhibition of Escherichia coli RecBC activities by plasmid-encoded GamS function of phage lambda. Gene 43:255–263 [DOI] [PubMed] [Google Scholar]
  • 35. Gunn JS, Alpuche-Aranda CM, Loomis WP, Belden WJ, Miller SI. 1995. Characterization of the Salmonella typhimurium pagC/pagD chromosomal region. J. Bacteriol. 177:5040–5047 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Hancock RW, Braun V. 1976. Nature of the energy requirement for the irreversible adsorption of bacteriophages T1 and phi80 to Escherichia coli. J. Bacteriol. 125:409–415 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Hay RJ. 1991. Operator-induced contamination in cell culture systems. Dev. Biol. Stand. 75:193–204 [PubMed] [Google Scholar]
  • 38. Henderson D, Weil J. 1975. Recombination deficient deletions in bacteriophage λ and their interaction with chi mutations. Genetics 79:143–174 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Hughes P, Marshall D, Reid Y, Parkes H, Gelber C. 2007. The costs of using unauthenticated, over-passaged cell lines: how much more data do we need? Biotechniques 43:575–584 [DOI] [PubMed] [Google Scholar]
  • 40. Ingraham J. 1987. Effect of temperature, pH, water activity, and pressure on growth, p 1543–1554 In Neidhardt FC, et al. (ed), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, DC [Google Scholar]
  • 41. Juhala RJ, et al. 2000. Genomic sequences of bacteriophages HK97 and HK022: pervasive genetic mosaicism in the lambdoid bacteriophages. J. Mol. Biol. 299:27–51 [DOI] [PubMed] [Google Scholar]
  • 42. Kadner RJ, Heller K, Coulton JW, Braun V. 1980. Genetic control of hydroxamate-mediated iron uptake in Escherichia coli. J. Bacteriol. 143:256–264 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Karu AE, Sakaki Y, Echols H, Linn S. 1975. The gamma protein specified by bacteriophage lambda. Structure and inhibitory activity for the recBC enzyme of Escherichia coli. J. Biol. Chem. 250:7377–7387 [PubMed] [Google Scholar]
  • 44. King G, Murray NE. 1995. Restriction alleviation and modification enhancement by the Rac prophage of Escherichia coli K-12. Mol. Microbiol. 16:769–777 [DOI] [PubMed] [Google Scholar]
  • 45. Kouzminova EA, Kuzminov A. 2004. Chromosomal fragmentation in dUTPase-deficient mutants of Escherichia coli and its recombinational repair. Mol. Microbiol. 51:1279–1295 [DOI] [PubMed] [Google Scholar]
  • 46. Kroger M, Hobom G. 1982. A chain of interlinked genes in the ninR region of bacteriophage lambda. Gene 20:25–38 [DOI] [PubMed] [Google Scholar]
  • 47. Kulkarni SK, Stahl FW. 1989. Interaction between the sbcC gene of Escherichia coli and gam gene of phage lambda. Genetics 123:249–253 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Langdon SP. 2004. Cell culture contamination: an overview. Methods Mol. Med. 88:309–317 [DOI] [PubMed] [Google Scholar]
  • 49. Larsen RA, Wilson MM, Guss AM, Metcalf WW. 2002. Genetic analysis of pigment biosynthesis in Xanthobacter autotrophicus Py2 using a new, highly efficient transposon mutagenesis system that is functional in a wide variety of bacteria. Arch. Microbiol. 178:193–201 [DOI] [PubMed] [Google Scholar]
  • 50. Lewis K. 2010. Persister cells. Annu. Rev. Microbiol. 64:357–372 [DOI] [PubMed] [Google Scholar]
  • 51. Lewis LK, Harlow GR, Gregg-Jolly LA, Mount DW. 1994. Identification of high affinity binding sites for LexA which define new DNA damage-inducible genes in Escherichia coli. J. Mol. Biol. 241:507–523 [DOI] [PubMed] [Google Scholar]
  • 52. Lipinska B, Rao AS, Bolten BM, Balakrishnan R, Goldberg EB. 1989. Cloning and identification of bacteriophage T4 gene 2 product gp2 and action of gp2 on infecting DNA in vivo. J. Bacteriol. 171:488–497 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Little JW. 1983. The SOS regulatory system: control of its state by the level of RecA protease. J. Mol. Biol. 167:791–808 [DOI] [PubMed] [Google Scholar]
  • 54. Little JW, Edmiston SH, Pacelli LZ, Mount DW. 1980. Cleavage of the Escherichia coli LexA protein by the RecA protease. Proc. Natl. Acad. Sci. U. S. A. 77:3225–3229 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Little JW, Mount DW. 1982. The SOS regulatory system of Escherichia coli. Cell 29:11–22 [DOI] [PubMed] [Google Scholar]
  • 56. Łobocka MB, et al. 2004. Genome of bacteriophage P1. J. Bacteriol. 186:7032–7068 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Lowe TM, Eddy SR. 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acid Res. 25:955–964 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Lozeron HA, Szybalski W. 1969. Congruent transcriptional controls and heterology of base sequences in coliphages lambda and phi80. Virology 39:373–388 [DOI] [PubMed] [Google Scholar]
  • 59. Lusetti SL, Drees JC, Stohl EA, Seifert HS, Cox MM. 2004. The DinI and RecX proteins are competing modulators of RecA function. J. Biol. Chem. 279:55073–55079 [DOI] [PubMed] [Google Scholar]
  • 60. Lusetti SL, Voloshin ON, Inman RB, Camerini-Otero RD, Cox MM. 2004. The DinI protein stabilizes RecA protein filaments. J. Biol. Chem. 279:30037–30046 [DOI] [PubMed] [Google Scholar]
  • 61. Marinus MG, Morris NR. 1975. Pleiotropic effects of a DNA adenine methylation mutation (dam-3) in Escherichia coli K12. Mutat. Res. 28:15–26 [DOI] [PubMed] [Google Scholar]
  • 62. Marsic N, Roje S, Stojiljcovic I, Salaj-Smic E, Trgovcevic Z. 1993. In vivo studies on the interaction of RecBCD enzyme and lambda Gam protein. J. Bacteriol. 175:4738–4743 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Miller JH. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY [Google Scholar]
  • 64. Morita T, Ichikawa N, Yamaguchi T, Matsushiro A. 1983. Isolation and characterization of deletion mutants affected in early genes of bacteriophage phi80 Mol. Gen. Genet. 183:144–151 [DOI] [PubMed] [Google Scholar]
  • 65. Mount DW, Low KB, Edmiston SJ. 1972. Dominant mutations (lex) in Escherichia coli K-12 which affect radiation sensitivity and frequency of ultraviolet light-induced mutations. J. Bacteriol. 112:886–893 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Murphy KC. 1991. λ Gam protein inhibits the helicase and χ-stimulated recombination activities of Escherichia coli RecBCD enzyme. J. Bacteriol. 173:5808–5821 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Ogawa T, Ogawa H, Tomizawa J. 1988. Organization of the early region of bacteriophage phi 80. Genes and proteins. J. Mol. Biol. 202:537–550 [DOI] [PubMed] [Google Scholar]
  • 68. Oppenheim AB, Kobiler O, Stavans J, Court DL, Adhya S. 2005. Switches in bacteriophage lambda development. Annu. Rev. Genet. 39:409–429 [DOI] [PubMed] [Google Scholar]
  • 69. Parma DH, et al. 1992. The Rex system of bacteriophage lambda: tolerance and altruistic cell death. Genes Dev. 6:497–510 [DOI] [PubMed] [Google Scholar]
  • 70. Peterson KR, Wertman KF, Mount DW, Marinus MG. 1985. Viability of Escherichia coli K-12 DNA adenine methylase (dam) mutants requires increased expression of specific genes in the SOS regulon. Mol. Gen. Genet. 201:14–19 [DOI] [PubMed] [Google Scholar]
  • 71. Phizicky EM, Roberts JW. 1981. Induction of SOS functions: regulation of proteolytic activity of E. coli RecA protein by interaction with DNA and nucleoside triphosphate. Cell 25:259–267 [DOI] [PubMed] [Google Scholar]
  • 72. Plunkett G, III, Rose DJ, Durfee TJ, Blattner FR. 1999. Sequence of Shiga toxin 2 phage 933W from Escherichia coli O157:H7: Shiga toxin as a phage late-gene product. J. Bacteriol. 181:1767–1778 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73. Ravin NV. 2011. N15: the linear phage-plasmid. Plasmid 65:102–109 [DOI] [PubMed] [Google Scholar]
  • 74. Renzette N, Gumlaw N, Sandler SJ. 2007. DinI and RecX modulate RecA-DNA structures in Escherichia coli K-12. Mol. Microbiol. 63:103–115 [DOI] [PubMed] [Google Scholar]
  • 75. Rotman E, Amado L, Kuzminov A. 2010. Unauthorized horizontal spread in the laboratory environment: the tactics of Lula, a temperate lambdoid bacteriophage of Escherichia coli. PLoS One 5:e11106 doi:10.1371/journal.pone.0011106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76. Rottem S, Barile MF. 1993. Beware of mycoplasmas. Trends Biotechnol. 11:143–151 [DOI] [PubMed] [Google Scholar]
  • 77. Rybchin VN. 1984. Genetics of bacteriophage phi80—a review. Gene 27:3–11 [DOI] [PubMed] [Google Scholar]
  • 78. Sakaki Y. 1974. Inactivation of the ATP-dependent DNase of Escherichia coli after infection with double-stranded DNA phages. J. Virol. 14:1611–1612 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79. Scherzer E, Auer B, Schweiger M. 1987. Identification, purification, and characterization of Escherichia coli virus T1 DNA methyltransferase. J. Biol. Chem. 262:15225–15231 [PubMed] [Google Scholar]
  • 80. Segawa T, Inokuchi I, Ozeki H. 1973. Genetic study on temperature sensitive nature of phage φ80. Virology 54:287–289 [DOI] [PubMed] [Google Scholar]
  • 81. Sergueev K, Yu D, Austin S, Court D. 2001. Cell toxicity caused by products of the p(L) operon of bacteriophage lambda. Gene 272:227–235 [DOI] [PubMed] [Google Scholar]
  • 82. Sharples GJ, Leach DRF. 1995. Structural and functional similarities between the SbcCD proteins of Escherichia coli and the RAD50 and MRE11 (RAD32) recombination and repair proteins of yeast. Mol. Microbiol. 17:1215–1220 [DOI] [PubMed] [Google Scholar]
  • 83. Shinedling S, Parma D, Gold L. 1987. Wild-type bacteriophage T4 is restricted by the lambda rex genes. J. Virol. 61:3790–3794 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84. Signer ER, Beckwith JR. 1966. Transposition of the lac region of Escherichia coli. III. The mechanism of attachment of bacteriophage φ80 to the bacterial chromosome. J. Mol. Biol. 22:33–51 [Google Scholar]
  • 85. Silverstein JL, Goldberg EB. 1976. T4 DNA injection. II. Protection of entering DNA from host exonuclease V. Virology 72:212–223 [DOI] [PubMed] [Google Scholar]
  • 86. Simon MN, Davis RW, Davidson N. 1971. Heteroduplexes of DNA molecules of lambdoid phages: physical mapping of their base sequence relationships by electron microscopy, p 313–328 In Hershey AD. (ed), The bacteriophage lambda. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY [Google Scholar]
  • 87. Takayama KM, Houba-Herin N, Inouye M. 1987. Overproduction of an antisense RNA containing the oop RNA sequence of bacteriophage lambda induces clear plaque formation. Mol. Gen. Genet. 210:184–186 [DOI] [PubMed] [Google Scholar]
  • 88. Tolmach LJ. 1957. Attachment and penetration of cells by viruses. Adv. Virus Res. 4:63–110 [DOI] [PubMed] [Google Scholar]
  • 89. Van Melderen L. 2010. Toxin-antitoxin systems: why so many, what for? Curr. Opin. Microbiol. 13:781–785 [DOI] [PubMed] [Google Scholar]
  • 90. Vostrov AA, Vostrukhina OA, Svarchevsky AN, Rybchin VN. 1996. Proteins responsible for lysogenic conversion caused by coliphages N15 and phi80 are highly homologous. J. Bacteriol. 178:1484–1486 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91. Wietzorrek A, Schwarz H, Herrmann C, Braun V. 2006. The genome of the novel phage Rtp, with a rosette-like tail tip, is homologous to the genome of phage T1. J. Bacteriol. 188:1419–1436 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92. Yamaguchi Y, Park JH, Inouye M. 2011. Toxin-antitoxin systems in bacteria and archaea. Annu. Rev. Genet. 45:61–79 [DOI] [PubMed] [Google Scholar]
  • 93. Yasuda T, Morimatsu K, Horii T, Nagata T, Ohmori H. 1998. Inhibition of Escherichia coli RecA coprotease activities by DinI. EMBO J. 17:3207–3216 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94. Yasuda T, et al. 2001. Physical interactions between DinI and RecA nucleoprotein filament for the regulation of SOS mutagenesis. EMBO J. 20:1192–1202 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95. Zissler J, Signer ER, Schaefer F. 1971. The role of recombination in growth of bacteriophage lambda. I. The gamma gene, p 455–468 In Hershey AD. (ed), The bacteriophage lambda. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES