HIV-1 Nef Impairs Heterotrimeric G-protein Signaling by Targeting Gα_i2 for Degradation through Ubiquitination

Background: HIV Nef disrupts chemotaxis of immune cells by targeting multiple steps.

Results: Nef recruits AIP4 E3 ligase, to ubiquitinate Gα_i2 of heterotrimeric G-proteins for subsequent lysosomal degradation.

Conclusion: Nef impedes chemokine-signaling events via degradation of Gα_i2.

Significance: Impaired G-protein signaling by HIV Nef-expressing lymphocytes probably contributes to immune dysfunction in AIDS.

Abstract

The HIV Nef protein is an important pathogenic factor that modulates cell surface receptor trafficking and impairs cell motility, presumably by interfering at multiple steps with chemotactic receptor signaling. Here, we report that a dominant effect of Nef is to trigger AIP4 E3 ligase-mediated Gα_i2 ubiquitination, which leads to Gα_i2 endolysosomal sequestration and destruction. The loss of the Gα_i2 subunit was demonstrable in many cell types in the context of gene transfection, HIV infection, or Nef protein transduction. Nef directly interacts with Gα_i2 and ternary complexes containing AIP4, Nef, and Gα_i2 form. A substantial reversal of Gα_i2 loss and a partial recovery of impaired chemotaxis occurred following siRNA knockdown of AIP4 or NEDD4 or by inhibiting dynamin. The N-terminal myristoyl group, ⁶²EEEE⁶⁵ motif, and ⁷²PXXP⁷⁵ motif of Nef are critical for this effect to occur. Nef expression does not affect a Gq_i5 chimera where the five C-terminal residues of Gq are replaced with those of Gα_i2. Lysine at position 296 of Gα_i2 was identified as the critical determinant of Nef-induced degradation. By specifically degrading Gα_i2, Nef directly subverts leukocyte migration and homing. Impaired trafficking and homing of HIV Nef-expressing lymphocytes probably contributes to early immune dysfunction following HIV infection.

Introduction

The recirculation of naive and memory lymphocytes, the trafficking of lymphocytes into lymphoid organs, and the appropriate localization of effector cells depend upon a regulated configuration of cell surface adhesion molecules and chemoattractants. Ligand-occupied chemoattractant receptors, trigger Gα subunits of the heterotrimeric G-protein G_i to exchange GTP for GDP. This leads to the release of Gα_i-associated Gβγ subunits, activation of downstream effectors, and directed cell migration (1). T lymphocytes employ several different chemokine receptors. The chemokine receptors CCR7, CCR9, and CXCR4 (chemokine (CXC motif) receptor 4) along with their cognate ligands regulate T-cell ontogeny in the thymus (2–4), whereas CCR7 regulates the migration of peripheral T cells to lymphoid tissue during adaptive immune response (5, 6). Proinflammatory chemokine receptors like CXCR3 and CCR5 and their respective ligands regulate effector CD4 and CD8 T cell trafficking in peripheral tissues (7–10). During an adaptive immune response, activated paracortical T cells use CCR7 and CXCR5 to migrate to the follicle edge and eventually into the lymph node follicle, where they help coordinate B lymphocyte responses (11, 12). Impaired signaling through these different receptors can cause immune dysfunction and lymphoid tissue disorganization.

A hallmark of HIV infection is severe disruption of the cellular microenvironment of lymph nodes and the gastrointestinal associated lymphoid tissue. Although this occurs in part as a consequence of CD4⁺ T cell depletion, a major contributing factor is compromised chemoattractant receptor signaling (13, 14). Perinatal HIV infection results in profound T cell developmental abnormalities mimicking those observed in thymic dysplasia in DiGeorge syndrome (15). Implicating the HIV Nef protein as a major co-factor in the general pathology and immune dysfunction in HIV AIDS, transgenic mice expressing HIV-1 provirus or HIV Nef protein alone have a similar constellation of immune pathologies (16–18).

Several mechanisms have been found by which Nef can interfere with chemoattractant receptor signaling. First, HIV and SIV Nef proteins have been shown to down-regulate chemokine receptor expression, presumably through enhanced receptor endocytosis (19, 20). This has been associated with a marked chemotactic arrest, presumably due to loss of the cognate receptor (19). Second, Nef can interfere with signal transduction pathways downstream of the receptors by affecting different intracellular signaling proteins involved in these pathways. These include the Ser/Thr kinase PAK; small GTPases, such as Rac and CDC42; and guanine nucleotide exchange factors, such as Vav and DOCK2-ELMO1 (21–24). In particular, Nef inhibited T lymphocyte chemotaxis toward CXCL12 (chemokine (CXC motif) ligand 12) by disrupting spatially organized cytoskeleton rearrangements through unregulated DOCK2-ELMO1-mediated Rac activation (24). Third, Nef has been linked to decreases in integrin expression, which impaired transmigration across endothelial cells (25). Fourth, Nef expression can alter the morphology of T lymphocytes and dendritic cells through changes in F-actin dynamics (26–28) by deregulating cofilin through PAK2 interaction (29) and RhoA interaction with diaphanous interacting protein and p190RhoAGAP (30). With the exception of the studies implicating reduced receptor expression, the majority of these studies indicate that the prominent effect of Nef on chemokine and chemoattractant receptor signaling is downstream of the major signal transducer, the heterotrimeric G-protein G_i.

Although Nef undoubtedly targets multiple sites in the chemoattractant signaling pathway, we have discovered a dominant effect of Nef because its expression results in a marked loss of steady-state levels of Gα_i2 protein but not of other Gα or Gβγ subunits. Nef triggered AIP4 (atrophin-interacting protein 4) E3 ligase-mediated Gα_i2 ubiquitination, leading to its endolysosomal sequestration and destruction. The consequence of the loss of Gα_i2 is a marked impairment in chemoattractant receptor signaling and directed leukocyte migration.

EXPERIMENTAL PROCEDURES

Expression Plasmids

Expression plasmids for CD4, CD8, WT and mutant Nef alleles, Nef Cerulean, and bicistronic IRES² plasmids encoding Nef and GFP have been described (31). Chemokine receptors, YFP-tagged Gα_i subunits, and the Gq_i5 chimera have been described (32–36). Mutations replacing each one of the three lysines at positions 296, 307, and 314 of Gα_i2 (but not in Gα_i3) with arginines were engineered by PCR mutagenesis of YFP-tagged Gα_i2 (35). The GST-Nef construct was constructed by in-frame cloning of Nef ORF into the EcoRI-SalI sites of pGEX-4T1 (GE Healthcare). Plasmids expressing GST fused to full-length AIP4, AIP4ΔWW, and AIP4-WW-I-IV were generously supplied by Adriano Marchese (Stritch School of Medicine, Loyola University, Chicago) as were the expression plasmids for FLAG-ubiquitin, FLAG-tagged WT AIP4, or c-Myc-tagged WT or C830A AIP4 mutant. The GST fusion proteins were expressed in Escherichia coli strain XL-1 Blue (Stratagene) and purified according to the manufacturer's (GE Healthcare) instructions.

Antibodies and Reagents

The following reagents were obtained from commercial sources. Unconjugated or dye-conjugated mAbs against EEA1 (early endosomal antigen 1) actin were from BD Immunocytometry (San Diego, CA); unconjugated LAMP1 (H4A3) and LAMP2 (H4B4) mAbs were from the Developmental Studies Hybridoma Bank (University of Iowa, Iowa City, IA); unconjugated or Alexa 488-, 647-, allophycocyanin-, or phycoerythrin-conjugated CD4 and CD8 were from Invitrogen or R&D Systems; antibodies against AIP4 and NEDD4, murine anti-Gα_i2 mAb, rabbit polyclonal antibodies against Gα_i2 (sc-7276), Gα_i3 (sc-262), Gα_o (sc-387), Gα_q/11 (sc-392), and Gα₁₃ (sc-410), and goat polyclonal antibody against actin (sc-1615) were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA); anti-YFP mAb was from Clontech Corp.; and rabbit IgG and murine mAb against HA or FLAG epitopes were from Covance or Roche Applied Science and Sigma-Aldrich, respectively. A second rabbit polyclonal antibody against Gα_o (catalog number 3975) was purchased from Cell Signaling Technology (Danvers, MA). Secondary antibodies to mouse, rabbit, goat, and human IgG conjugated to various Alexa dyes were from Invitrogen Corp., and HRP-conjugated goat anti-mouse, rabbit, or human IgG and donkey anti-goat IgG were from Pierce. Dyansore was purchased from Tocris Corp.; epoxomicin, forskolin, isoproterenol, and MG-132 were from EMD Biosciences. Dynasore and epoxomicin treatments were used at 80 and 25 μm concentrations, respectively, for 4 h at 37 °C, followed by staining for flow cytometry or immunoblotting.

Cells and Transfection

For this study, HeLa cells were used for microscopy, and T cell lines of Jurkat or CEM cells were used for phenotypic assays. HeLa cell transfection conditions have been described in detail before (69). The Department of Transfusion Medicine at the National Institutes of Health provided elutriated monocytes and leukocyte-enriched buffy coat from anonymous volunteers. Peripheral blood lymphocytes were purified as before (69), and cells were cultivated under standard conditions in RPMI medium or DMEM with 10% fetal calf serum (FCS) and 1% l-glutamine, as appropriate. Primary hematopoietic cells and cell lines in suspension (7–10 × 10⁶ cells/100 μl) were nucleofected with 3–5 μg of DNA using an Amaxa Nucleofector as recommended by the manufacturer. In all cases, GFP or CD8 expression plasmid was included to check transfection efficiency as described (31). Cell viability was checked using a FACS-based live/killed assay kit using a Guava Easycyte flow cytometer as described by the manufacturer (Millipore Corp.). Experiments were rejected if cell viability was less than 75%. For biochemical experiments, cell numbers were adjusted to equivalent viability and transfection efficiency. However, for most non-FACS-based experiments, transfectants were purified by positive selection using CD8 immunoaffinity beads from Stem Cell Technologies as recommended by the manufacturer.

HIV Infection

For single-cycle HIV infection, recombinant viruses expressing mouse CD24 in place of vpR (CD24), CD24 with a vpU deletion (CD24U), or CD24 lacking both vpU and Nef (CD24UM1T) were generated by 293-T cell transfection (Trans-IT LT1 transfection reagent, Mirus Corp.) with the respective HIV proviruses and a VSV-G expression plasmid. Infection was allowed to proceed for 48–72 h to achieve >40% infection. Virus production, quantification, and T cell infection kinetics have been described before (33).

RNA-mediated Interference

Gα_i1, Gα_i2, Gα_i3, and Gα_o subunits were knocked down using the recommended sequence (37). AIP4 and NEDD4 were knocked down using UUUCAAUGCAGAAUUUCUGUGGUCC and UAGAGGAGAAGGUUCUUGUUGUUGC, respectively (Invitrogen). Protocols for siRNA transfection followed by plasmid expression have been described before (31).

Intracellular [Ca²⁺] Measurements

Two different spectrofluorimetric assays were used. In the ratiometric assay, the relative ratio of fluorescence emitted at 510 nm after sequential excitation at 340 and 380 nm was measured as described (33), using Fura-2 AM (Invitrogen) as the calcium-binding dye in a fluorimeter (Photon Technology Inc., South Brunswick, NJ). Alternatively, intracellular Ca²⁺ levels were measured using a FLIPR 3 calcium assay kit (Molecular Devices) with a FlexStation III scanning fluorimeter as described (38), using Softmax Pro (Molecular Devices) for data acquisition and analysis. Single cell analysis of calcium flux was performed using the Leica SP5, using a ×40 oil immersion objective, numerical aperture 1.25. HeLa cells in 8-well chambers (LabTek chambers, Thermo Scientific) were cotransfected with CerFP or Nef-CerFP and YFP-tagged WT Gα_i2 or Gα_i3. At 18–24 h post-transfection, cells were loaded with Hanks' balanced saline solution containing Ca²⁺ and Mg²⁺ (Invitrogen) with 1% FBS and 4 μm Fluo-4 AM (Invitrogen). The cells were irradiated with a UV laser at 405 nm for Cerulean and with an argon laser at 488 nm for Fluo-4 and at 514 nm for YFP. Images were acquired in a 512 × 400-pixel format with the pinhole set at 2 airy units every 1–1.4 s for ∼200 s. The images were collected as line scan images, which provide the values of the calcium-dependent increase in fluorescence along a single spatial dimension as a function of time. For analysis, the regions of interest (ROIs) were drawn on the cells expressing Cerulean/Nef Cerulean. At least 10 ROIs were drawn for each field, and the calcium flux was measured in >5 fields for each experimental condition. The change in the intensities was analyzed using the Leica software, followed by graphing using EXCEL.

Affinity Selections

GST pull-downs of cellular extracts (10⁷ cell equivalents in 1 ml) in 25 mm Tris-HCl, pH 7.4, 150 mm NaCl, 1 mm EGTA, 0.5 mm MgCl₂, and 0.5% (w/v) Triton X-100 (lysis buffer) with protease inhibitors (1 Complete tablet/ml; Roche Applied Science) was done using purified GST or the indicated GST fusion proteins immobilized on glutathione- agarose beads (GE Healthcare) and incubated for 2 h. The beads were washed three times with lysis buffer and once with lysis buffer without Triton X-100. Bound proteins were resolved by SDS-PAGE and detected by immunoblotting using antibodies against the respective targets. His₆-tagged Nef protein was affinity-selected from extracts of corresponding transfectants using Ni²⁺-nitrilotriacetic acid-agarose beads (Qiagen Corp.), and FLAG-tagged proteins were selected using agarose bead immobilized M2 mAb (Sigma-Aldrich).

cAMP Assay

Intracellular cAMP levels were assayed using the Direct cAMP Enzyme Immunoassay kit (Assay Designs), following the manufacturer's instructions. The optical density was read at 405 nm in a FlexStation II microplate scanner, and the results were analyzed using Softmax Pro 5 (Molecular Devices, Sunnyvale, CA).

Flow Cytometry

The fluorescent dye-conjugated antibodies for CD4, CD8, and the chemokine receptors were obtained from BD Biosciences, R&D Systems, or eBioscience. One million cells were incubated with the appropriate antibodies in 100 μl of PBS containing 1% goat serum for 15 min at room temperature. The data acquisition was carried out using a FACSort^TM (BD Biosciences) flow cytometer, and the analyses were done using FlowJo version 9.2. (Tree Star Inc., Ashland, OR). Flow cytometric detection of F-actin by phalloidin staining has been described (75).

Confocal Microscopy

Confocal microscopy was done as described (32) using a Leica TCS-NT/SP5 microscope (Leica, Exton, PA) equipped with a 100× oil immersion objective, numerical aperture 1.32. Images were collected using digital zooms up to ×8. Co-localization experiments were done with live (fluorescent proteins) or fixed cells for most experiments as described (31). The fluorochromes were excited using a UV laser at 405 nm for Cerulean, an argon laser at 488 nm for Alexa 488 and YFP, and a DPSS laser at 561 nm for Alexa 568 and 647. Images were processed using the Leica TCS-NT/SP5 software, Leica Lite, and Adobe Photoshop CS4.

FRET Assay

FRET interactions between Nef-CerFP and YFP-tagged Gα_i2 or Gα_i3 were evaluated using the Leica acceptor photobleaching software to examine in live or fixed cells in the Leica SP5 confocal microscope with a ×60, numerical aperture 1.4 oil immersion objective in a 512 × 512-pixel format using a DPSS laser at 442 nm for Cerulean and an argon laser at 514 nm for YFP. The exposure times were kept equal within each series of images and chosen such that all pixel intensities were within the linear range. A ×63 oil lens was used unless mentioned otherwise. ROIs were selected from individual fields visualized at zoom factors between 1 and 8 (Z1–Z8), and 50–80% YFP photobleaching was achieved in the selected ROIs using the 514-nm laser at 100% power for 45 s at ×8 optical zoom. Each pixel of the image contains data corresponding to an emission spectrum resulting from both CFP and YFP. The fluorescence intensities of donor and acceptor were measured before and after photobleaching in the ROIs drawn at different cellular organelles and membranes. The diameter of the ROIs was kept uniform throughout the analysis at 8 μm. 10 ROIs were drawn for each part of a single cell, and at least 10 different cells were taken for each FRET efficiency calculation. Only regions photobleached at >50% were considered for analysis. FRET efficiency was calculated using the equation E_F = (I_postbleach − I_prebleach)/I_postbleach, where I is the average CFP fluorescence intensity after the subtraction of the background.

Chemotaxis Assays

End-point chemotaxis was determined using the transwell system with membranes of 6.5-mm diameter and 5.0-μm pore size in RPMI containing 10 mm HEPES and 1% FBS as described (32). The ratios of migrated cells were determined from the number of cells in the lower and upper chambers counted in a cell sorter after the addition of a known number of fluorescent reference particles (Spherotech, Inc., Libertyville, IL) (38). Flow cytometric detection of F-actin by phalloidin staining has been described (38).

Statistical Analyses

The statistical analyses were performed using GraphPad Prism version 5.0. A paired t test or one-way analysis of variance test was performed as appropriate, to determine the significance of the observed differences between the paired or unpaired samples. A value of p < 0.05 was considered to be significant in all of the analyses. The graphs were generated using either Microsoft Excel or GraphPad Prism, and the bars represent mean ± S.E.

RESULTS

Nef-induced Chemotaxis Defect in T Cells and Monocytes

Nef has been shown to impair chemotaxis toward CXCL12 in lymphoid cell lines, presumably through mechanisms other than depletion of cell surface CXCR4 (24, 25, 29, 39, 40). To investigate how Nef subverts chemotactic responses downstream of chemokine receptors, we selected cells for study in which Nef only modestly (<50%) reduced receptor expression. These included the T cell lines, CEM and Jurkat, human peripheral blood mononuclear cells (PBMCs), and human monocytes. Despite the relatively modest reduction in receptor levels (data not shown), Nef expression still markedly inhibited CXCL12-, CCL19-, CCL2-, or formylmethionylleucylphenylalanine-induced chemotaxis (Fig. 1, A–C).

FIGURE 1.

Nef inhibits migration of Jurkat T cells (A1–A4), fresh PBMCs (B), and monocytes (C) toward CXCL12 in a transwell assay and F-actin accumulation in response to CXCL12 or CCL2 (D). Relative (%) chemotaxis of Jurkat cells expressing different Nef alleles (and gated for GFP co-expression) at the optimal peak levels of CXCL12 for cells is illustrated by the histogram (mean with S.E., n = 3; *, p < 0.01) in A1, and a representative CXCL12 dose-response profile of chemotaxis of Nef(−) or Nef(+) cells (n = 3) is illustrated in A2. Relative migration potential of Jurkat cells expressing GFP alone (Vec) or with WT NA7, M20A, P72A, E62A, or L164A mutant from Nef-GFP IRES vector toward CXCR4 is shown as a function of GFP expression in A3 (n = 3). *, p < 0.05; **, p < 0.01, when compared with plasmid-transfected cells. A4, relative (%) chemotaxis of Jurkat cells transfected with CD8 alone or with WT NA7 or NL4–3 Nef allele or M20A, P72A, E62A, or L164A NL4–3 Nef mutant. Chemotaxis data are shown for CD8(+) cells (n = 3). *, p < 0.01 compared with respect to null controls. B, the histogram on the left shows chemotaxis potential of single-cycle Nef(+) HIV-infected (CD24-positive) and uninfected (CD24-negative) CEM cells toward CXCL12. Relative (%) migration potential of CEM cells in WT infected (CD24⁺) and non-infected (CD24⁻) population to different concentrations of CXCL12 was assessed by a transwell migration assay. The next histogram (with error bars (S.E.)) shows relative (%) chemotaxis toward CCL19 of PBMCs cotransfected with GFP and WT Nef, null mutant, or empty vector (n = 3, p < 0.02). CXCL12 dose response of chemotaxis (in absolute terms) for Nef(+) GFP(+) versus Nef(−) GFP(+) transfectants is illustrated on the right (n = 3). *, p < 0.05 compared with respective nanomolar concentration. C, histograms with S.E. (n = 3) show the chemotaxis potential toward CXCL12 or CCL2 (left) and formylmethionylleucylphenylalanine (right) of monocytes, transduced for 2 h with BSA or purified Nef fusion protein tagged C-terminally with the arginine-rich motif (RRM) of HIV-1 Tat followed by His₆ residues (n = 3). *, p < 0.05. D, time course of F-actin accumulation in Jurkat cells or fresh PBMCs nucleofected with bicistronic (IRES) plasmids encoding WT or null (Nef Xho) Nef and GFP. Histograms (with S.E.) on the left illustrate the F-actin accumulation in GFP(+) versus GFP(−) gated Jurkat cells nucleofected with Nef-Xho-IRES-GFP (top) or Nef-IRES-GFP (bottom) (n = 3). *, p < 0.02. PBMCs nucleofected with Nef-IRES-GFP or NefXho-IRES-GFP were treated with 20 nm CXCL12 for 45 min. Relative (%) F-actin levels (phalloidin mean fluorescence value (MFV)) are plotted as a function of GFP (Nef or NefXho) expression (n = 3). Bars, S.E.; ***, p < 0.01. Alternatively, monocytes were nucleofected with GFP and Nef or an empty vector, and the time course of F-actin accumulation in response to 20 nm CXCL12 or CCL2 was monitored in GFP(−) versus GFP(+) cells (n = 3). ***, p < 0.05.

The inhibition occurred irrespective of whether Nef was expressed by DNA transfection (Fig. 1, A1–A4, B (right two panels), and C (right panel)), protein transduction of monocytes (Fig. 1C, left panel), or single cycle HIV infection (Fig. 1B, left panel). Alanine substitutions disrupting the Nef polyglutamic motif at position 62 (E62A), the PXXP motif at 72 (P72A), or alanine substitutions at threonine 162 (T162A) and at histidine 166 (H166A) partially or completely reversed the inhibitory effect (Fig. 1, A3 and A4). The chemotactic defect corresponded to the marked reduction of F-actin accumulation in response to CXCL12 or CCL2 in Nef-expressing Jurkat cells, monocytes, and PBMCs (Fig. 1D).

Nef Markedly Inhibited Biochemical Readouts of Early G-protein Signaling from Agonist-stimulated Chemokine Receptors

Most, if not all, chemokines activate Gα_i-coupled GPCRs. An agonist-bound GPCR exchanges GTP for GDP in the Gα subunit of receptor-bound heterotrimeric G-protein. This results in Gα and Gβγ dissociation and the activation of downstream effectors. First, we examined the immediate consequence of Gβγ dissociation by monitoring intracellular Ca²⁺ flux from ER stores mediated by inositol 1,4,5-trisphosphate in response to activation of phospholipase C. We found that Nef expression markedly attenuated the rapid chemokine-induced mobilization of intracellular Ca²⁺ normally observed in Jurkat cells and abolished the response in U937 cells (Fig. 2, A1 and A2). We also visualized single cell Ca²⁺ flux in response to CXCL12 stimulation of HeLa cells expressing either Cerulean fluorescent protein (CerFP) or Nef-CerFP by real-time time lapse confocal video microscopy. CXCL12 increased intracellular Ca²⁺ in the CerFP-expressing cells, but not the Nef-CerFP cells (Fig. 2, B1). This was confirmed by quantitative kinetic analysis of Ca²⁺ flux of individual cells expressing CerFP or Nef-CerFP (Fig. 2, B2). These data suggested that Nef might perturb chemokine-mediated G-protein dissociation from cognate GPCR(s). In agreement with the corresponding effects on chemotaxis, alanine substitutions of four glutamates at 62 and at the PXXP motif partially reversed the Nef-induced inhibition of CXCL12-mediated calcium release from the ER (Fig. 2, B3).

FIGURE 2.

Nef markedly inhibited biochemical readouts of Gα_i2 activation. Nef inhibits chemoattractant-mediated calcium flux in Jurkat cells (A1) and the U937 cell line (A2). Cells were co-transfected with CD8 and Nef, co-expressers were purified by CD8-positive selection (Stem Cell Technologies), and Nef effect in Jurkat cells was evaluated by measuring cell surface CD4 expression. The time course of CXCL12 (10 nm)-initiated calcium flux profiles was obtained using FlexStation III and the recommended assay. Results are representative of four experiments. Agonist (CXCL12 followed by CCL2) dose (10 or 100 nm)-response profiles of intracellular calcium flux in U937 transfectants were analyzed by fluorescence ratiometry in a PTI fluorimeter (33). B1, time course of CXCL12-initiated Ca²⁺ flux in HeLa cells expressing CerFP or Nef-CerFP (red) was monitored by video capture at 30 frames/s of Fluo-4 emission (green) up to 150 s after CXCL12 addition. The arrows denote CerFP or Nef-CerFP cells (expressed at ∼10–15% efficiency around 12–16 h post-transfection) to highlight their difference in Fluo-4 intensity. Fluorescent data were collected from ∼10 ROIs for each field, the calcium flux was measured in >5 fields for each condition in an experiment, and the experiments were repeated three times (n = 50–60). The change in the intensities was analyzed using the Leica software followed by graphing using EXCEL. Ca²⁺ flux profiles of a few (to avoid clutter) representative cells (ROIs) expressing CerFP (left) or Nef-CerFP (right) are shown in B2, with the ordinate showing relative intensity of Fluo-4 emission. CXCL12-initiated Ca²⁺ flux is profiled in purified CEM cells co-transfected with CD8 and WT, null, or other Nef mutants. CEM cells were transfected with CD8, WT, null, or the indicated Nef mutants, and CD8(+) cells were purified prior to measurement of Ca²⁺ flux (as described above) (B3). Nef expression enhanced cAMP levels under basal conditions or after Gα_s activation by isoproterenol (C) or by forskolin stimulation of adenylyl cyclase (D). However, Nef did not further enhance the cAMP levels after isoproterenol treatment with transfectants overexpressing Gα_i3 (E). Jurkat cells were cotransfected with CD8 and Nef or vector (for C–E) and with a Gα_i3 expression plasmid (only for E). Transfected cells were purified by CD8 selection and assayed for cAMP production as described under “Experimental Procedures” (n = 4; error bars represent S.E.; *, p < 0.05).

Next, we inquired whether Nef subverted activation of G-protein α subunit(s). The major effectors of activated Gα_i subunits are adenylyl cyclase isoforms. GTP-bound Gα_i directly inhibits specific adenylyl cyclase isoforms, thereby reducing cAMP production by direct (by agents like forskolin) or hormone-induced (via activated Gα_s subunit) activation of adenylyl cyclase. Basal intracellular cAMP levels reflect a steady-state equilibrium of tonic inhibition and stimulation of adenylyl cyclase isoforms by activated Gα_i and Gα_s subunits, respectively. We found that Nef-expressing Jurkat cells had a 2-fold higher basal cAMP level than did the null expression controls, consistent with a loss of constitutive Gα_i signaling. Furthermore, Nef expression was associated with enhanced cAMP production in Jurkat cells treated with the β-adrenergic agonist, isoproterenol (ISOPRO), or forskolin, a direct adenylyl cyclase activator (Fig. 2, C and D). However, basal or hormone-induced cAMP levels were not enhanced in Nef(+) cells co-expressing recombinant Gα_i3 (Fig. 2E). This suggested that Nef might solely target Gα_i2 because Jurkat cells and lymphocytes express Gα_i2 and Gα_i3, not Gα_i1.

Nef Induced a Marked Loss of Steady-state Levels of Gα_i2 but Not Gα_i3 or Other Gα Subunits

To determine if Nef impaired G-protein functionality or induced a physical loss or sequestration of one or more G-protein subunits, we quantified the steady-state levels of Gα subunits in Nef(+) cells by immunoblotting. We found that Nef induced a dose-dependent decrease in Gα_i2 levels in Jurkat/CEM cells and monocytes, comparable in magnitude with CD4 down-regulation in Jurkat or CEM cells (Fig. 3A). In contrast, Gα_i3 in Jurkat cells, CEM cells (not shown), and monocytes or Gα_q and Gα_s in Jurkat cells were unaffected (Fig. 3A).

FIGURE 3.

Biochemical and genetic analysis of Nef induced loss of steady-state levels of Gα_i2 subunit in Jurkat and CEM cell lines and primary human monocytes in the context of DNA transfection or single cycle HIV infection. A, cellular extracts were immunoblotted for Gα_i2, Gα_i3, Gα_q, Gα_s, CD4, or actin. Protein bands were scanned for pixel density, and results are plotted as histograms with error bars representing S.E. (n = 3; *, p < 0.03). B, loss of Gα_i2 in single cycle infections of CEM/Jurkat cells with identical reverse transcriptase unit equivalents of VSV-G pseudotyped Nef⁺ (wt), but not Nef⁻ (M1T) or Nef⁻vpU⁻ (ΔvpU M1T) NL4-3 HIVs expressing murine CD4 antigen in place of vpR. Gα_i2, Gα_i3, and Nef were detected by immunoblotting cellular extracts. C, HIV-1 Nef alleles induced a specific loss of Gα_i2 of comparable magnitude. Jurkat cells were transfected with various Nef alleles, and the levels of Gα_i2 down-regulation were assessed. Cellular extracts were immunoblotted for Gα_i2, Gα_i3, HA (Nef), or actin. D, certain Nef mutants had lost the ability to induce loss of Gα_i2. Extracts of CEM/Jurkat cells transfected with the indicated Nef derivatives were analyzed by SDS-PAGE followed by immunoblotting for actin, Gα_i2, and Gα_i3. Relative pixel values in B and C represent averages from two experiments for each case. E, knockdown of Gα_i2 or Gα_i2 by cognate siRNAs partially inhibited CXCL12-dependent calcium flux. Jurkat cells were co-transfected with CD8 and Nef or an empty vector following siRNA nucleofection and expression for 48 h. ∼2 × 10² transfectants were adjusted to reflect constant levels of CD8 and analyzed for CXCL12-initiated intracellular calcium flux. Gα_i2 and Gα_i2 in the respective siRNA transfectants were detected by immunoblotting as described above.

In single cycle HIV-1 infections, loss of Gα_i2 correlated with Nef expression. Gα_i2 levels were unaltered in cells infected with viruses deleted for Nef or Nef and vpU (Fig. 3B). Eight different HIV-1 Nef alleles induced a specific loss of Gα_i2 of comparable magnitude (Fig. 3C). The differences in the level of down-regulation might be dependent on critical Nef residues, and they are a subject of further investigation. Gα_i2 levels were unaffected in cells expressing Nef mutants with alanine substitutions in the acidic motif at 62 (E62A) or in the polyproline motif at 72 (P72A) in Jurkat and CEM cells (Fig. 3D). We compared the effects of siRNA knockdown of individual Gα_i2, Gα_i3, or G_o subunits on agonist-driven Ca²⁺ flux. Knockdown of Gα_i2 or Gα_i3 resulted in a significant (∼60%) decrease in the agonist-mediated Ca²⁺ flux (Fig. 3E). Thus, the Nef-induced defect in early G-protein signaling reflected by chemokine-mediated Ca²⁺ flux was attributed to the physical loss of the Gα_i2 subunit.

Nef-induced Inhibition of Gα_i2 Degradation Was Partially Rectified by Overexpression of Recombinant Gα_i2, and a Gq_i5 Chimera Replacing the C-terminal Five Residues with Those of Gα_I Was Resistant to the Nef Effect

Co-expression of YFP-tagged recombinant Gα_i1 (not shown), Gα_i2, or Gα_i3 failed to restore CXCL12-mediated Ca²⁺ flux in Jurkat cells expressing a 2-fold molar excess of Nef over the recombinant Gα_i2 subunits (Fig. 4, A and B). The failure to reverse CXCL12-mediated Ca²⁺ flux by recombinant Gα_i2 reflected the destruction of endogenous and a substantial loss of the co-expressed Gα_i2 (Fig. 4A, bottom). Only by increasing the ratio of Gα_i2 to Nef expression could the signaling be partially restored. Although there was no loss of Gα_i3-YFP co-expressed with a molar excess of Nef (Fig. 4B, bottom), Gα_i3-YFP failed to restore CXCL12-initiated Ca²⁺ flux (Fig. 4B, top).

FIGURE 4.

Nef-induced inhibition of G-protein signaling and Gα_i2 degradation were partially rectified by overexpression of recombinant Gα_i2, and a Gq_i5 chimera replacing the C-terminal five residues with those of Gα_I was resistant to Nef effect. CEM cells were nucleofected with CD8 and YFP-tagged Gα_i2 (A) or Gα_i3 (B) subunits with or without a molar excess of Nef. Purified CD8 transfectants were analyzed for CXCL12-driven intracellular Ca²⁺ flux. Nef-induced loss of Ca²⁺ flux in response to CXCL12 was partially reversed in cells expressing a 2-fold molar excess of Gα_i2 over Nef (A), but Gα_i3 co-expression did not ameliorate Ca²⁺ flux deficit (B). At a 2-fold molar excess of Gα_i2 over Nef, there was much less relative loss in the steady-state levels of Gα_i2-YFP (A, bottom). There was no loss of Gα_i3-YFP with or without of Nef (B, bottom). Relative Gα_i2-YFP pixel values shown in the immunoblot are averages from three experiments. C, Nef did not inhibit CXCL12-initiated calcium flux in cells expressing Gq_i5 chimera replacing the C-terminal five residues with those of Gα_i2, (36). Jurkat transfectants co-expressing CD8 and Gq_i5 chimera with or without Nef were purified and analyzed as described above. D, Nef did not alter the stability of co-expressed Gq_i5 chimera. Cell extracts of Jurkat transfectants were analyzed for expression of HA-tagged Gq_i5, co-expressed CD8, Nef, and actin. E, Gq_i5 expression did not alter Nef-induced down-regulation of CD4 or CXCR4 at the PM. Black and gray histograms (with error bars (S.E.)) represent normalized data for CD8(−) and CD8(+) gated cells (n = 3; *, p < 0.05). IB, immunoblot.

A small C-terminal region of Gα subunit(s) is the GPCR selectivity determinant and a recombinant Gq_i5, which exchanged five Gq residues at the C terminus for those of Gα_i2, thus becoming functionally equivalent to Gα_i2 in chemokine responsiveness and pertussis toxin sensitivity (36). Nef failed to alter the expression of or inhibit CXCL12-induced intracellular Ca²⁺ flux from the Gq_i5 chimera (Fig. 4, C and D) while still down-regulating CD4 and CXCR4 (Fig. 4E). Because heterotrimeric G-proteins are bound to the receptor in an inactive state, it is possible that the Nef-induced lysosomal sequestration of Gα_i2 reflects aberrant trafficking of CXCR4. However, this is unlikely because cells co-expressing Nef and Gq_i5 chimera retained CXCL12-driven Ca²⁺ flux.

Nef Co-localized with and Promoted Sequestration of Gα_i2, but Not Gα_i3, in the Perinuclear Region Enriched for Endolysosomal Markers

To determine whether Nef interacted with Gα_i2 in vivo, we examined the subcellular distribution of YFP-tagged recombinant Gα_i2 or Gα_i3 in HeLa cells co-expressing CerFP or Nef-CerFP. In the CerFP-expressing cells, Gα_i2 and Gα_i3 were distributed at the PM irrespective of CXCL12 exposure. In Nef-expressing cells, a substantial fraction of Gα_i2 co-localized with Nef in the perinuclear region (co-localization correlation of >0.75), regardless of CXCL12 treatment, whereas Gα_i3 did not co-localize with Nef (correlation of <0.04) (Fig. 5, A1 and A2). Nef expression resulted in an equivalent loss of membrane-associated versus detergent-soluble fractions of Gα_i2-YFP, indicating that Nef induced collective loss of Gα_i2 inside the cell (Fig. 5, A3). The Gα_i2- and Nef-containing vesicular structures stained positively for endolysosomal markers EEA1 and LAMPs but not with the markers for ER (GRP) or Golgi (Golgin) (Fig. 5B).

FIGURE 5.

Nef co-localized with and promoted endolysosomal sequestration of Gα_i2 but not Gα_i3. HeLa cells in coverglass chambers were co-transfected with YFP-tagged Gα_i2 (A1) or Gα_i3 (A2) with CerFP or Nef-CerFP (top or bottom row in A1 and A2) and treated for 10 min at 37 °C with increasing concentrations of CXCL12 or not before processing for live microscopy. Cerulean is green, and YFP is red. A3, Nef-induced loss of YFP-tagged Gα_i2 occurred irrespective of whether or not the G-protein was membrane-associated. Cells were extracted in a buffer containing 1% (w/v) Triton X-100 (TXT-100) at 25 °C (room temperature (RT)), conditions that are known to strip most if not all membrane-associated proteins. Membrane (pellet) and cytoplasmic (supernatant) extracts were resolved by SDS-PAGE followed by immunoblot detection of YFP, Nef, and CD8. Relative Gα_i2-YFP pixel values are averages from three experiments. B, in Nef-expressing cells, YFP-tagged Gα_i2 (red) co-localized with Nef-CerFP (green) and endolysosomal markers, EEA1 and LAMP (blue) proteins, but not with markers (blue) for ER (GRP) or Golgi (GOLGIN).

Nef-mediated Lysosomal Sequestration of Gα_i2 Reflected in Vivo Interaction of Nef and Gα_i2

Next, we performed live FRET microscopy to analyze nearest neighbor interactions between Nef and Gα_i. We measured FRET efficiency on the basis of the increase in the donor (CFP or Nef-CFP) fluorescence upon photobleaching the YFP-tagged Gα_i2 acceptor. FRET efficiencies generated by tandem CFP-YFP fusion protein served as the positive control. We analyzed >10 cells in each of three experiments, and photomicrographs of one representative cell are shown (Fig. 6, A1), with the calculated FRET efficiencies of ∼100 ROIs shown in the graphs below (Fig. 6, A2). There was substantial FRET between Nef-CFP and Gα_i2-YFP at the intracellular, perinuclear region (Fig. 6, B1) but not at the PM (Fig. 6, B2) or anywhere in the cell with Gα_i3-YFP (Fig. 6, B1 and B2).

FIGURE 6.

Nef associated with Gα_i2 but not Gα_i3in vivo. Acceptor photobleaching FRET assay of HeLa cells co-expressing CerFP or Nef-CerFP with YFP-tagged Gα_i2 or Gα_i3. FRET assay was limited to Gα_i2 or Gα_i3 with CerFP or Nef-CerFP in the perinuclear area (A1) or at the PM (A2). Photomicrographs are representative of 10 fields (cells). Fluorescence intensities of 10 ROIs (arrows) corresponding to Gα_i2 or Gα_i3 in the perinuclear regions (B1) or at the PM (B2) in each cell were examined before (Pre) and after (Post) photobleaching, and calculated FRET efficiencies for all ROIs (∼100) from three independent experiments are shown as scatter plots with error bars. Donor emission of representative ROIs pre- and postphotobleaching is shown in the inset above the graph. The calculated statistical significance is represented (*, p < 01).

Nef Interacted with Gα_i2 in Vitro and Induced Gα_i2 Ubiquitination

To confirm the physical interaction between Nef and Gα_i2, we performed in vitro GST pull-down assays of leukocyte extracts using GST or GST-Nef. Using extracts from Jurkat T-cells and primary monocytes, we found that GST-Nef bound Gα_i2 but not Gα_i3 in a dose-responsive manner (Fig. 7A).

FIGURE 7.

Nef interacted with Gα_i2in vitro and induced Gα_i2 ubiquitination. A, varying amounts of purified GST or GST Nef were incubated with cellular extracts of Jurkat cells or human monocytes. Bound proteins were resolved by SDS-PAGE, and Gα_i species were detected by immunoblotting. B, Nef-induced ubiquitination of native Gα_i2 in Nef-expressing CEM cells. CEM cells were co-transfected with FLAG-tagged ubiquitin and Nef or null plasmid. Cellular extracts were directly immunoblotted for Gα_i2 (B1 and B2, left panels) or immunoprecipitated first with anti-FLAG polyclonal antibody (B1) or mAb (B2) followed by immunoblotting for Gα_i2. Asterisks denote Gα_i2 (left) and mono- and diubiquitinated Gα_i2 (right). Numbers (kDa) refer to molecular mass markers. Data are representative of three experiments. C, Nef-mediated Gα_i2 breakdown was partially rectified by Dynasore, a small molecular weight inhibitor of dynamin, or the proteosome inhibitor epoxomycin. Cellular extracts were analyzed by immunoblotting for Gα_i2. Gα_i2 bands are shown pairwise for Nef(+) versus Nef(−) for each treatment with relative (%) density (average values from three experiments) denoted below.

To inquire whether the loss of Gα_i2 was a consequence of Nef-induced ubiquitination of Gα_i2 and its subsequent lysosomal proteolysis, we directly evaluated whether Gα_i2 was ubiquitinated. We co-transfected CEM cells with vectors expressing FLAG-tagged ubiquitin and either Nef or control. Nef expression resulted in significant loss of Gα_i2 (Fig. 7, B1 (left)). Cellular extracts were immunoprecipitated with FLAG mAb-coated beads, and the selected proteins were immunoblotted for Gα_i2 using mouse monoclonal antibody (Fig. 7, B1 (right)) or rabbit polyclonal antibody (Fig. 7, B2). Nef expression resulted in significant loss of Gα_i2 (Fig. 7B, left). Two immunoreactive bands of ∼53 and ∼63 kDa were seen in lysates of Nef-expressing cells, probably representing mono- and diubiquitinated native Gα_i2 (Fig. 7B, right).

We first evaluated the effects of Dynasore (41), a small molecular weight dynamin inhibitor, and the proteosome inhibitor, epoxomycin. We found that pretreatment with the inhibitors substantially reversed the Nef-induced loss of Gα_i2 (Fig. 7C).

Nef Co-localizes with E3 Ubiquitin Ligases AIP4 and Nedd4

Ubiquitination of agonist-occupied CXCR4 by the Nedd4-like E3 ubiquitin ligase AIP4 (42) primes it for traffic through the ESCRT pathway, ultimately resulting in lysosomal proteolysis (43, 44). We inquired whether Nef-induced endolysosomal trafficking of Gα_i2 was facilitated by these E3 ligase(s). We stained HeLa cells co-transfected with plasmids expressing YFP-tagged Gα_i2 or Gα_i3 and Nef-CerFP or CerFP with antibodies against AIP4 or NEDD4. There was extensive co-localization of Gα_i2 with Nef and AIP4 in the perinuclear area (Fig. 8A). There was a similar co-distribution of Nef and Gα_i2 with the NEDD4-positive region (Fig. 8B). In contrast, Gα_i3 was mostly at the PM, with no evidence of co-localization with Nef, AIP4, or NEDD4 (Fig. 8, A and B (bottom)).

FIGURE 8.

Nef recruits HECT domain E3 ligases, AIP4, or NEDD4 and facilitates Gα_i2 ubiquitination, presumably as a ternary complex. A, Nef co-localized with Gα_i2 but not with Gα_i3 in the AIP4-enriched perinuclear region. HeLa cells co-transfected with Nef-CerFP and YFP-tagged Gα_i2 or Gα_i3 were fixed, permeabilized, and stained with murine mAb against AIP4 followed by Alexa 647-conjugated anti-mouse IgG. B, Nef co-localizes with Gα_i2 but not Gα_i3 in NEDD4-positive regions in HeLa cells. Experimental details are as above except for the use of rabbit polyclonal antibody against NEDD4. Monochromatic images on the right in each row correspond to Nef-CerFP, YFP-tagged Gα_i2 or Gα_i3, and anti-AIP4 or -NEDD4 fluorescence with two-channel (like AIP4/NEDD4 and Gα_i2 or AIP4/NEDD4 and Nef, etc.) composite images shown on the left. 4× cropped RGB images (Nef-CerFP (R), Gα_i2- or Gα_i3-YFP (G), and AIP4/NEDD4 (B)) with arrows denoting vesicles showing maximal co-localization are shown on the far left in each row.

AIP4 Bound Gα_i2 through the HECT Domain of the E3 Ligase and to the Tetraglutamate and Polyproline Motif of Nef, Presumably through the WW Domain(s)

We evaluated the binding potential of AIP4 for Nef and Gα_i subunits in vitro and in vivo. In GST-Nef pull-down assays, AIP4 was recovered from Jurkat cell extracts in a specific and quantifiable manner (Fig. 9A, top). Like other members of the NEDD4 family of HECT domain E3 ligases, AIP4 has four WW domains (Fig. 9A, center), which preferentially bind to proline-rich PY motifs (45–47) or hyperphosphorylated C termini of PM receptors (44). Accordingly, GST-AIP4 bound poorly to Nef mutants with substitutions of the polyglutamate at position 62 (E62A) or the polyproline tract at position 72 (P72A) (Fig. 9A, bottom left). GST fusion proteins containing WT AIP4 or a deletion mutant that excised all four WW domains but retained the HECT domain bound Gα_i2 (Fig. 9A, bottom right).

FIGURE 9.

Biochemical and genetic analysis of Nef interaction in vivo with Gα_i2 and E3 ligases. A, Nef and Gα_i2 interacted with AIP4 in vitro. Shown is a schematic illustration (top) of GST-tagged WT AIP4 and mutants deleted for the WW or HECT domains (44). Jurkat cells were transfected with WT, M20A, E62A, P72A, or L164A Nef mutant, and cellular extracts were incubated with ∼22 pmol of GST or GST-AIP4 immobilized on agarose beads. GST-bound fractions and unselected lysate (2%) were analyzed for Nef by immunoblotting (left). Cellular extracts of Jurkat cells were reacted with equimolar amounts (∼22 pm) of GST-AIP4, GST-AIP4 ΔWW, GST-WW-I-IV, or GST alone. Bound fractions were analyzed by immunoblotting with anti-Gα_i2 mAb (right). Input, an aliquot of extract immunoblotted without selection. Numbers in both cases refer to bound fraction (%) averaged from two experiments. B, in vivo interaction of Nef with AIP4. Extracts of Jurkat cells cotransfected with FLAG-AIP4 and HA-tagged Nef or empty HA vector and immunoprecipitated with FLAG-mAb and Nef were identified by immunoblotting with rabbit anti-HA (top). Relative binding affinity of Nef mutants for AIP4 was evaluated in Jurkat cells cotransfected with GFP, FLAG-AIP4, and His₆-tagged WT or mutant Nef (bottom). Cellular extracts were bound to Ni²⁺-nitrilotriacetic acid beads, and the bound FLAG-AIP4 was detected by immunoblotting with anti-FLAG mAb. C, alternatively, Jurkat cells were cotransfected with GFP, FLAG-AIP4, and HA-tagged WT or mutant Nef. Extracts were immunoprecipitated with FLAG mAb, followed by immunoblotting with HA antibody. Data represent results from three experiments.

Next, we co-transfected Jurkat cells with expression vectors for FLAG-AIP4 and Nef-HA or a control plasmid. Immunoblotting FLAG immunoprecipitates prepared from lysates from co-expressing cells for Nef-HA revealed an interaction between them (Fig. 9B, top). Furthermore, mutations at the Nef motifs judged to be critical for in vitro binding to AIP4 were also impaired for in vivo binding (Fig. 9, B (bottom) and C).

From these observations collectively, we concluded that Nef facilitated Gα_i2 ubiquitination by recruitment of the NEDD4 class of HECT domain E3 ligases, presumably as a ternary complex of Nef, Gα_i2, and E3 ligases(s).

Nef-induced Loss of Gα_i2 Was Partially Reversed by Expression of Enzymatically Defective AIP4 or by siRNA Knockdown of AIP4 or NEDD4

To firmly establish the role of AIP4 in the Nef-induced Gα_i2 ubiquitination and degradation, Jurkat cells were co-transfected with Nef or an empty vector and WT or an enzymatically defective HECT domain mutant, AIP4-C830A (43, 48). AIP4-C830A overexpression reversed the Nef-mediated loss of Gα_i2 (Fig. 10A).

FIGURE 10.

Nef-induced loss of Gα_i2 was partially reversed by enzymatically defective AIP4 or by siRNA knockdown of AIP4 or NEDD4. A, the HECT domain mutant of AIP4 (C830A) reversed Nef-induced degradation of Gα_i2. Jurkat cells were nucleofected with CD8, FLAG-tagged WT, or C830A AIP4 mutant and HA-tagged Nef or empty HA vector. Extracts from cells adjusted for equivalent CD8 expression were analyzed by immunoblotting using mAb against Gα_i2 and anti-FLAG antibody for detecting AIP4. Numbers refer to relative (%) Gα_i2 amounts for the respective transfectants adjusted for equivalent CD8 expression. B, Nef-induced loss of Gα_i2 was partially reversed by siRNA knockdown of AIP4 or NEDD4. Transfected Jurkat cells were disrupted in 0.5 ml of lysis buffer, and extracts were resolved by SDS-PAGE followed by immunoblotting for actin, NEDD4, AIP4, Gα_i2, or Gα_i3. Numbers denote relative (%) pixel densities of Gα_i2 averaged from three experiments. C, siRNA knockdown of AIP4 or NEDD4 partially reversed Nef-induced inhibition of chemotaxis toward CXCL12. After a 48-h treatment with the respective siRNAs, Jurkat cells were cotransfected with GFP and Nef(−) or Nef(+) plasmid. Cells were evaluated for chemotaxis toward 20 nm CXCL12. Histograms represent pairwise comparison of relative (%) chemotaxis efficiency of GFP(+) Nef(−) versus Nef(+) (n = 3). D, siRNA knockdown of AIP4 or NEDD4 did not interfere with Nef-mediated CD4 down-regulation. Jurkat cell transfectants were analyzed for CD4 expression by flow cytometry. Relative (%) CD4 mean fluorescence values for Nef(+) and Nef(−) transfectants are plotted pairwise for each condition as histograms (with error bars). The mean fluorescence value for Nef(−) cells in each case was arbitrarily assigned as 100 (n = 3); *, p < 0.05 when compared with their respective plasmid (mock)-transfected controls.

We then compared the effect of siRNA knockdown of AIP4 or NEDD4 on Nef-induced loss of endogenous Gα_i2 in Jurkat and CEM cells. siRNA-induced reduction of AIP4 or NEDD4 E3 ligase reversed the Nef-induced Gα_i2 loss (Fig. 10B). Simultaneously, we evaluated chemotaxis of Nef versus non-Nef transfectants after siRNA knockdown of AIP4 or NEDD4. Nef-mediated chemotactic inhibition was partially rectified by NEDD4 knockdown, although not nearly as well as by the AIP4 knockdown (Fig. 10C). Silencing the E3 ligases did not affect cell viability or curtail other activities of Nef, such as CD4 (Fig. 10D) down-regulation.

Lysine at Position 296 Is the Critical Determinant of Gα_i2 Ubiquitination and Degradation in Nef-expressing Cells

Finally, we identified the potential lysine residue in Gα_i2 that may be targeted for ubiquitination by AIP4 in Nef-expressing cells, by evaluating the susceptibility to Nef of individual Gα_i2-YFP mutants that exchanged unique lysines for arginines at positions 296, 307, and 314. Jurkat cells were co-transfected with wild type or the respective LYS/ARG mutants with or without Nef. Immunoblotting for YFP showed that the LYS/ARG mutant, M1, was resistant to Nef-induced steady-state loss (Fig. 11A). In agreement, CXCL12-driven Ca²⁺ flux in M1 mutant-expressing cells was relatively more resistant than in the WT Gα_i2-YFP expressers (Fig. 11B). We then examined the subcellular distribution of WT Gα_i2-YFP versus the M1 mutant in HeLa cells co-expressing CerFP or Nef-CerFP. In the CerFP-expressing cells, WT and M1 were distributed at the PM. In Nef-expressing cells, a substantial fraction of WT but not M1 co-localized with Nef in the perinuclear region (co-localization correlation of >0.75 versus <0.125) (Fig. 11C).

FIGURE 11.

Lysine at position 296 of Gα_i2 is the critical determinant of Nef-induced degradation. A, the C-terminal 66 residues of Gα_i2 are shown at the top, with all lysines shaded and the three lysines unique to Gα_i2 denoted by asterisks. M1–M3, the respective lysine to arginine mutations engineered into the YFP-tagged Gα_i2. CEM cells were transfected with CD8, WT, or the indicated Gα_i2 mutant and HA-tagged Nef or empty HA vector. Extracts of transfected cells were adjusted for equivalent CD8 expression and analyzed by immunoblotting using mAb against YFP for detecting Gα_i2. Numbers at the bottom are relative (%) pixel densities of Gα_i2 averaged from two experiments. B, M1 mutant is more efficient than the WT Gα_i2-YFP in rectifying Nef-induced G-protein signaling (by intracellular Ca²⁺ flux) defect. CEM cells were nucleofected with CD8, and YFP-tagged WT or M1 Gα_i2 CD8 transfectants were analyzed for CXCL12-driven intracellular Ca²⁺ flux as described in the legend to Fig. 3. C, YFP-tagged WT, but not the M1 Gα_i2, was internalized and co-localized with Nef-enriched vesicular structures. HeLa cells in coverglass chambers were co-transfected with YFP-tagged WT or M1 Gα_i2 mutant with Nef-CerFP or CerFP and processed for live microscopy. Cerulean is green, and YFP is red.

DISCUSSION

Through multiple criteria, we have shown here that HIV Nef impairs G-protein signaling from chemokine receptors by selectively targeting Gα_i2 for ubiquitination and rapid endolysosomal destruction. Nef-induced loss of steady-state levels of Gα_i2 was observed in many cell types in the context of gene transfection, HIV infection, or Nef protein transduction. Lys/Arg substitution at each of the three unique lysines near the C terminus of Gα_i2 identified lysine at 296 as the crucial determinant of Nef-induced degradation. Nef-mediated loss of Gα_i2 was shown to be dependent on ubiquitination by AIP4, because it was reversed by overexpression of catalytically defective C830A AIP4 mutant, by siRNA knockdown of AIP4, or by use of proteosomal inhibitors or a dynamin antagonist. Previous reports have shown that, following agonist activation, CXCR4 is ubiquitinated by the NEDD4 class HECT domain E3 ubiquitin ligase AIP4 (but not NEDD4), which primes it for traffic through the ESCRT pathway, resulting in lysosomal proteolysis (43, 44). Nef recruits either E3 ligase for Gα_i2 ubiquitination without need for agonist treatment.

Nef bound Gα_i2 much better than other Gα species in vitro. Given the level of sequence homologies among Gα_i isoforms, it is not surprising that Nef bound to Gα_i3 at 4.8 pm concentration. But it occurred at relatively much higher concentrations of Gα_i3 compared with Gα_i2, indicating that Nef preferably binds to Gα_i2 rather than Gα_i3. We repeated the experiment with increasing concentration of GSTNef, and we found binding of Gα_i3 to Nef (data not shown). But this occurred at a concentration that is physiologically not relevant. Nef and Gα_i2 co-localized in vivo in perinuclear vesicles enriched for endolysosomal markers, which was further validated by increased FRET intensity between Nef-CFP and Gα_i2-YFP in the intracellular vesicular structures. There was also extensive co-localization of Nef with Gα_i2 (but not Gα_i3) and AIP4 (or NEDD4) in the same perinuclear vesicles. Taken together, these findings strongly implied that Nef-induced Gα_i2 ubiquitination occurs in a ternary complex of Nef, E3 ligase, and Gα_i2. AIP4 binding to substrates is mediated by its WW domain, which targets polyproline motifs like PPPY or PPXY (47, 49, 50) or phosphothreonine and phosphoserine residues (51). Our studies showed that AIP4 bound Gα_i2 through the HECT domain and Nef, presumably through the WW domain(s). Accordingly, AIP4 poorly bound Nef mutants that substituted the polyglutamate at 62 (E62A) or the polyproline tract at position 72 (P72A). This suggested that the Src homology 3 binding domain of Nef, with the PXXP motif, which has been demonstrated to be important for viral replication (52, 53), might be crucial for the down-regulation of Gα_i2. Additional residues surrounding the PXXP motif have been shown to affect the HIV replication and disease progression (54) and might account for the variation in the ability of various Nef alleles to down-regulate Gα_i2.

Ubiquitin-dependent degradation of G-proteins(s) was originally shown for the yeast Gpa1, a Gα equivalent (55–57), which was routed to multivesicular bodies for proteolysis. Mammalian Gα_o (58), Gα_i (59, 60), Gα_s (61, 62), and Gβγ (63, 64) subunits are presumed to be regulated by the proteasomal pathway; however, only Gα_s (61, 62), transducin Gβγ (64), and Gγ₂ (63) were shown to be ubiquitinated. To our knowledge, Nef-induced Gα_i2 loss represents the first instance where ubiquitination routes the G-protein for endolysosomal proteolysis. A systematic analysis of essential genes in yeast important for regulating G-protein signaling identified a preponderance of genes involved with protein degradation (65). Our results indicate that mammalian cells must also carefully control expression of the essential components in the G-protein signaling pathway and that HIV Nef has probably co-opted this mechanism that regulates Gα_i2 stability.

It was of interest that, although Nef spared Gα_i isomers other than Gα_i2, early G-protein signaling and chemotaxis defects perpetrated by Nef implied that other Gα_i isomers were not recruited for signaling in the different cell types we have used. This was further confirmed by siRNA knockdown of either Gα_i2 or Gα_i3, which resulted in a significant (∼60%) decrease in the agonist-mediated Ca²⁺ flux. Notwithstanding the paramount role(s) of Gα_i in immune cell trafficking, chemokine receptors can couple to other G-proteins to facilitate chemotaxis (66–68) in monocyte/macrophages. In addition, an alternative chemokine receptor pathway has been described for certain receptor/cell combinations in dendritic cells and neutrophils (69, 70) that is activated by Gα_i2 but was dependent on G_q proteins for optimal G-protein signaling and chemotaxis. Given that Gq stability and functionality were unaltered by Nef, migration of certain leukocyte subtypes, such as DCs and monocytes, might be differentially regulated in vivo.

Nef is a short-lived protein produced early in the HIV life cycle; Nef protein and fragments are packaged within nascent HIV particles and may be delivered to newly infected cells (71). Non-infected cells may also be subject to Nef effects either by its secretion by infected cells or by its transfer via intercellular nanotubular conduits from infected to non-infected cells, which can alter cellular function (72, 73) and membrane dynamics causing a transfer of infected cell signaling to recipient cells (74). The targeting of Gα_i2 for destruction by Nef in infected as well as in nearby non-infected cells provides several potential advantages for HIV. First, disabling responsiveness to chemoattractants prevents cells from leaving a nidus of infection, thereby promoting cell-to-cell spread of the virus. Second, because of the importance of T cell migration for T cell function, disruption of directed T cell migration will impair the induction of effective immunity. Third, a sharp reduction in Gα_i2 will impair the sequestration of Gβγ subunits. Freed Gβγ subunits can activate downstream effectors that can provide signals that promote viral replication as well as effect cell survival. Fourth, decreased Gα_i2 removes its tonic inhibition of adenylyl cyclase isoforms, increasing cAMP levels and PKA activity, which can also enhance HIV replication (75–77). Fifth, because heterotrimeric G-proteins also function in GPCR-independent signaling pathways involved in intracellular trafficking and cell division (78–80), Nef-induced Gα_i2 loss may impact T cell function by affecting these pathways.

Although the Nef-induced chemotaxis defect may derive in part from its effects on other signaling events, such as PAK2-mediated cofilin deregulation (29) or inappropriate DOCK2/ELMO1-driven Rac activation uncoupled from chemokine receptor signaling (24), we have shown that Nef-induced loss of Gα_i2 probably trumps these because it impacts the earliest events in chemokine signaling. HIV, by expressing Nef, has chosen to target Gα_i2 for destruction. Nef probably does so by usurping a normal cellular mechanism that regulates Gα_i2 stability. Nef-induced loss of Gα_i2 in lymphocytes will profoundly affect their function and may impact signaling pathways that impact HIV replication.