Skip to main content
BMC Genetics logoLink to BMC Genetics
. 2012 Aug 15;13:72. doi: 10.1186/1471-2156-13-72

Pseudogenization of the MCP-2/CCL8 chemokine gene in European rabbit (genus Oryctolagus), but not in species of Cottontail rabbit (Sylvilagus) and Hare (Lepus)

Wessel van der Loo 1,2,, Sandra Afonso 1,3, Ana Lemos de Matos 1,2,3, Joana Abrantes 1,2,4, Pedro J Esteves 1,5
PMCID: PMC3511233  PMID: 22894773

Abstract

Background

Recent studies in human have highlighted the importance of the monocyte chemotactic proteins (MCP) in leukocyte trafficking and their effects in inflammatory processes, tumor progression, and HIV-1 infection. In European rabbit (Oryctolagus cuniculus) one of the prime MCP targets, the chemokine receptor CCR5 underwent a unique structural alteration. Until now, no homologue of MCP-2/CCL8a, MCP-3/CCL7 or MCP-4/CCL13 genes have been reported for this species. This is interesting, because at least the first two genes are expressed in most, if not all, mammals studied, and appear to be implicated in a variety of important chemokine ligand-receptor interactions. By assessing the Rabbit Whole Genome Sequence (WGS) data we have searched for orthologs of the mammalian genes of the MCP-Eotaxin cluster.

Results

We have localized the orthologs of these chemokine genes in the genome of European rabbit and compared them to those of leporid genera which do (i.e. Oryctolagus and Bunolagus) or do not share the CCR5 alteration with European rabbit (i.e. Lepus and Sylvilagus). Of the Rabbit orthologs of the CCL8, CCL7, and CCL13 genes only the last two were potentially functional, although showing some structural anomalies at the protein level. The ortholog of MCP-2/CCL8 appeared to be pseudogenized by deleterious nucleotide substitutions affecting exon1 and exon2. By analyzing both genomic and cDNA products, these studies were extended to wild specimens of four genera of the Leporidae family: Oryctolagus, Bunolagus, Lepus, and Sylvilagus. It appeared that the anomalies of the MCP-3/CCL7 and MCP-4/CCL13 proteins are shared among the different species of leporids. In contrast, whereas MCP-2/CCL8 was pseudogenized in every studied specimen of the Oryctolagus - Bunolagus lineage, this gene was intact in species of the Lepus - Sylvilagus lineage, and was, at least in Lepus, correctly transcribed.

Conclusion

The biological function of a gene was often revealed in situations of dysfunction or gene loss. Infections with Myxoma virus (MYXV) tend to be fatal in European rabbit (genus Oryctolagus), while being harmless in Hares (genus Lepus) and benign in Cottontail rabbit (genus Sylvilagus), the natural hosts of the virus. This communication should stimulate research on a possible role of MCP-2/CCL8 in poxvirus related pathogenicity.

Keywords: Chemokines, Monocyte chemotactic protein, Pseudogene, Poxvirus, Myxomatosis, Oryctolagus, Bunolagus, Sylvilagus, Lepus

Background

The Lagomorph family of Leporidae (leporids) originated in the New World (Neoartics/Americas), an area which still is home to the most successful of living leporids i.e. species of Sylvilagus and Lepus. The genera Sylvilagus (cottontail rabbits) and Lepus (jack rabbits or hares) comprise numerous species, with Lepus having conquered also the Old World (Paleoartics/Afro-Eurasia) [1]. In contrast, typical Old World leporid genera tend to be monotypic, inhabiting isolated areas where many of them are listed as endangered [2]. The recent world-wide success of the European rabbit (Oryctolagus cuniculus), which in prehistoric times was confined to the Southwestern parts of the Iberian Peninsula, was largely, if not entirely, due to human activity [3-6].

The introduction of Myxoma virus (MYXV) during the midst of last century as a method of rabbit pest control had devastating effects on populations of European rabbit with reported mortality rates approaching 100% in Europe and Australia [7]. This was in sharp contrast to the very mild pathology caused by the virus in its natural host and reservoir, i.e. species of the genus Sylvilagus[8,9]. For Lepus species, only few cases of MYXV infections were reported and experiments in France have shown that most individuals are innately resistant, reviewed in [7]. In nature, infection with MYXV occurs through bites by flying or jumping insects. Replication of virus starts in MHC-II positive dendritic-like cells at the bite lesions and is passed on to T cells of lymph nodes draining the inoculation site [10]. The pathogenesis of MYXV infection apparently depends upon the aptitude of avoiding the spreading of infected cells throughout the lymphatic system. Whereas in cottontail rabbits MYXV infection remains localized, in ‘naïve’ European rabbits (below “Rabbit”)b, the MYXV infected cells rapidly spread to distal nodes. This results in a generalized leukocyte depletion, particular of CD4+ T cells, which leads to a systemic immunodepression with fatal outcome i.e. myxomatosis [11,12].

Leukocyte migration and trafficking are mainly governed through interactions of a variety of chemokines with their cellular receptors [13,14]. Insights in the parasite strategies of immune evasion offer major gateways for identifying genetic components of pathways allowing Cottontail rabbit to cope with MYXV infection. Studies of different research teams have shown that this virus encodes a number of proteins that manipulate factors of the innate immune system of the host, among them proteins interfering directly with chemo-attractive functions of the CC chemokines [15,16]. It shows that these proteins have played a role during the process of coadaptation between virus and host, and most likely still do. These findings have been of cardinal guidance in the search for host genes (candidate genes) that could make the difference between susceptible vs. resistant species.

MYXV is a large double-stranded DNA virus of the poxvirus family (genus Leporipoxvirus). There have been indications that the CCR5 receptor might play a crucial role during MYXV infection, as it is the case by HIV infection in human [17,18], although the experimental evidence for this has been disputed [19]. However as already mentioned, the variation of pathogenicity of the MYXV among leporid species does not depend upon the fact whether or not the virus can enter and replicate in the host cell, but more likely on a constellation of endogenous factors preventing or permitting the dissemination of infected cells throughout the lymphatic system [11,12]. Studies of pathways underlying the contrasting outcomes of MYXV infection may therefore contribute to a more general understanding of pathogenesis due to large DNA viruses in mammals, inclusive humans. In view of the importance of CCR2 and CCR5 receptors in HIV infection, genes controlling these receptors and their ligands might be prefigurative of such ‘candidate genes’. This led to the discovery of a gene conversion that altered the second external loop of Rabbit CCR5. This mutation occurred in the ancestral lineage of the Old World genera including Oryctolagus and Bunolagus, but not in the lineages of Sylvilagus and Lepus species [20,21]. Although these differences at CCR5 obviously do not arbitrate the entry of MYXV for lymphocytes, they might affect CCR5 related pathways of signal transduction [17-19]. Note that Bunolagus species being highly endangered, studying their susceptibility to myxomatosis proved impracticable [2].

We therefore have taken a closer look at the main ligands of the Rabbit CCR2 and CCR5 receptors which are the ‘macrophage inflammatory proteins’ chemokines (MIP’s) and the ‘monocyte chemotacticproteins’ (MCP’s). The excellent recent review of the gene organization of mammalian chemokines by Nomiyama and coworkers [22], while comprehensive by extending to non-eutherian mammals (Metatheria and Monotremata), did not include Lagomorpha (Rabbits and Hares). Indeed, chemokine data on Rabbit are incomplete and sometimes erratic (see below). The Rabbit Genome Project being recently completed at the Broad Institute at 7x coverage [23], we have assessed the Rabbit Whole Genome Sequence (WGS) data for orthologs of the mammalian genes of MIP-RANTES and MCP-Eotaxin. Our analyses based on nucleotide sequence similarity revealed that Rabbit possesses proper orthologs of three MCP encoding genes (CCL7, CCL8, and CCL13) which are not identified by gene finder methods used by GenBank. The non-annotation can indicate that in Rabbit these genes may have acquired singularities hampering transcription or disqualifying them as functional proteins. We have searched for such traits and, at the event, verified their presence or absence in species of the leporid genera Oryctolagus, Bunolagus, Sylvilagus and Lepus.

Results

The genes of the CC chemokine ligands (CCL) RANTES/CCL5, MIP-1a/CCL3, and MIP-1b/CCL4 are documented for Rabbit (Oryctolagus cuniculus) [GenBank: NC_013687_REGION:24922000.25085000]. They are located on chromosome 19 as a syntenic group [GenBank: NC_000017_REGION:34198000to34433100] and are in every respect (chromosomal location, gene organization, sequence similarity) orthologs of their mammalian counterparts cf. [22]. In contrast, the GenBank list of Rabbit orthologs of the mammalian MCP-Eotaxin encoding genes is limited to MCP-1/CCL2 and Eotaxin/CCL11 [Genbank: NC_013687 REGION:23720000.23798000].True orthologs of mammalian MCP-3/CCL7, MCP-2/CCL8, and MCP-4/CCL13 have not yet been identified (a print-out of the GenBank Features report is shown in Additional file 1). This is surprising because at least the first two chemokines seem to be functional in most, if not all mammal species studied [22], and in Human and Mouse are subject of intense investigations due to their importance in regulating inflammatory and anti-tumoral effects and for their role in HIV infection [24-28].

We will adopt the CCL nomenclature unless we are dealing with proteins. For most mammals, MCP encoding genes are organized as a syntenic group composed of the chemokine genes CCL2CCL7CCL11CCL8CCL13CCL1[22] (in that order; CCL1 serves here only as a syntenic marker). In Human the CCL2CCL1 encompassing syntenic group is located on chromosome 17 [GenBank: NC_000017.1_REGION:32582070.32690817]. The fragment of Rabbit chromosome 19 is homologous to this region [Genbank: NC_013687_REGION:23720000.23798000]. We will refer to it as “R-MCPgb”.

The pronounced interspecies similarity between the coding sequences allowed localizing the orthologs of the CCL2, -7, -11, -8, and -13 genes in the Rabbit genome. The exons positions are listed side by side for Rabbit and Human in Table 1. The sequence alignments can be consulted in Additional files, with annotations for the undocumented genes (CCL7: Additional file 2, CCL8: Additional file 3, CCL13: Additional file 4) or for the entire MCPgb regions as a ‘blunt' 108 kb alignment in FASTA format (Additional file 5).

Table 1.

Identification of gene structure of RabbitCCL2,-7,-11,-8,-13,-1genes based on Human orthologs

CHEMOKINE
 
 
P
GenB
 
 
sense
Species orcu$ orcu$     Hosa* Hosa*  
CCL2
 
 
 
 
 
 
 
hnmRNA
216
2031
 
 
227
2153
 
CDS-ex1
287
362
0.86
v
300
375
+
CDS-ex2
1066
1183
1.00
v
1172
1289
+
CDS-ex3
1534
1717
0.89
v
1627
1777
+
CCL7
 
 
 
 
 
 
 
hnmRNA
11534
13840
 
 
15171
17187
 
CDS-ex1
11603
11678
0.99
v
15241
15316
+
CDS-ex2
12913
13030
1.00
-
16096
16213
+
CDS-ex3
13429
13534
1.00
-
16647
16752
+
CCL11
 
 
 
 
 
 
 
hnmRNA
19375
22120
 
 
30618
33130
 
CDS-ex1
19509
19584
0.89
- v
30759
30834
+
CDS-ex2
20714
20822
1.00
v v
32046
32157
+
CDS-ex3
21217
21322
1.00
v v
32535
32640
+
CCL8-like
 
 
 
 
 
 
 
pseudogene
47126
49449
 
 
63997
66352
 
CDS-ex1
47576
47641
 
-
64452
64527
+
CDS-ex2
48337
48455
 
-
65219
65336
+
CDS-ex3
48872
48977
 
-
65752
65857
+
CCL13
 
 
 
 
 
 
 
hnmRNA
71995
73927
 
 
101402
103560
 
CDS-ex1
72083
72158
1.00
-
101477
101552
+
CDS-ex2
72902
73016
1.00
-
102425
102539
+
CDS-ex3
73361
73457
1.00
-
102976
103081
+
complCCL1
 
 
 
 
 
 
 
hnmRNA
74930
77383
 
 
105330
108183
-
CDS-ex3
75053
75155
1.00
-
105509
105611
-
CDS-ex2
76180
76291
1.00
-
106735
106846
-
CDS-ex1 77337 77412 0.91 - 108036 108111 -

$): pos 1 corresponds to position 23720000 of NC_013687.1.

*): pos 1 corresponds to position 32582070 of NC_000017.1.

The Rabbit genome fragment R-MCPgb containing the CCL2 and CCL1 genes is compared to its Human correlate according to the alignment in Additional file 5. The identification of the Rabbit orthologs of the Human CCL genes based on sequence similarity was checked for consistency using Genscan [29], which furthermore provided estimates of the quality of intron splice sites (values varying between 0 and 1 are shown under the heading “P”). Positions of transcription initiator and termination sites were estimated by homology with Human. The exons annotated in the GenBank feature file of the Rabbit sequence (Additional file 1) are marked “v” under “GenB”.

Orthologs of CCL7 and CCL13 exist and are similar among leporid species

Of the two isoforms of the “Rabbit A11 chemokine” annotated in the GenBank, “isoform 2” is orthologous to mammalian CCL11, whereas the “isoform 1” differs from CCL11 only by using as initiating exon a sequence located upstream between CCL2 and CCL11. Sequence alignments make it clear that this exon is orthologous to the initiating exon of mammalian CCL7 and at the same time reveal potential exons that are orthologs of the mammalian CCL7 exons 2 and 3. The mRNA transcripts of both CCL11 isoforms are also reported as ‘transcriptional variants 2’ [GenBank: XM_002719227.1] and ‘transcriptional variant 1’ [GenBank: XM_002719226.1].

We have evaluated the putative functionality of the CCL7, -11, and -13 genes, by submitting the R-MCP fragment to Gene Finder software, which did report three exons for each of five genes (CCL2, -7, -11, -13, and -1). All exons were localized exactly as previously inferred by sequence similarity (Table 1). The predicted genes were confirmed by testing specimens of Oryctolagus and Lepus for correct transcription of the CCL7 gene by PCR amplification of cDNA. The CCL7 gene appeared to be transcribed as predicted in Table 1 (Figure 1). Although they are not identified as such, Ensembl.org reports a Rabbit sequence [Ensembl: ENSOCUG00000013412] and its translation [Ensembl: ENSOCUT00000013408] which correspond to transcripts of the CCL13 ortholog as defined in Table 1 (Figure 2; for detailed descriptions see Additional file 6). The fact this sequence was derived from cDNA implies that also the CCL13 gene is transcribed. We note the minor sequencing differences at the 3’ end of the sequence which might have to do with proximity of the reverse primer used for cDNA amplification.

Figure 1.

Figure 1

The rabbit ortholog of human CCL7 gene exists and is transcribed. The “A11 isoform 1” predicted by GenBank suggests that exon1 of the Rabbit ortholog of CCL7 uses preferentially exon2 and exon3 of CCL11 during transcription (Additional file 2). We show that cDNA of the leporid species (Oryctolagus cuniculus, Lepus granatensis and Lepus europaeus) contain a transcript uniting three exons orthologous to those of human CCL7 gene. The position of missing MCP-3 characteristic N-glycosylation site is underlined (N X S in other mammals). Variable amino acid residues are highlighted in gray.

Figure 2.

Figure 2

Lacking of N-terminal X-Pro motifs in Leporid MCP -4/CCL13. All known MCP genes encode a 24GlnPro25 (QP) motif which is required for post-transcriptional maturation and modification of the protein. The Rabbit CCL13 ortholog is unique by encoding a 24GlnThr25 motif (QT). This particularity appears to be shared among leporids, inclusive Sylvilagus. Leporid genomic DNA was amplified using CCL13 primers designed on R-MCPgb. orcuB: Rabbit, subsp. cuniculus, orcuA: Rabbit, subsp. algirus, syfl: Western Cottontail Rabbit, Legr: Granada Hare, Orcu ENS13408: [Ensembl: ENSOCUT00000013408]. The MCP-4 protein sequences of “other” mammals are derived from the CCL13 mRNA sequences listed in Additional file 9. eqca: horse, calu: dog, hosa: human, poab: orangutan, mamu: monkey, aime: giant panda.

Transcription alone does not necessarily warrant a functional gene product. The proteins deduced from Rabbit CCL7/MCP-3 and CCL13/MCP-4 CDS sequences show indeed structural anomalies which could disqualify them as functional MCP chemokines. Rabbit MCP-3/CCL7 misses an N-glycosylation site which is present in all known MCP-3 sequences [30]. As glycosylation of MCP-3 may affect its biological activity [31], the loss of the AsnXSer site (underlined in Figure 1) might impair normal chemokine function.

The situation is more problematic with MCP-4/CCL13. Mature MCP chemokines are derived from the precursor sequence after cyclization of the glutamine Gln24 residue, which is encoded by the 3’ end of exon1. In reports on the biological activity of MCP’s, the resulting N-terminal pyroglutamic acid (pGlu) is therefore referred to as pGlu1 rather than Gln24. Indeed, most reported MCP protein precursors (CCL2, -7, -8, and -13) are characterized by a 24GlnPro25 motif which after cyclization can further be modified by different types of metalloproteinases [32-34]. At the same time, pGlu blocks the action of serine protease peptidases, which in non-MCP chemokines recognize the ubiquitous Pro residue at position 2 of the NH2-terminus of the mature protein, by this way fine tuning their function [24,35]. The MCP-4/CCL13 precursor protein inferred from the R-MCPgb sequence is particular by showing a 24GlnThr25 motif instead of the canonical 24GlnPro25. Whereas a Gln24 residue is not a prerequisite of chemokine maturation (e.g. in Rodent MCP-2/CCL8 and Human Eotaxin/CCL11 it is replaced by Gly), the absence of a 24X-Pro25 motif is liable to prevent normal posttranslational processing.

However, we found by PCR of gDNA that these singularities encoded by the Rabbit CCL7 and CCL13 genes are shared among the different leporid genera studied, including Sylvilagus (Figures 1 and 2), making a contribution to species-specific variation in disease resistance highly unlikely.

Interestingly, the two Ensembl ENSOCU sequences mentioned were either designated as RABIT CCL8 or as Rabbit CCL7 (Additional file 6). The confusion about identifying the Rabbit CCL13 and CCL7 orthologs is probably due to the relatively large protein distances separating them from their mammalian correlates (Figure 2). Different methods of phylogenetic reconstruction produced nevertheless trees in which the paralogous genes did cluster according to orthology, inclusive the Rabbit genes (Figure 3). Bootstrap values were however very low. Incidentally, the branch lengths of Rabbit CCL7 and -13 nodes were about two times larger in comparison to the average branch length of the Rabbit CCL2, -8, and -11 nodes. Note that Leporid CCL8 is relatively well conserved (Figure 3).

Figure 3.

Figure 3

Gene orthology of CCL2 ,-7 , -11 , -8 , and -13 of placental mammals supported by phylogeny. The evolutionary history was inferred by using the Maximum Likelihood method conducted in MEGA5 [36]. The tree with the highest log likelihood (-4585.9908) is shown. Bootstrap values are placed next to the branches. Codon positions included were 1st + 2nd + 3rd and were limited to those encoding the mature chemokine. There were 231 positions in the final data set. Positions of leporid branches are highlighted by triangles ▴ for functional, or by ∇ for pseudogenes. Taxon names of sequences obtained in this study are extended by ‘gDNA’ when derived from genomic DNA or by ‘cDNA’ when (also) derived from cDNA. All other sequences represent a sample of mRNA sequences listed in Additional file 9. Mouse CCL12 and CCL8 are located between the CCL11 and CCL1 genes and are likely duplicates of the ortholog of murid CCL8[22].

We conclude that Leporid orthologs of CCL7 and CCL13 exist and are transcribed but that their contribution to species-specific disease resistance is unlikely.

The Rabbit ortholog of CCL8 exists but is pseudogenized

Sequence alignments of mammalian CCL8 mRNA (at least for swine, horse, cow, panda, human and dolphin) identify clearly a single region of outstanding CCL8 homology within R-MCPgb. It is located between the CCL11 and CCL13 genes, as is the case for CCL8 in most, if not all mammals for which this has been checked [22]. It is interesting that gene orthology was much better revealed when the untranslated regions (UTR’s) were included. This is illustrated in Figure 4. Whereas the coding regions of CCL8 show pronounced cross-paralog similarity with at least CCL2, -7, and -11, the UTR’s are highly gene specific.

Figure 4.

Figure 4

Fishing the Rabbit CCL8 ortholog using NCBI Blast-Align. Human CCL8 mRNA is compared to the Rabbit genomic fragment containing both the CCL2 and the CCL1 region (R-MCPgb). The graphical representation visualizes the outstanding similarity of one genomic region covering the human RNA transcript almost entirely. At the same time it localizes other structurally related regions and reveals that compared to the coding regions, untranslated region (UTR’s) might be more gene-specific. The graph was produced using the online facilities offered by NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi; option: Align).

The comparison of the Rabbit CCL8 sequence with its mammalian counterparts (Figure 5) reveals several deleterious mutations at exon1 and exon2, as well as at intron2. At exon1 the initiating methionine codon (ATG) was mutated into an isoleucine codon (ATA) and the CAG codon of the canonical GlnPro motif (CAG.CCA) at the 3’ end of the exon was changed into TAG. This premature stop codon is however put out of frame by a 10 base pair (bp) deletion, which incidentally transforms the in-frame LeuSer codons (CTG.AGC) into a premature stop codon (c.TGA.gc). The 3’ part of exon2 is corrupted by a 1 bp insert, while the GT donor site of intron2 is mutated into AT. In addition, the codon of the third of the four characteristic cysteine residues (TGT) was altered into arginine (CGT), or histidine (CAT) in some wild rabbits (Figure 6). At this position, a cysteine residue is mandatory for the formation of a disulfide bound with the first cysteine of the characteristic cysteine pair [37] and present in all CC chemokines.

Figure 5.

Figure 5

The Rabbit ortholog of mammalian CCL8 exist as a pseudogene. The “Orcu WGS” sequence shows parts of the exon embedding fragments of R-MCPgb region with outstanding similarity with mammalian MCP-2/CCL8 gene (Figure 4). The alignment with functional mammalian CCL8 clarifies the pseudogenization of Rabbit CCL8 gene. Exon regions are highlighted in gray, disabling mutations are highlighted in black. orcu: rabbit, hosa: human, susc: swine. The protein sequence shown is inferred from the susc_CCL8 sequence. Insertions were added at exon2 in order to maintain the reading frame. Open spaces are introduced at exon boundaries. ‘.’: identity with leader sequence, ‘-‘: deletions/insertions.

Figure 6.

Figure 6

Gene variation at the CCL8 locus within and among leporids. PCR products of leporid specimens were obtained using either gDNA or cDNA and are aligned with the CCL8ps sequence of rabbit WGS. Potential Stop and Translation Initiating codons are underlined. The positions of the cDNA primers are bold underlined. ‘Orcu CCL8ps’ represents the consensus of 11 haplotypes of Oryctolagus cuniculus specimens of both subspecies (O. c. cuniculus and O. c. algirus), after excluding one haplotype that was identical to CCL8ps of WGS (OccTar109allele1) and ignoring singletons (i.e. nucleotide differences observed only once). Occ: Oryctolagus cuniculus; Bumo: Bunolagus monticularis; Syfl: Sylvilagus floridanus; Leti: Lepus timidus; Legr: Lepus granatensis; Leeu: Lepus europaeus. ‘.’: identical to leader sequence; ‘-‘: indel. The data shown are limited to the exon containing fractions. An alignment of the entire 1.6Kb gene region is presented in Additional file 7.

A first question was in how far the WGS CCL8 sequence is representative of the species, and if so, whether this situation is limited to the genus Oryctolagus. In order to assess the distribution and history of this apparent gene loss, we designed primers for each exon of the Rabbit CCL8 ortholog (see Methods). By PCR we obtained the CCL8 pseudogene (CCL8ps) DNA sequences of wild rabbits of both subspecies Oryctolagus c. cuniculus and Oryctolagus c. algirus. These rabbits were collected in the original distribution range of the genus (i.e. the Iberian Peninsula), where the gene diversity is much greater than in domestic and wild rabbits of the more recent areas of Rabbit colonization [38,39]. The PCR products confirmed that the CCL8 ortholog is pseudogenized in all Rabbit genomes studied. Individual variation was observed. Only one rabbit showed a sequence identical with the CCL8 sequence of R-MCPgb. It is interesting that for a majority of wild rabbits, the CCL8 genes appeared as “less” derived compared to the Thorbecke rabbit of the WGS files (Figure 6). While all genomes studied showed the initiation site mutation ATG->ATA, many of them did not show the 10 bp deletion at exon1, and the vast majority did feature the canonic 24GlnPro25 codons instead of the in-frame stop codon of the WGS sequence. Moreover they disposed of one or even two Met(ATG) in-frame codons, which could possibly provide a rescue initiation site (Figure 6).

The situation is more clear-cut at exon2. The three deleterious mutations were present in all Rabbit haplotypes: (1) the altered third mandatory cysteine codon, (2) the 1 bp insert, and (3) the donor site alteration. On the other hand, at least two genomes showed the loss of the characteristic CysCys motif of exon2 (TGCTGC->TGCTCC), a deleterious mutation not present in the WGS Rabbit. The alignment with wild rabbit sequences furthermore revealed an interesting 33 bp insertion in the WGS sequences, which went unnoticed in previous alignments with non-leporid sequences (Figure 5). This insert was present in both subspecies, although not in all specimens. It results from an exact direct repeat at the junction exon2-intron2, spanning the 1 bp insert and the donor site mutation. Because both of these disabling mutations were present in all rabbit haplotypes, and repeated in the insert, the duplication is most likely more recent. This also applies to the 10 bp deletion at exon1 (you can’t delete nor duplicate what didn’t already exist). It indicates that the latter are consequences of a prior loss of functionality, and are part of a process of pseudogenization.

The terminating exon3 was found to be potentially “functional” in all rabbits studied.

The Rabbit CCL8 has been pseudogenized for more than 4 million years

These deleterious mutations are shared among both Rabbit subspecies O. c. cuniculus and O. c. algirus. These subspecies did separate about 2 My ago [40,41], implying that the pseudogenization of CCL8 must be relatively old and possibly older than the genus. This was corroborated by the CCL8 sequence obtained with one Riverine Rabbit, Bunolagus monticularis, which showed all four deleterious mutations shared among Oryctolagus. The pseudogenization must precede the genus split of Bunolagus and Oryctolagus which occurred an estimated 4 My ago [40,42].

We note in both haplotypes of the Bunolagus specimen the absence of the 10 bp deletion at the 5’ region of exon1 and of the 33 bp direct repeat at the 5’ region of intron2 of Rabbit CCL8 (Figure 6). It further supports the viewpoint that the two occasional indels occurred after the initial pseudogenization. The Bunolagus CCL8 pseudogene differs however from that of Oryctolagus by the absence of a theoretical ‘rescue’ initiator codon (ATG->ACG) in exon1, and the loss of the TATA box (TATAAA->TgTgAA), which Oryctolagus shares with many mammalian CCL8 genes.

MCP-2/CCL8 appears to be functional in Lepus and Sylvilagus species

The next question was whether the CCL8 gene is also pseudogenized in species of leporid lineages that do not share the CCR5 mutation with rabbit. As mentioned before, these species are also those that are resistant to MYXV. Using the primer sets designed for amplifying the three Rabbit-CCL8ps exons, we found that all haplotypes obtained with two Lepus specimens and three Sylvilagus specimens possess a CCL8 ortholog which does not show any disabling mutations. The CDS consensus sequences are shown in alignment with Rabbit sequences (see Figure 6). The same alignment including the complete UTR’s and intron regions can be found in Additional file 7. The usual amino acid numbering of mature MCP-2 protein is shown in the alignment presented in Figure 7.

Figure 7.

Figure 7

Comparing mature MCP2 proteins of Leporid and Other-Mammals. The consensual numbering of amino acid positions used in functional studies of MCP ligands is shown (e.g. [32]). Pseudogenes are translated according to a nucleotide alignment respecting the reading frame of functional homologs. Positions where leporid MCP-2 differs markedly from the mammalian consensus are highlighted in gray if inferred from ‘functional’ genes, or in black in case differences would be limited to pseudogenes. leeu: European brown hare, legr: Granada hare; syfl: Western cottontail rabbit; orcu: European rabbit, sps. cuniculus; oral: European rabbit, sps. algirus, bumo: South African Riverine rabbit. GenBank Accession of the underlying “Other-Mammal” sequences are listed in Additional file 9.

The functionality of the CCL8 gene was further evaluated by analyzing cDNA obtained with specimens of species Oryctolagus and Lepus. Although the primers were designed according to the Oryctolagus sequence, the expected CCL8 CDS sequences were obtained with both specimens of Lepus but not with cDNA of Oryctolagus. This failure was not due to the quality of the Rabbit cDNA, because successful PCR amplification of CCL7 was obtained using the same cDNA preparation with the appropriate primers (Figure 1). Tissue samples of Sylvilagus specimens were not suited for RNA extraction, but the extensive sequence similarity with Lepus CCL8 predicts correct splicing and gene transcription, which was also confirmed by gene finder software applied to the genomic sequences of both genera.

The Rabbit genome contains only one CCL8-like gene

A last question was whether functional CCL8-like genes might exist outside or within the R-MCPgb region studied. At least in mouse, cow and elephant the CCL8 genes are indeed duplicated, which, parenthetically, might be a further indication of their relative importance (in mouse they are named CCL12 and CCL8, although CCL12 is more similar to mammalian CCL8; Figure 3). By blasting the (entire) Rabbit WGS database (inclusive the Trace File Archives) with the Rabbit-CCL8 sequences here presented, at the exception of full identity with the actual query, highest similarities were obtained with sequences of the CCL11 and CCL7 genes embedded in the R-MCPgb fragment. It strongly suggests that there is no other CCL8-like gene in the entire genome of the specimen studied in the Rabbit Genome Project.

We can therefore ascertain that the unique ortholog of the mammalian CCL8 gene is pseudogenized in the Old Word leporid genera Oryctolagus and Bunolagus, while potentially functional in Sylvilagus and Lepus species and, at least in Lepus, being correctly transcribed.

Discussion

We show that both MCP-2/CCL8 and CCR5 were altered in lineage of Oryctolagus and Bunolagus due to apomorphic mutations which did not occur in the lineage comprising species of Sylvilagus and Lepus. It implies that the species known to be reservoirs of MYXV, i.e. S. brasiliensis and S. bachmani, dispose most likely of normal (plesiomorphic) CCR5 and CCL8 genes. Although such deductions are in line with current phylogenetic inference, they might be worthwhile to be verified, as falsification would imply the independent alteration of one or both of these genes in lineages separated in space and time for millions of years. Meanwhile we will assume that the CCR5 and CCL8 genes of the different Sylvilagus species do not differ significantly from those shared by the New World rabbits of this study.

The situation revealed by the presented data might orientate research towards the role of chemokine and their receptors in host species of MYXV and could lead to new insights in processes of parasite-host coadaptation. In mice MCP-2/CCL8 and CXCL12 were found to cooperate to attract hematopoietic progenitors of immune-regulatory dendritic cells [43] while Islam and coworkers [44] describe mouse MCP-2/CCL8 as crucial regulator of T(h)2 cell homing. In Human, MCP-2 is known to bind to chemokine receptors CCR1, CCR2 and CCR5 and can act as a potent inhibitor of HIV-1 infectivity [44-46]. More in particular, compared to other chemokines, MCP-2 was found the most efficient inhibitor of the HIV protein gp120 for CCR5 receptor binding [47,48]. Studies of the role of MCP chemokines in Human and Mouse revealed that inflammation is regulated by feedback mechanisms where proteases play an important role [24,33-35]. They act by removing the N-terminal tetra or penta peptide of MCP’s which can transform them into MCP antagonists. Different research groups reported that natural occurring posttranslational modified MCP-2/CCL8 products can completely (sic) block the chemotactic effects of intact MCP’s and of RANTES/CCL5, and have identified natural MCP-2(6-76) (cf. Figure 7) as a potent and functional CC chemokine inhibitor [28,33,34]. These studies have highlighted the role played by MCP-2 products in the subtle agonist-antagonist interplay with CC chemokine receptors, including CCR5.

In this context our data might fuel speculations about possible reasons underlying the permanent loss in Old World rabbits of an important gene function, which has been well preserved throughout mammalian evolution (cf. Figures 3 and 4; a CCL8-like gene has also been reported in bony fish [GenBank: BT048349]). One explanation could be that functions of CCL products can be redundant or interchangeable, at least in leporids, which would be at odds with the evolutionary perpetuation of CCL gene identity. More interesting is the hypothesis of a causal link between the appearance within the lineage of Old World rabbits of the alteration at the second external loop of CCR5 on one hand, and the pseudogenization of one of its prime ligands on the other. Both events are highly unusual and none of them did occur in the Sylvilagus-Lepus lineage, nor in any other studied species. Although the argument is somewhat circular - we looked at the CCL8 gene precisely because of the CCR5 alteration - it can offer a plausible explication for the knock-out of an otherwise prominent gene function over a period of more than 4 My (cf. Figure 3). If “lost by accident”, the CCL8 gene could during this period have been repaired by back-mutations or by gene conversion with one of its neighbors. One might consider that receptor alteration occurred first, making CCL8 either useless or even detrimental, allowing or forcing its permanent pseudogenization. Or on the contrary, the CCL8 gene knock-out, and the consecutive perturbation of CCR5-dependent signaling pathways (e.g. due to the loss of a potential (ant)agonist of other CCR5 ligands such as Rantes/CCL5), may have favored structural change at its orphaned target (i.e. at the second external loop of CCR5). Regardless of the scenario, we could be facing an irreversible situation where a “gene knock-out” resulted in a gene “lock-out”. Indeed gene repair would not be favored by selection if the recovered ligand can no longer recognize its receptor (why repair the key if the lock has changed). It might therefore be interesting to know to what extent, if at all, the receptor mutation impairs the affinity of the different CCR5 ligands.

A further question beyond our competence is whether, when, and in which cellular environment CCL8 is expressed in Sylvilagus during MYXV infection and how, at the event, it contributes to the clearance of infected lymphocytes. In this context it might be interesting to mention that MCP-2 expression was down regulated in human HIV infected brain cells by miRNA146a [49], a microRNA which we found to be present in Rabbit (the miRNA146a sequences are identical among Human and Rabbit and are localized in same chromosomal region; WvdL unpublished observations).

Conclusions

The large number of host-specific immunodulatory proteins encoded by MYXV implies multiple levels of elaborate interactions between the virus and its natural host which can be the outcome of thousands of years of co-adaptive evolution. Identifying the constituents of this interplay remains a huge challenge, as host factors involved can be even more numerous. It might therefore be worthwhile to consider that the knock-out of a single host factor could severely affect this virus-host equilibrium. Given that monocyte chemotactic proteins control patterns of leukocyte migration, which in turn govern the outcome of MYXV infection in rabbits, the observation of a factual correlation between the near absence of MYXV virulence and the concurring presence of a functional MCP-2/CCL8 and an ‘intact’ CCR5 gene, could promote studies on the role played by this particular chemokine ligand-receptor interaction in keeping Myxoma virus under control.

Methods

Tissue samples specimens of leporid species belonging to genera Oryctolagus, Lepus and Sylvilagus were provided by CIBIO Lagomorph Tissue Collection maintained by Paulo C. Alves (CIBIO, Vairão, Portugal; http://pcalves@mail.icav.up.pt). Species and sample names are listed in Table 2. All samples are from wild populations.

Table 2.

Species names and their abbreviations, and sample names (inclusive geographic origin), of studied specimens

Species: References and sample names:
European rabbit:
 
Oryctolagus c. cuniculus (Occ):
OccTar104, OccTar109, OccAlt104, OccZrg18 (Spain)
Oryctolagus c. aligirus (Oca) :
OcaPan3, Ocaped1, OcaPed9, OcaMert35 (Portugal),
 
Oca32 c), OcaHue54 (Spain)
South African Riverine rabbit:
 
Bunolagus monticularis (Bumo):
Bumo, one sample of gDNA donated by Mathew, South Africa.
Cottontail rabbit:
 
Sylvilagus floridanus (Syfl) -:
Syfl-161, Syfl-162, Syfl-172
Hare:
 
Lepus timidus (Leti) :
Leti2012, Leti2191 (Finland)
Lepus granadensis (Legr)
Legr2c, Legr6c, Legr2016. Legr2061 (Portugal),
 
LegrCrd905 (Spain),
Lepus europeus (Leeu) : Leeu1c, Leeu2c (Spain)

c) sources of cDNA, all others were sources of gDNA.

gDNA

For the genomic DNA extraction of Oryctolagus (9 specimens) and Lepus (5 specimen) we used liver tissues preserved at -20°C in RNA stabilizing medium. We were privileged by the generous gift of Bunolagus gDNA prepared by Conrad Mathee. For Sylvilagus we only disposed of blood clots with mRNA not suitable for cDNA synthesis. Genomic DNA was extracted using the EasySpin Genomic DNA Minipreps Tissue Kit (Citomed) according to manufacturer’s instructions.

cDNA

Total RNA was prepared for one wild rabbit (Oryctolagus cuniculus algirus: Oca32), and four hares (genus Lepus). The hare specimens represent two species: Iberian hare (Lepus granatensis: Legr2, Legr6) and European brown hare (Lepus europaeus: Leeu1, Leeu2). RNA was extracted using the guanidinium thiocyanate-phenol-chloroform extraction method (TRIzol) according to manufacturer’s instructions (Molecular Research Center, Inc., Cincinnati, OH, USA). Next, first strand cDNA was prepared from 5 μg of RNA and synthesized using oligo (dT) primers [50]. The putative CCL8 and CCL7 transcripts were PCR-amplified using a primer set located in the UTR regions.

PCR

Primers were designed according to the R-MCPgb fragment of the Rabbit chromosome 19 [GenBank: NC_013687.1_REGION:23720000.23798000], using the online software Primer-Blast provided by NCBI [51]. For amplification of genomic CCL8, primers were designed separately for each of the three exons, in a way covering all coding and intron regions (see Figure 8). Primer pairs are listed in Table 3. PCR methods were standard. Details are given in Additional file 8. For the sequencing reactions we used ABI PRISM BigDye Terminator v3.1 Cycle Sequencing Kit and protocols were followed according to the manufactures. The sequencing reactions were cleaned with Sephadex™ from GE Healthcare Life Sciences. Sequencing was performed on an ABI PRISM 310 Genetic Analyser (PE Applied Biosystems). PCR products were sequenced in both directions.

Figure 8.

Figure 8

Schematic presentation of primer positions on the rabbit CCL8 ortholog. Primers were designed to cover all exon and intron regions of the proposed Rabbit ortholog of the Human CCL8 gene (1634 bp) [Genbank NC_013687.1:REGION:23767421.23769054]. ‘>’: position of forward primer; ‘<’: of reverse primer; ‘ps’: PCR fragment length.

Table 3.

List of primer pairs

Gene Exon Primer name Sequence R-MPCgb
gDNA
 
 
 
 
CCL8
ex1
FwPrCL8e1
5’ AGCACACGCAGGGTCTTGCT 3’
47421-47440§
 
 
RvPrCL8e1a
5’ ATGGCTCCCACTTGGATGGC 3’
47692-47711
 
 
RvPrCL8e1b
5’ TCGACCCCGTGGGCTGGTAG 3´
48091-48110
 
ex2
FwPrCL8e2a
5’ GCATCCAGCACGGTGGCTGT 3’
48021-48040
 
 
RvPrCL8e2a
5’ GCCAGCCCTTGCTCCTTGGG 3’
48774-48793
 
ex3
FwPrCL8e3b
5’ GGCTCCAGGTGCTTCAGCCA 3’
48659-48678
 
 
RvPrCL8e3b
5’AGTACCCAGGGAAGGCTGGG 3’
49034-49054
CCL13
ex1
F1CL13e1
5’ TTGGCTCTCCCGTGGCAGCA 3’
72054-72073
 
 
R1CL13e1
5’ GGCCAGCACTATGGCGCAGT 3’
72537-72556
 
 
F9CL13e1
5’ AGGCAGCAAGCATGGGAGCG 3’
71722-71741
 
 
R9CL13e1
5’ GGGCCCTTTGGCTTAGAAGGCG 3’
72226-72206
cDNA
 
 
 
 
CCL8
CDS
FwCCL8_CDS
5’ CTCCAAGCTCGGCTCCTTG 3’
47548-47566
 
 
RvCCL8_CDS
5’ ACTCTGAGTCTCAGTCCAGGTG 3’
48990-49011
CCL7
CDS
FwCCL7_CDS
5’ AGGCTGAGGCCAGCACAGGA 3’
13720-13739
    RvCCL7_CDS 5’ TCCTCCCCCATGCCAGTGCA 3’ 11541-11560

§ NC_013687.1 REGION:2376421.23767440.

Source of data

All sequence data except those produced in this study were obtained from GenBank database of the NCBI platform [52] or Ensembl [53]. The GenBank accession numbers of nucleotide sequences used in this study are listed in Additional file 9. Sequences produced in this study were submitted to GenBank and the accession numbers are listed in Table 4.

Table 4.

GenBank accessions of novel nucleotide sequences

Description GenBank Name GB Accession
Legr_CCL8_cDNA
CCL8_Legr2
JX000247
Leeu_CCL8_cDNA
CCL8_Leeu1
JX000248
Legr_CCL8_cDNA
CCL8_Legr6
JX000249
Leeu_CCL7_cDNA
CCL7_Leeu2
JX000250
Legr_CCL7_cDNA
CCL7_Legr6
JX000251
Occ_CCL7_cDNA
CCL7_Occ32
JX000252
Occ_CCL8_gDNA
CCL8gDNA_Occ_Tar109_1
JX000253
Occ_CCL8_gDNA
CCL8gDNA_Occ_Tar109_2
JX000254
Occ_CCL8_gDNA
CCL8gDNA_Occ_Alt104_1
JX000255
Occ_CCL8_gDNA
CCL8gDNA_Occ_Alt104_2
JX000256
Occ_CCL8_gDNA
CCL8gDNA_Occ_Tar102_1
JX000257
Occ_CCL8_gDNA
CCL8gDNA_Occ_Tar102_2
JX000258
Occ_CCL8_gDNA
CCL8gDNA_Occ_Zrg18_1
JX000259
Oca_CCL8_gDNA
CCL8gDNA_Occ_Zrg18_2
JX000260
Oca_CCL8_gDNA
CCL8gDNA_Oca_Pan3_1
JX000261
Oca_CCL8_gDNA
CCL8gDNA_Oca_Pan3_2
JX000262
Oca_CCL8_gDNA
CCL8gDNA_Oca_Ped1
JX000263
Oca_CCL8_gDNA
CCL8gDNA_Oca_Ped9_1
JX000264
Oca_CCL8_gDNA
CCL8gDNA_Oca_Ped9_2
JX000265
Oca_CCL8_gDNA
CCL8gDNA_Oca_Mert35_1
JX000266
Oca_CCL8_gDNA
CCL8gDNA_Oca_Mert35_2
JX000267
Oca_CCL8_gDNA
CCL8gDNA_Oca_Hue54
JX000268
Bumo_CCL8_gDNA
Bumo_CCL8
JX000276
Legr_CCL8_gDNA
Legr_CCL8
JX000277
Syfl_CCL8_gDNA
Syfl_CCL8_1
JX000279
Syfl_CCL8_gDNA
Syfl_CCL8_2
JX000280
Oca_CCL13_exon1_gDNA
Oca_Pan3x_CCL13ex1
JX020976
Oca_CCL13_exon1_gDNA
Oca_Pan3y_CCL13ex1
JX020977
Oca_CCL13_exon1_gDNA
Oca_Ped1_CCL13ex1
JX020978
Oca_CCL13_exon1_gDNA
Oca_Ped9_CCL13ex1
JX020979
Leti_CCL13_exon1_gDNA
Leti_2061_CCL13ex1
JX020980
Syfl_CCL13_exon1_gDNA
Syfl_161_CCL13ex1
JX020981
Syfl_CCL13_exon1_gDNA
Syfl_162_CCL13ex1
JX020982
Syfl_CCL13_exon1_gDNA
Syfl_171x_CCL13ex1
JX020983
Syfl_CCL13_exon1_gDNA
Syfl_171y_CCL13ex1
JX020984
Syfl_CCL13_exon1_gDNA Syfl_176_CCL13ex1 JX020985

Sequences were obtained by PCR using either genomic DNA (gDNA) or reverse transcribed mRNA (cDNA). Species names are indicated by abbreviations (Legr: Lepus granatensis; Leeu: Lepus europaeus; Leti: Lepus timidus; Bumo: Bunolagus monticularis; Syfl: Sylvilagus floridanus; Oc: Orytolagus cuniculus). The two subspecies of Oryctolagus cuniculus are distinguished (Occ: O. cuniculus cuniculus; Oca: O. cuniculus algirus). Extensions (x and y) refer to reproducible sequence ambiguities in PCR products obtained from a same individual that can be explained by allelic variation. Legr_CCL8 is a consensus sequence of Legr2016 and Legr2061; Syfl_CCL8_1 and _2 are two putative alleles inferred from sequences obtained with Syfl-161, -162, -171, -172, -176.

Sequence analysis

Alignments were done using the online software “Align” provided by the NCBI site in combination with online software Dialign [54] and Clustal W as incorporated in the MEGA5 package [36] and improved by visual corrections using BioEdit [55]. Phylogenetic analysis shown was conducted using Maximum Likelihood method provided in MEGA5 [36]. The probability of gene transcription of undocumented CCL orthologs was evaluated with GenScan [29].

Endnotes

a) MCP-2/CCL8 and similar. Read: either the Monocyte chemotactic protein type 2 encoded by the gene CCL8, or the CCL8gene encoding the MCP-2 protein, depending on context. Maintaining the MCP nomenclature for proteins is preferred because used in studies of chemokines function.

b) Rabbit and rabbit: Species name are capitalized when used to avoid irrelevant repetitions of scientific names (European rabbit or Oryctolagus cuniculus). Thus “Rabbit genome” or “Rabbit sequences” but “rabbits were collected”. By analogy we write Human, Cottontail rabbit etc. depending on context.

Abbreviations

MIP: Macrophage inflammatory proteins; MCP: Monocyte chemotactic proteins; R-MCPgb: Rabbit MCP-Eotaxin WGS fragment [Genbank: NC_013687 REGION: 23720000.23798000]; MYXV: Myxoma virus; MHC-II: Major Histocompability Complex Class 2; HIV: Human Immunodeficiency Virus; CCL: CC chemokine ligand; CCR: CC chemokine receptor; WGS: Whole Genome Sequence; i.e.: In extenso, more in detail; e.g.: Exempli gratia, for example; cf.: Confer; indel: Insert or deletion in sequence comparisons.

Competing interests

The authors declare that they have no competing interests.

Authors’ contribution

WvdL conceived the study and its design and carried out the literature research, data mining and analysis, drafting and editing of the manuscript. The most important findings of present report were nevertheless produced by SA and ALM, who provided the new data which are the core of the paper. SA did the PCR amplifications and sequencing, revealing the existence of a potentially functional CCL8 gene in Lepus and Sylvilagus species. ALM contribution was the cDNA work, putting the corner stone to this study by showing that in these species the CCL8 gene is transcribed. PJE is the leader and JA one of the most inspiring members of the CIBIO Evolutionary Immunogenetic Group, and played an important role in coordinating and supporting the work of ALM and SA, and by critical commenting and stimulating discussion of the manuscript.

Supplementary Material

Additional file 1

GenBank Features file for RabbitNC_013687REGION: 23720000.23798000.

Click here for file (33.5KB, doc)
Additional file 2

Alignment of Oryctolagus cuniculus and Homo sapiens WGS sequences: identifying rabbit ortholog of human CCL7.

Click here for file (46KB, doc)
Additional file 3

Alignment of Oryctolagus cuniculus and Homo sapiens WGS sequences: identifying the rabbit ortholog of human CCL8.

Click here for file (50.5KB, doc)
Additional file 4

Alignment of Oryctolagus cuniculus and Homo sapiens WGS sequences: identifying rabbit ortholog of human CCL13.

Click here for file (45.5KB, doc)
Additional file 5

Alignment of MCP encoding regions of rabbit and human in Fasta format.

Click here for file (314.5KB, doc)
Additional file 6

Rabbit CCL13 ortholog named ‘ CCL8’ or ‘ CCL7’.

Click here for file (59.5KB, doc)
Additional file 7

Nucleotide variation at CCL8 genes within and among leporid species.

Click here for file (99KB, doc)
Additional file 8

Detailed PCR procedures.

Click here for file (38.5KB, doc)
Additional file 9

Genbank Accessions and Links of MCP-Eotaxin mRNA sequences of Placental Mammals used or consulted.

Click here for file (115.5KB, doc)

Contributor Information

Wessel van der Loo, Email: wvdloo@mail.icav.up.pt.

Sandra Afonso, Email: sandra.biotec@gmail.com.

Ana Lemos de Matos, Email: amatos@mail.icav.up.pt.

Joana Abrantes, Email: jabrantes@mail.icav.up.pt.

Pedro J Esteves, Email: pjesteves@mail.icav.up.pt.

Acknowledgments

We want to thank Paulo Alves and his staff for the maintenance of the Lagomorph tissue collection and Conrad Matthee for providing the sample of South-African Riverine rabbit. The Portuguese Foundation for Science and Technology supported the doctoral fellowship of ALM (SFRH/BD/48566/2008), the post-doctoral fellowships of JA (SFRH/BPD/73512/2010) and PJE (SFRH/BPD/27021/2006) and the project (PTDC/BIA-BEC/103158/2008).

References

  1. Lopez-Martinez N. Revision sistematica y biostratigrafica de los lagomorphos (Mammalia) del neogeno y cuaternario de España. Disputacion General de Aragon: Memorias del Museo Paleontologico de la Universidad de Zaragoza; 1989. [Google Scholar]
  2. Chapman JA, Flux JEC. Rabbits, hares and pikas: status survey and conservation action plan. IUCN/SSC Lagomorph Specialist Group (ed.) Oxford UK: Information Press; 1990. [Google Scholar]
  3. Rougeot J. Origin et histoire du lapin. Ethnozootechnie. 1981;27:1–9. [Google Scholar]
  4. Flux JEC. In: The European rabbit: The history of a successful colonizer. Thomson HV, King CM, editor. Oxford: Oxford Science Publications; 1994. World distribution; pp. 8–21. [Google Scholar]
  5. Callou C. Modifications de l'aire de répartition du Lapin (Oryctolagus cuniculus) en France et en Espagne, du Pléistocène à l'époque actuelle État de la question. Anthropozoologica. 1995;21:95–114. [Google Scholar]
  6. Monnerot M, Vigne JD, Biju-Duval C, Casane D, Callou C, Hardy C, Mougel F, Soriguer R, Dennebouy N, Mounolou JC. Rabbit and man: genetic and historic approach. Genet Sel Evol. 1994;26:167–187. doi: 10.1186/1297-9686-26-2-167. [DOI] [Google Scholar]
  7. Fenner F. Myxomatosis. Br Med Bull. 1959;15:240–245. doi: 10.1093/oxfordjournals.bmb.a069772. [DOI] [PubMed] [Google Scholar]
  8. Hyde RR, Gardner E. Infectious myxoma of rabbits. Am J Epidemiol. 1933;17:446-46. [Google Scholar]
  9. Regnery DC, Marshall ID. Studies in the epidemiology of myxomatosis in California IV: the susceptibility of six leporid species to Californian myxoma virus and the relative infectivity of their tumors for mosquitoes. Am J Epidemiol. 1971;94:508–513. doi: 10.1093/oxfordjournals.aje.a121348. [DOI] [PubMed] [Google Scholar]
  10. Best SM, Collins SV, Kerr PJ. Coevolution of host and virus: cellular localization of virus in myxoma virus infection of resistant and susceptible European rabbits. Virology. 2000;277:76–91. doi: 10.1006/viro.2000.0505. [DOI] [PubMed] [Google Scholar]
  11. Zúñiga MC. Lessons in détente or know thy host: the immunomodulatory gene products of myxoma virus. J Biosci. 2003;28:273–285. doi: 10.1007/BF02970147. [DOI] [PubMed] [Google Scholar]
  12. Stanford MM, Werden SJ, McFadden G. Myxoma virus in the European rabbit: interactions between the virus and its susceptible host. Vet Res. 2007;38:299–318. doi: 10.1051/vetres:2006054. [DOI] [PubMed] [Google Scholar]
  13. McFadden G, Graham K, Ellison K, Barry M, Macen J, Schreiber M, Mossman K, Nash P, Lalani A, Everett H. Interruption of cytokine networks by poxviruses: lessons from myxoma virus. J Leukoc Biol. 1995;57:731–738. doi: 10.1002/jlb.57.5.731. [DOI] [PubMed] [Google Scholar]
  14. Ransohoff RM. Chemokines and chemokine receptors: standing at the crossroads of immunobiology and neurobiology. Immunity. 2009;31:711–721. doi: 10.1016/j.immuni.2009.09.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Liu J, Wennier S, McFadden G. The immunoregulatory properties of oncolytic myxoma virus and their implications in therapeutics. Microbes Infect. 2010;12:1144–1152. doi: 10.1016/j.micinf.2010.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Spiesschaert B, McFadden G, Hermans K, Hans Nauwynck H, Van de Walle GR. The current status and future directions of myxoma virus, a master in immune evasion. Vet Res. 2011;42:76:1–18. doi: 10.1186/1297-9716-42-76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Lalani AS, Masters J, Zeng W, Barrett J, Pannu R, Everett H, Arendt CW, McFadden G. Use of chemokine receptors by poxviruses. Science. 1999;286:1968–1971. doi: 10.1126/science.286.5446.1968. [DOI] [PubMed] [Google Scholar]
  18. Masters J, Hinek AA, Uddin S, Platanias LC, Zeng W, McFadden G, Fish EN. Poxvirus infection rapidly activates tyrosine kinase signal transduction. J Biol Chem. 2001;276:48371–48375. doi: 10.1074/jbc.M108019200. [DOI] [PubMed] [Google Scholar]
  19. Johnston JB, Johnston JB, Barrett JW, Chang W, Chung CS, Zeng W, Masters J, Mann M, Wang G, McFadden G. Role of serine-threonine kinase PAK-1 in Myxoma virus replication. J Virol. 2003;77:5877–5888. doi: 10.1128/JVI.77.10.5877-5888.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Carmo CR, Esteves PJ, Ferrand N, van der Loo W. Genetic variation at chemokine receptor CCR5 in leporids: alteration at the 2nd extracellular domain by gene conversion with CCR2 in Oryctolagus, but not in Sylvilagus and Lepus species. Immunogenetics. 2006;58:494–501. doi: 10.1007/s00251-006-0095-4. [DOI] [PubMed] [Google Scholar]
  21. Abrantes J, Carmo CR, Matthee CA, Yamada F, van der Loo W, Esteves PJ. A shared unusual genetic change at the chemokine receptor type 5 between Oryctolagus, Bunolagus and Pentalagus. Conserv Genet. 2011;12:325–330. doi: 10.1007/s10592-009-9990-1. [DOI] [Google Scholar]
  22. Nomiyama H, Osada N, Yoshie O. The evolution of mammalian chemokine genes. Cytokine Growth Factor Rev. 2010;21:253–262. doi: 10.1016/j.cytogfr.2010.03.004. [DOI] [PubMed] [Google Scholar]
  23. Eli and Edythe L, Broad Institute of Harvard and MIT. Rabbit Genome Project. http://www.broadinstitute.org/scientific-community/science/projects/mammals-models/rabbit/rabbit-genome-project.
  24. Howard MZ, Galligan CL. An expanding appreciation of the role chemokine receptors play in cancer progression. Curr Pharm Des. 2004;10:2377–2389. doi: 10.2174/1381612043383935. [DOI] [PubMed] [Google Scholar]
  25. Loetscher P, Seitz M, Clark-Lewis I, Baggiolini M, Moser B. Monocyte chemotactic proteins MCP-1, MCP-2, and MCP-3 are major attractants for human CD4+ and CD8+ T lymphocytes. FASEB J. 1994;8:1055–1106. doi: 10.1096/fasebj.8.13.7926371. [DOI] [PubMed] [Google Scholar]
  26. Van Coillie E, Proost P, Van Aelst I, Struyf S, Polfliet M, De Meester I, Harvey DJ, Van Damme J, Opdenakker G. Functional comparison of two human monocyte chemotactic protein-2 isoforms, role of the amino-terminal pyroglutamic acid and processing by cd26/dipeptidyl peptidase IV. Biochemistry. 1998;37:12672–12680. doi: 10.1021/bi980497d. [DOI] [PubMed] [Google Scholar]
  27. Hellier S, Frodsham AJ, Hennig BJW, Klenerman P, Knapp S, Ramaley P, Satsangi J, Wright M, Zhang L, Thomas HC, Thursz M, Hill AVS. Association of genetic variants of the chemokine receptor CCR5 and its ligands, RANTES and MCP-2, with outcome of HCV infection. Hepatology. 2003;38:1468–1476. doi: 10.1016/j.hep.2003.09.027. [DOI] [PubMed] [Google Scholar]
  28. Struyf S, Proost P, Vandercappellen J, Dempe S, Noyens B, Nelissen S, Gouwy M, Locati M, Opdenakker G, Dinsart C. Synergistic up-regulation of MCP-2/CCL8 activity is counteracted by chemokine cleavage, limiting its inflammatory and anti-tumoral effects. Eur J Immunol. 2009;39:843–857. doi: 10.1002/eji.200838660. [DOI] [PubMed] [Google Scholar]
  29. Burge C, Karlin S. Prediction of complete gene structures in human genomic DNA. J Mol Biol. 1997;68:78–94. doi: 10.1006/jmbi.1997.0951. http://genes.mit.edu/GENSCAN.html. [DOI] [PubMed] [Google Scholar]
  30. Proost P, Wuyts A, Van Damme J. Human monocyte chemotactic proteins-2 and −3: structural and functional comparison with MCP-1. J Leukoc Biol. 1996;59:67–74. doi: 10.1002/jlb.59.1.67. [DOI] [PubMed] [Google Scholar]
  31. Yamamoto N, Tanabe Y, Okamoto R, Dawson PE, Kajihara K. Chemical synthesis of a glycoprotein having an intact human complex-type sialyloligosaccharide under the Boc and Fmoc synthetic strategies. J Am Chem Soc. 2008;130:501–510. doi: 10.1021/ja072543f. [DOI] [PubMed] [Google Scholar]
  32. Proost P, Struyf S, Wuyts A, Menten P, De Meester I, Lambeir AM, Scharpé S, Schols D, De Clercq E, Van Damme J. Isolation and identification of naturally modified C-C chemokinesMCP-1, MCP-2 and RANTES: effects of posttranslation modifications on receptor usage, chemotactic and anti-HIV-1 activity. Eur CytokineNetw. 1998;9:73–75. [PubMed] [Google Scholar]
  33. Proost P, Struyf S, Couvreur M, Lenaerts JP, Conings R, Menten P, Verhaert P, Wuyts A, Van Damme J. Posttranslational modifications affect the activity of the human monocyte chemotactic proteins MCP-1 and MCP-2: identification of MCP-2 (6–76) as a natural chemokine inhibitor. J Immunol. 1998;160:4034–4041. [PubMed] [Google Scholar]
  34. McQuibban GA, Gong JH, Wong JP, Wallace JL, Clark-Lewis I, Overall M. Matrix metalloproteinase processing of monocyte chemoattractant proteins generates CC chemokine receptor antagonists with anti-inflammatory properties in vivo. Blood. 2002;100:1160–1167. [PubMed] [Google Scholar]
  35. Dean RA, Cox JH, Bellac CL, Doucet A, Starr AE, Overall CM. Macrophage-specific metalloelastase (MMP-12) truncates and inactivates ELR+ CXC chemokines and generates CCL2, -7, -8, and −13 antagonists: potential role of the macrophage in terminating polymorphonuclear leukocyte influx. Blood. 2008;112:3455–3464. doi: 10.1182/blood-2007-12-129080. [DOI] [PubMed] [Google Scholar]
  36. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–1599. doi: 10.1093/molbev/msm092. http://www.megasoftware.net/ [DOI] [PubMed] [Google Scholar]
  37. Blaszczyk J, Coillie EV, Proost P, Damme JV, Opdenakker G, Bujacz GD, Wang JM, Ji X. Complete crystal structure of monocyte chemotactic protein-2, a CC chemokine that interacts with multiple receptors. Biochemistry. 2000;39:14075–14081. doi: 10.1021/bi0009340. [DOI] [PubMed] [Google Scholar]
  38. van der Loo W, Ferrand N, Soriguer RC. Estimation of gene diversity at the b locus of the constant region of the immunoglobulin light chain in natural populations of European rabbit (Oryctolagus cuniculus) in Portugal, Andalusia and on the Azorean Islands. Genetics. 1991;127:789–799. doi: 10.1093/genetics/127.4.789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Branco M, Ferrand N, Monnerot M. Phylogeography of the European rabbit (Oryctolagus cuniculus) in the Iberian Peninsula inferred from RFLP analysis of the cytochrome b gene. Heredity. 2000;85:307–317. doi: 10.1046/j.1365-2540.2000.00756.x. [DOI] [PubMed] [Google Scholar]
  40. Biju-Duval C, Ennafaa H, Dennebouy N, Monnerot M, Mignotte F, Soriguer R, El Gaied A, El Hili A, Mounolou JC. Mitochondrial DNA evolution in lagomorphs: origin of systematic heteroplasmy and organization of diversity in European rabbits. J Molec Evol. 1991;33:92–102. doi: 10.1007/BF02100200. [DOI] [Google Scholar]
  41. Geraldes A, Ferrand N, Nachman N. Contrasting patterns of introgression at X linked loci across the hybrid zone between subspecies of the European rabbit (Oryctolagus cuniculus) Genetics. 2006;173:919–933. doi: 10.1534/genetics.105.054106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Matthee CA, van Vuuren BJ, Bell D, Robinson TJ. A molecular supermatrix of the rabbits and hares (Leporidae) allows for the identification of five intercontinental exchanges during the Miocene. Syst Biol. 2004;53:433–447. doi: 10.1080/10635150490445715. [DOI] [PubMed] [Google Scholar]
  43. Nguyen Hoang AT, Liu H, Juaréz J, Aziz N, Kaye PM, Svensson M. Stromal cell derived CXCL12 and CCL8 cooperate to support increased development of regulatory dendritic cells following Leishmania infection. J Immunol. 2010;185:2360–2371. doi: 10.4049/jimmunol.0903673. [DOI] [PubMed] [Google Scholar]
  44. Islam SA, Chang DS, Colvin RA, Byrne MH, McCully ML, Moser B, Lira SA, Charo IF, Luster AD. Mouse CCL8, a CCR8 agonist, promotes atopic dermatitis by recruiting IL-5+ TH2 cells. Nat Immunol. 2011;12:167–177. doi: 10.1038/ni.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Moser B, Wolf M, Walz A, Loetscher P. Chemokines: multiple levels of leukocyte migration control. Trends Immunol. 2004;25:75–84. doi: 10.1016/j.it.2003.12.005. [DOI] [PubMed] [Google Scholar]
  46. D’Souza P, Harden V. Chemokines and HIV−1 second receptors. Nat Med. 1996;2:1293–1300. doi: 10.1038/nm1296-1293. [DOI] [PubMed] [Google Scholar]
  47. Premack BA, Schall TJ. Chemokine receptors: gateways to inflammation and infection. Nat Med. 1996;2:1174–1178. doi: 10.1038/nm1196-1174. [DOI] [PubMed] [Google Scholar]
  48. Blanpain C, Migeotte I, Lee B, Vakili J, Doranz BJ, Govaerts C, Vassart G, Doms RW, Parmentier M. CCR5 binds multiple CC-chemokines: MCP-3 acts as a natural antagonist. Blood. 1999;94:1899–1905. [PubMed] [Google Scholar]
  49. Rom S, Rom I, Passiatore G, Pacifici M, Radhakrishnan S, Del Valle L, Piña-Oviedo S, Khalili K, Eletto D, Peruzzi F. CCL8/MCP-2 is a target for mir-146a in HIV-1-infected human microglial cells. FASEB J. 2010;24:2292–2300. doi: 10.1096/fj.09-143503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Krug MS, Berger SL. First strand cDNA synthesis primed with oligo (dT) Methods Enzymol. 1987;152:316–320. doi: 10.1016/0076-6879(87)52036-5. [DOI] [PubMed] [Google Scholar]
  51. Rozen S, Skaletsky HJ. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology. Krawetz S, Misener S, editor. Totowa, NJ: Humana Press; 2000. Primer3 on the WWW for general users and for biologist programmers; pp. 365–386. http://www.ncbi.nlm.nih.gov/tools/primer blast. [DOI] [PubMed] [Google Scholar]
  52. Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW. GenBank®. Nucleic Acids Res. 2011;39:D32–D37. doi: 10.1093/nar/gkq1079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Flicek P, Amode MR, Barrell D, Beal K, Brent S, Chen Y, Clapham P, Coates G, Fairley S, Fitzgerald S, Gordon L, Hendrix M, Hourlier T, Johnson N, Kähäri A, Keefe D, Keenan S, Kinsella R, Kokocinski F, Kulesha E, Larsson P, Longden I, McLaren W, Overduin B, Pritchard B, Riat HS, Rios D, Ritchie GR, Ruffier M, Schuster M, Sobral D, Spudich G, Tang YA, Trevanion S, Vandrovcova J, Vilella AJ, White S, Wilder SP, Zadissa A, Zamora J, Aken BL, Birney E, Cunningham F, Dunham I, Durbin R, Fernández-Suarez XM, Herrero J, Hubbard TJ, Parker A, Proctor G, Vogel J, Searle SM. Ensembl 2011. Nucl Acids Res. 2011;39(Database issue):D800–D806. doi: 10.1093/nar/gkq1064. http://www.ensembl.org/index.html. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Brudno M, Steinkamp R, Morgenstern B. The CHAOS/DIALIGN WWW server for multiple alignment of genomic sequences. Nucl Acids Res. 2004;32:W41–W44. doi: 10.1093/nar/gkh361. http://dialign.gobics.de. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Hall T. Bioedit. v7th. 2011. pp. 1–3. http://www.mbio.ncsu.edu/bioedit/bioedit.html. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 1

GenBank Features file for RabbitNC_013687REGION: 23720000.23798000.

Click here for file (33.5KB, doc)
Additional file 2

Alignment of Oryctolagus cuniculus and Homo sapiens WGS sequences: identifying rabbit ortholog of human CCL7.

Click here for file (46KB, doc)
Additional file 3

Alignment of Oryctolagus cuniculus and Homo sapiens WGS sequences: identifying the rabbit ortholog of human CCL8.

Click here for file (50.5KB, doc)
Additional file 4

Alignment of Oryctolagus cuniculus and Homo sapiens WGS sequences: identifying rabbit ortholog of human CCL13.

Click here for file (45.5KB, doc)
Additional file 5

Alignment of MCP encoding regions of rabbit and human in Fasta format.

Click here for file (314.5KB, doc)
Additional file 6

Rabbit CCL13 ortholog named ‘ CCL8’ or ‘ CCL7’.

Click here for file (59.5KB, doc)
Additional file 7

Nucleotide variation at CCL8 genes within and among leporid species.

Click here for file (99KB, doc)
Additional file 8

Detailed PCR procedures.

Click here for file (38.5KB, doc)
Additional file 9

Genbank Accessions and Links of MCP-Eotaxin mRNA sequences of Placental Mammals used or consulted.

Click here for file (115.5KB, doc)

Articles from BMC Genetics are provided here courtesy of BMC

RESOURCES